Bacillus subtilis SHAN-1 with high yield of IAA and protease and application thereof

Abstract

The application discloses a bacillus subtilis SHAN-1 with high IAA and protease production and application thereof. The bacillus subtilis SHAN-1 provided by the application is salt-tolerant and has strong IAA and protease production capacity, and the application of the bacillus subtilis SHAN-1 to microbial fertilizer has a promoting effect on the growth of plants. In the aspect of microbial fermentation technology, the bacillus subtilis SHAN-1 can utilize peanut meal and other substances as fermentation substrates, and the fermentation product can obviously promote the growth of plants and increase the sugar accumulation of plant fruits, especially citrus fruits.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of microbial fermentation, in particular to a Bacillus subtilis SHAN-1 with high yield of IAA and protease and application thereof. BACKGROUND

[0002] Bacillus belongs to Firmicutes, and is a bacillus that can form spores (endospores), and has strong resistance to external harmful factors. At present, the most studied Bacillus includes Bacillus subtilis, Bacillus cereus, Bacillus thuringiensis, Bacillus anthracis, Bacillus alcalophilus, Bacillus amyloliquefaciens, Bacillus licheniformis and the like. Among them, Bacillus subtilis is a kind of multifunctional microorganism, which has multiple activities such as utilization of protein, fat, various sugars and starch. It has wide application in the fields of feed industry, sewage treatment, biological control, microbial fermentation technology and the like.

[0003] Auxin (indole acetic acid, IAA) is an important hormone for regulating plant growth, and its chemical nature is indole acetic acid, which is the earliest discovered hormone for promoting plant growth. IAA affects the division, elongation and differentiation of plant cells, controls the rooting and germination of plants, and affects the growth, maturation and aging of plant organs. Due to the low content of endogenous hormones in plants, it is impossible to extract them in large quantities and use them in agricultural production. Therefore, generating or synthesizing through other ways has become the development trend of modern agriculture. Protease is the most important industrial enzyme preparation, which can catalyze the hydrolysis of protein and polypeptide, and widely exists in animal viscera, plant stems and leaves, fruits and microorganisms. Protease preparation is mainly produced by microbial fermentation of Bacillus subtilis and Aspergillus terricola.

[0004] In the prior art, a Bacillus subtilis FM-20 capable of high-yield protease is disclosed in Chinese patent CN113549575A and is applied in the development of poultry feed, which has good effects of inhibiting the activity of harmful bacteria, resisting gastric acid and high temperature. A Bacillus subtilis capable of high-yield IAA and cellulase is disclosed in Chinese patent CN112980739A, and it is found that it has good application value in the biological control of pepper gray mold. At present, most of the reported Bacillus subtilis is applied in biological control and feed development, and there is little research on the application of Bacillus subtilis capable of high-yield IAA and protease in the fermentation of peanut meal, soybean meal and other protein agricultural and sideline products. Therefore, Bacillus subtilis and its application still need to be developed. SUMMARY

[0005] The primary purpose of the present application is to overcome the shortcomings and deficiencies of the prior art, and to provide a salt-tolerant Bacillus subtilis strain SHAN-1 capable of high-yield IAA and protease.

[0006] The second purpose of the present application is to provide a microbial agent containing the above-mentioned Bacillus subtilis SHAN-1 and / or its fermentation product.

[0007] The third purpose of the present application is to provide the application of the above-mentioned Bacillus subtilis SHAN-1 or microbial agent.

[0008] The purposes of the present application are achieved by the following technical solutions:

[0009] A Bacillus subtilis SHAN-1, which was preserved in the China General Microbiological Culture Collection Center of the Institute of Microbiology, Chinese Academy of Sciences, located at No. 1, Beichen West Road, Beijing City, on March 3, 2023, with the preservation number of CGMCC No. 26729.

[0010] A microbial agent containing the above-mentioned Bacillus subtilis SHAN-1 and / or the fermentation product of Bacillus subtilis SHAN-1.

[0011] Further, the fermentation product contains protease; and further, the protease is neutral protease.

[0012] Further, the fermentation product further contains auxin; the auxin has high activity; and further, when the fermentation product further contains auxin, the substrate before fermentation contains L-tryptophan.

[0013] Further, the fermentation product is obtained by fermenting peanut meal by Bacillus subtilis SHAN-1.

[0014] Furthermore, the fermentation product is obtained by fermenting peanut bran with Bacillus subtilis SHAN-1 and Saccharomyces cerevisiae.

[0015] Furthermore, the bacterial agent also contains pharmaceutically acceptable excipients.

[0016] The preparation of the fermentation product of Bacillus subtilis SHAN-1 includes the following steps:

[0017] The above-mentioned Bacillus subtilis SHAN-1 was inoculated into the fermentation substrate for fermentation.

[0018] Furthermore, the fermentation substrate includes a nitrogen source, a carbon source, and metal ions. The nitrogen source includes at least one of skim milk powder and ammonium sulfate. The carbon source includes at least one of glucose and maltose. The metal ions include Mg. 2+ Zn 2+ and Ca 2+ At least one of the following; further, the nitrogen source includes skim milk powder, the carbon source includes glucose, and the metal ion includes Mg. 2+ Furthermore, the nitrogen source comprises nitrogen with a concentration of 10 g·L⁻¹. -1 The skim milk powder, wherein the carbon source comprises a concentration of 5 g·L -1 The glucose, wherein the metal ions comprise 1 g·L -1 Mg 2+ .

[0019] Furthermore, when the fermentation product contains auxin, the fermentation substrate contains L-tryptophan.

[0020] Furthermore, the fermentation substrate includes peanut bran; and even further, the peanut bran is peanut bran that has undergone alkali hydrolysis and enzymatic hydrolysis.

[0021] Furthermore, the preparation of the fermentation product of Bacillus subtilis SHAN-1 includes the following steps:

[0022] (1) Peanut bran is added to water and alkali, and then subjected to alkali hydrolysis to obtain the alkali hydrolysis product;

[0023] (2) Take the alkaline hydrolysis product, adjust the pH to above 10, add enzyme, and perform enzymatic hydrolysis to obtain the enzymatic hydrolysis product;

[0024] (3) Take the enzymatic hydrolysis product, adjust the pH to 6.5-7.5, add bacterial suspension and culture medium, and ferment.

[0025] Furthermore, the alkaline hydrolysis conditions described in step (1) are: shaking culture at 50-70℃ and 300-400rpm for 10-15h; and even further, shaking culture at 60℃ and 350rpm for 12h.

[0026] Further, the enzyme in step (2) comprises at least one of alkaline protease and lipase.

[0027] Further, the concentration of the enzyme in step (2) is 3-10 g / L.

[0028] Further, the enzymolysis condition in step (2) is 25-75℃, 250-350 rpm, and the oscillation culture is 15-25 h; further, 50℃, 300 rpm, and the oscillation culture is 20 h.

[0029] Further, the bacterial suspension in step (3) comprises Bacillus subtilis SHAN-1 bacterial suspension; further, Saccharomyces cerevisiae bacterial suspension.

[0030] The preparation of the Bacillus subtilis SHAN-1 bacterial suspension comprises the following steps: inoculating Bacillus subtilis SHAN-1 into liquid fermentation medium, and oscillating culture at 30℃ and 180 rpm for 48 h; the liquid fermentation medium comprises L-tryptophan 200 mg·L -1 , skim milk powder 6.0-10.0 g·L -1 , glucose 5.0 g·L -1 , NaCl 4.0 g·L -1 , MgSO4·7H2O 1 g·L -1 , and K2HPO4 1 g·L -1 .

[0031] The preparation of the Saccharomyces cerevisiae bacterial suspension comprises the following steps: inoculating Saccharomyces cerevisiae into PDB medium, and oscillating culture at 28℃ and 180 rpm for 24 h.

[0032] Further, the medium in step (3) comprises liquid fermentation medium; further, PDB medium; the liquid fermentation medium comprises L-tryptophan 200 mg·L -1 , skim milk powder 6.0-10.0 g·L -1 , glucose 5.0 g·L -1 , NaCl 4.0 g·L -1 , MgSO4·7H2O 1 g·L -1 , and K2HPO4 1 g·L -1 .

[0033] Further, the fermentation condition in step (3) is 20-40℃, 300-400 rpm, and the fermentation is 40-60 h; further, 30℃, 350 rpm, and the fermentation is 48 h.

[0034] Use of the above-mentioned Bacillus subtilis SHAN-1 or the above-mentioned microbial agent in the preparation of a protease.

[0035] Use of the above-mentioned Bacillus subtilis SHAN-1 or the above-mentioned microbial agent in the preparation of an auxin.

[0036] Use of the above-mentioned Bacillus subtilis SHAN-1 in the preparation of a product for promoting plant growth.

[0037] Use of the above-mentioned Bacillus subtilis SHAN-1 or the above-mentioned microbial agent in promoting plant growth.

[0038] Use of the above-mentioned Bacillus subtilis SHAN-1 in the preparation of a product for promoting seed germination.

[0039] Use of the above-mentioned Bacillus subtilis SHAN-1 or the above-mentioned microbial agent in promoting seed germination.

[0040] Use of the above-mentioned Bacillus subtilis SHAN-1 in the preparation of an antioxidant product.

[0041] Use of the above-mentioned Bacillus subtilis SHAN-1 or the above-mentioned microbial agent in antioxidant.

[0042] Use of the above-mentioned Bacillus subtilis SHAN-1 in the preparation of a product for increasing sugar content of plant fruits.

[0043] Use of the above-mentioned Bacillus subtilis SHAN-1 or the above-mentioned microbial agent in increasing sugar content of plant fruits.

[0044] Use of the above-mentioned Bacillus subtilis SHAN-1 in the preparation of a product for reducing acid content of plant fruits.

[0045] Use of the above-mentioned Bacillus subtilis SHAN-1 or the above-mentioned microbial agent in reducing acid content of plant fruits.

[0046] Use of the above-mentioned Bacillus subtilis SHAN-1 in the preparation of a product for reducing acid content of plant fruits.

[0047] Use of the above-mentioned Bacillus subtilis SHAN-1 or the above-mentioned microbial agent in reducing acid content of plant fruits.

[0048] The auxin is indole acetic acid.

[0049] Further, the plant comprises at least one of Brassicaceae and Rutaceae; and further at least one of Brassica and Citrus.

[0050] Further, the plant fruit comprises a fruit of Rutaceae; and further a fruit of Citrus.

[0051] Further, the application of the preparation of the protease comprises a step of protease purification, the protease purification is the step of purifying the protease produced by Bacillus subtilis SHAN-1 by using the ammonium sulfate fractional precipitation method; further comprising the following steps: adding the saturated solution of ammonium sulfate to the fermentation product of Bacillus subtilis SHAN-1 under the condition of magnetic stirring, after the ammonium sulfate crystal is completely dissolved, standing and centrifuging, collecting the precipitate, placing the precipitate in the phosphate buffer solution and dialyzing by using the dialysis bag to obtain the purified protease.

[0052] Further, the concentration of the saturated solution of ammonium sulfate is 0-30%, 30%-50%, 50%-70% or 70%-90%; further 30%-50%.

[0053] Further, the centrifugation condition is that the temperature is 4℃, the rotation speed is 8000rpm and the centrifugation time is 10min.

[0054] Further, the phosphate buffer solution is the phosphate buffer solution with the pH of 7.0 and the concentration of 20mmol / L.

[0055] Further, the dialysis by using the dialysis bag is the dialysis by using the 4kDa molecular weight dialysis bag for 36h.

[0056] The application has the following advantages and effects relative to the prior art:

[0057] The Bacillus subtilis SHAN-1 provided by the application is salt-tolerant and has strong abilities of producing IAA and protease. The Bacillus subtilis SHAN-1 is applied to the microbial fertilizer, and has the promoting effect on the growth of plants. In the microbial fermentation technology, the Bacillus subtilis SHAN-1 can utilize peanut meal and other substances as the fermentation substrate, the fermentation product can promote the growth of plants and promote the sugar accumulation of the fruits of plants, especially the fruits of citrus. BRIEF DESCRIPTION OF DRAWINGS

[0058] Figure 1 It is the morphological identification result graph of Bacillus subtilis SHAN-1, wherein A is the colony morphology graph, B is the gram staining graph and C is the scanning electron microscope graph.

[0059] Figure 2 It is the phylogenetic tree graph of Bacillus subtilis SHAN-1.

[0060] Figure 3 It is the growth curve and protease production curve of Bacillus subtilis SHAN-1.

[0061] Figure 4 The results of the effects of carbon source, nitrogen source, and metal ions on the protease activity of Bacillus subtilis SHAN-1 and the optimal concentration of the substances on the enzyme activity are shown in the graphs, wherein A is the result graph of different nitrogen sources, B is the result graph of different carbon sources, C is the result graph of different metal ions, D is the result graph of different concentrations of skimmed milk, E is the result graph of different concentrations of glucose, and F is the result graph of different concentrations of magnesium ions; different lowercase letters in the graphs represent significant differences (P<0.05) between treatments.

[0062] Figure 5 The results of the effects of culture medium pH, culture temperature, and culture time on the protease activity of Bacillus subtilis SHAN-1 are shown in the graphs, wherein A is the result graph of pH, B is the result graph of different temperatures, and C is the result graph of different times; different lowercase letters in the graphs represent significant differences (P<0.05) between treatments.

[0063] Figure 6 The colorimetric results of IAA production by Bacillus subtilis SHAN-1 are shown in the graphs, wherein A is the photograph of the water control, B is the result photograph of the LB blank medium without tryptophan, C is the result photograph of the LB blank medium with tryptophan, D is the result photograph of the LB medium without tryptophan, and E is the result photograph of the LB medium with tryptophan.

[0064] Figure 7 The results of the salt tolerance characteristics of Bacillus subtilis SHAN-1 are shown in the graphs, wherein the left graph is the result graph of Bacillus subtilis concentration under different concentrations of NaCl, and the right graph is the result graph of IAA production under different concentrations of NaCl.

[0065] Figure 8 The results of the effects of temperature and pH on the protease production by Bacillus subtilis SHAN-1 and the SDS-PAGE results of the protease produced are shown in the graphs, wherein A is the result graph of different temperatures, B is the result graph of different pH, and C is the SDS-PAGE result graph of the protease before and after purification.

[0066] Figure 9 The results of the fermentation of two kinds of peanut meal by Bacillus subtilis SHAN-1 are shown in the graphs, wherein A is the sample graph, and B is the SDS-PAGE result graph of the fermented two kinds of peanut meal.

[0067] Figure 10 The results of the effect of the peanut meal fermentation broth of Bacillus subtilis SHAN-1 on the germination and seedling stage of flowering cabbage are shown in the graphs.

[0068] Figure 11 The results of the effect of the peanut meal fermentation broth of Bacillus subtilis SHAN-1 on citrus are shown in the graphs, wherein A is the effect of color change, and B is the comparison graph of the effects of different treatment groups after harvesting. DETAILED DESCRIPTION

[0069] The application will be described in further detail below with reference to the embodiments and drawings, but the embodiments of the application are not limited thereto. The test methods in the following examples, unless otherwise specified, are generally in accordance with conventional test conditions or in accordance with the test conditions suggested by the manufacturer. The materials, reagents, etc. used, unless otherwise specified, are commercially available.

[0070] The protease enzyme activity in the examples was determined by the Folin-phenol method, and the specific steps were as follows:

[0071] (1) 1 mL of the fermentation broth to be tested was taken in a 1.5 mL centrifuge tube, and centrifuged at 12000 rpm for 1 min.

[0072] (2) Two 1.5 mL test tubes were taken, and 200 μL of casein substrate was added to each, and 600 μL of trichloroacetic acid solution was added to the control centrifuge tube, and then 200 μL of the supernatant after centrifugation in (1) was added to the two test tubes, and then placed in a 40°C water bath for 10 min.

[0073] (3) After the reaction was completed, centrifugation was performed at 12000 rpm for 1 min, and 2.5 mL of sodium carbonate was added to each of the two test tubes, and 500 μL of the supernatant after centrifugation was taken in a test tube, and 500 μL of Folin-phenol reagent was added, and then left to stand for 30 min, and then colorimetry was performed at 680 nm under ultraviolet spectrophotometry.

[0074] Example 1: Isolation and screening of Bacillus subtilis SHAN-1 and identification

[0075] I. Isolation and screening of Bacillus subtilis SHAN-1

[0076] 1. Medium formula

[0077] Beef extract protein peptone medium: beef extract 5.0 g·L -1 , protein peptone 10.0 g·L -1 , sodium chloride (NaCl) 5.0 g·L -1 , 1.5% by mass agar; the balance is deionized water.

[0078] LB liquid medium containing L-tryptophan: Tryptone 10.0 g·L -1 , yeast extract 5.0 g·L -1 , NaCl 10.0 g·L -1 , L-tryptophan 200.0 mg·L -1 ; the balance is deionized water.

[0079] Skim milk powder solid medium: skim milk powder 6.0 g·L -1 , 1.5% agar; the rest is deionized water.

[0080] Salkowski colorimetric solution: 50 mL 35% HClO4, 1 mL 0.5 mol·L -1 FeCl3.

[0081] 2、Enrichment

[0082] The strain of the application is derived from rhizosphere soil samples collected by the Tree Garden of South China Agricultural University. 10 g of soil sample is added to a triangular flask containing 100 ml of sterile normal saline, and after standing for 20 min, it is shaken at 28℃ and 180 rpm for 30 min. 1 ml is added to 9 ml of sterile normal saline, and then sequentially diluted 10 2 , 10 3 , 10 4 , 10 5 , 10 6 times, and 100 μL of the diluted 10 4 , 10 5 , 10 6 times soil suspension is uniformly plated on beef extract peptone culture medium plates, and cultured in a 28℃ incubator for 48 h. The morphologically different bacterial single colonies are picked with sterile toothpicks and purified by streaking, and then stored for use. A total of 96 strains of bacteria are isolated.

[0083] 3、Primary screening

[0084] The purified strains are inoculated in LB liquid medium containing L-tryptophan 200 mg·L -1 , and cultured at 30℃ and 180 rpm for 24 h. 50 μL of bacterial suspension is dropped on a white ceramic plate, and an equal amount of Salkowski color developing solution is added for color development. The standard solution of 50 μL IAA (50 mg·L -1 ) is used as a positive control. The white ceramic plate is observed after being placed at room temperature and in the dark for 30 min, and if the color turns red, it indicates that IAA can be produced. The strains with color close to the positive control, i.e., the deeper the color, are marked, and a total of 17 strains are used for further rescreening.

[0085] 4、Rescreening

[0086] The purified strains after primary screening are inoculated in skim milk powder solid medium and cultured in a 30℃ constant temperature incubator for 24 h. If colonies are formed in the plate and transparent circles are formed around the colonies, it indicates that the strain can produce protease. The activity of the produced protease is judged according to the size of the transparent circle around the colony, the size of the transparent circle is measured, and the strain producing the largest transparent circle is selected as the target strain.

[0087] Finally, a strain capable of producing IAA and protease was screened out through the above screening process.

[0088] II. Identification of Bacillus subtilis SHAN-1

[0089] 1. Morphological identification of the strain

[0090] The screened strain was streaked on skimmed milk solid medium, incubated at 30°C for 24 h, and the colony size and morphology were observed, and the bacterial morphology was observed under a microscope by Gram staining. The colony morphology and Gram staining results are shown in Figure 1 . Figure 1 The medium in A is a solid medium with skimmed milk powder as the only nitrogen source. The presence of a clear zone around the colony indicates that the strain can produce protease to utilize skimmed milk powder as a nitrogen source for growth. In addition, the colony morphology of Bacillus subtilis SHAN-1 can be observed in A. The colony is white, not raised, irregular in edge, dry, and easy to pick up. Figure 1 Figure 1 The Gram staining in B is blue-purple, indicating that the strain is a Gram-positive bacterium. Figure 1 C is a scanning electron micrograph (SEM), which shows that the SHAN-1 strain is short rod-shaped under the electron microscope.

[0091] 2. Analysis of physiological and biochemical characteristics

[0092] According to the "Berger's Bacterial Identification Manual (8th Edition)", Bacillus subtilis SHAN-1 was subjected to sugar fermentation test, V.P test, and physiological and biochemical index test, and the results are shown in Table 1.

[0093] Table 1 Test results of physiological and biochemical indexes of Bacillus subtilis SHAN-1

[0094]

[0095] Note: +: positive; -: negative

[0096] 3. Molecular identification

[0097] ​The purified strain was scraped from a single colony on the culture medium into 150 μL sterile water, mixed and boiled for 10 min, centrifuged at 12000 r / min for 10 min, and the supernatant was subjected to PCR amplification. Bacterial 16S rDNA universal primers (27F: 5'-AGAGTTTGATCCTGGTCAGAACGAACGCT-3' and 1492R: 5'-TACGGCTACCTTGTTACGACTTCACCCC-3') were used for PCR amplification, and the amplification procedure was as follows: 94°C for 5 min; 98°C for 10 s, 55°C for 30 s, 72°C for 1 kb / 1 min, 35 cycles; 72°C for 10 min; 4°C storage. The obtained PCR product was verified by 1% agarose gel electrophoresis, and was sent to Wuhan Tianyi Huiyuan Gene Technology Co., Ltd. for sequencing. The 16S rDNA sequence is as follows:

[0098] CGGCGTGCTATACATGCAAGTCGAGCGGACAGATGGGAGCTTGCTCCCTGATGTTAGCGG

[0099] CGGACGGGTGAGTAACACGTGGGTAACCTGCCTGTAAGACTGGGATAACTCCGGGAAACCGG

[0100] GGCTAATACCGGATGGTTGTTTGAACCGCATGGTTCAAACATAAAAGGTGGCTTCGGCTACCA

[0101] CTTACAGATGGACCCGCGGCGCATTAGCTAGTTGGTGAGGTAACGGCTCACCAAGGCAACGA

[0102] TGCGTAGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTA

[0103] CGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGT

[0104] GAGTGATGAAGGTTTTCGGATCGTAAAGCTCTGTTGTTAGGGAAGAACAAGTACCGTTCGAAT

[0105] AGGGCGGTACCTTGACGGTACCTAACCAGAAAGCCACGGCTAACTACGTGCCAGCAGCCGCG

[0106] GTAATACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTCGCAGGCGGTTTC

[0107] TTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGGAACTTG

[0108] AGTGCAGAAGAGGAGAGTGGAATTCCACGTGTAGCGGTGAAATGCGTAGAGATGTGGAGGA

[0109] ACACCAGTGGCGAAGGCGACTCTCTGGTCTGTAACTGACGCTGAGGAGCGAAAGCGTGGGG

[0110] AGCGAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGAGTGCTAAGTGTTAGGG

[0111] GGTTTCCGCCCCTTAGTGCTGCAGCTAACGCATTAAGCACTCCGCCTGGGGAGTACGGTCGCA

[0112] AGACTGAAACTCAAAGGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTC

[0113] GAAGCAACGCGAAGAACCTTACCAGGTCTTGACATCCTCTGACAATCCTAGAGATAGGACGT

[0114] CCCCTTCGGGGGCAGAGTGACAGGTGGTGCATGGTTGTCGTCAGCTCGTGTCGTGAGATGTT

[0115] GGGTTAAGTCCCGCAACGAGCGCAACCCTTGATCTTAGTTGCCAGCATTCAGTTGGGCACTCT

[0116] AAGGTGACTGCCGGTGACAAACCGGAGGAAGGTGGGGATGACGTCAAATCATCATGCCCCTT

[0117] ATGACCTGGGCTACACACGTGCTACAATGGACAGAACAAAGGGCAGCGAAACCGCGAGGTT

[0118] AAGCCAATCCCACAAATCTGTTCTCAGTTCGGATCGCAGTCTGCAACTCGACTGCGTGAAGCT

[0119] GGAATCGCTAGTAATCGCGGATCAGCATGCCGCGGTGAATACGTTCCCGGGCCTTGTACACAC

[0120] CGCCCGTCACACCACGAGAGTTTGTAACACCCGAAGTCGGTGAGGTAACCTTTTAGGAGCCA

[0121] GCCGCCGAAG。

[0122] The sequencing results were submitted to the NCBI database, aligned using its alignment program, and a phylogenetic tree was constructed by the Neighbor-Joining method of MEGA11.0 software. It was identified that the strain belongs to Bacillus subtilis, and was named Bacillus subtilis SHAN-1. The phylogenetic tree constructed by the 16S rDNA sequences of the strain and its close strains is shown in Figure 2 Bacillus subtilis SHAN-1 was preserved in the China General Microbiological Culture Collection Center (CGMCC) of the Institute of Microbiology, Chinese Academy of Sciences, located at No. 1, Yichen West Road, Beijing Chaoyang District, on March 3, 2023, with the preservation number of CGMCC No. 26729.

[0123] Example 2: Drawing of the growth curve and enzyme production curve of Bacillus subtilis SHAN-1

[0124] (1) Strain activation: Bacillus subtilis SHAN-1 preserved in glycerol at-80℃ was inoculated into seed culture medium and cultured at 30℃, 180rpm for 36h to obtain a strain in the logarithmic growth phase (OD 600= 0.6-0.8) seed liquid.

[0125] (2) Growth curve drawing: the activated strain in (1) was inoculated into LB medium (100 mL / 250 mL) and cultured at 30°C, 180 rpm for 72 h. The sample was taken every 6 h, and the OD value was determined at 600 nm by UV spectrophotometer. The growth curve of the strain SHAN-1 was drawn according to the OD value. Figure 3 It can be seen from the figure that the strain was in the lag phase at 0-6 h, then gradually entered the logarithmic phase, and reached the stable phase at 42 h. The number of bacterial cells tended to be balanced, and the OD value reached the highest at 48 h, then gradually entered the decline phase. At this time, the metabolic activity of the strain decreased, and autolysis phenomenon occurred.

[0126] (3) Enzyme production curve drawing: the activated strain in (1) was inoculated into skimmed milk powder liquid fermentation medium and cultured at 30°C, 180 rpm for 72 h. 1 mL sample was taken every 6 h, centrifuged at 10000 rpm, and the protease activity in the supernatant was determined by Folin phenol method. The enzyme production curve was drawn according to the determination results, and the results are shown in Figure 3 It can be seen from the figure that the enzyme production curve of the strain SHAN-1 was similar to the trend of the growth curve. The protease activity of the strain was low at 0-6 h, then gradually increased and reached the highest at 48 h, and the enzyme activity was 815.79 U / mL (before optimization of the culture conditions). The enzyme production activity of the strain gradually decreased after 48 h, which may be due to the fact that the protein in the medium was basically consumed.

[0127] The formula of the seed medium in step (1) is as follows: tryptone 10.0 g·L -1 , yeast extract 5.0 g·L -1 , sodium chloride 10.0 g·L -1 , and the rest is deionized water.

[0128] The formula of the skimmed milk powder liquid fermentation medium in step (3) is as follows: skimmed milk powder 8.0 g·L -1 , glucose 5.0 g·L -1 , NaCl 4.0 g·L -1 , MgSO4·7H2O 1 g·L -1 , K2HPO4 1 g·L -1 , and the rest is deionized water.

[0129] Example 3: Optimization of the medium formula of Bacillus subtilis SHAN-1

[0130] (1) Strain activation: Bacillus subtilis SHAN-1, preserved in glycerol at -80℃, was inoculated into seed culture medium (10.0 g·L⁻¹ tryptone). -1 Yeast extract 5.0 g·L -1 Sodium chloride 10.0 g·L -1 The remainder was deionized water. The mixture was cultured at 30℃ and 180 rpm for 36 hours with shaking to obtain cells in the logarithmic growth phase (OD). 600 Seed liquid (0.6-0.8%).

[0131] (2) Fermentation medium optimization: The activated strain from step (1) was inoculated into the liquid fermentation medium. The liquid fermentation medium formula was: 6.0 g / L skim milk powder. -1 5.0 g / L glucose -1 NaCl 4.0 g·L -1 MgSO4·7H2O 1g·L -1 K2HPO4 1g·L -1 The remainder is deionized water. Single-factor experiments were conducted to investigate nitrogen sources (skim milk powder, urea, (NH4)2SO4, KNO3), carbon sources (glucose, sucrose, fructose, maltose, water-soluble starch, lactose), and metal ions (Mg). The components were replaced or their content adjusted. 2+ Cu 2+ Zn 2+ Ca 2+ Fe 3+ Mn 2+ The effect of the strain on enzyme production activity was investigated. The culture medium was at pH 7.0 and cultured at 30℃ and 180 rpm for 36 h with shaking. The optimal nitrogen source, carbon source and metal salt ion were selected by measuring the protease activity. Then, the optimal concentration was tested to further optimize the fermentation medium.

[0132] The results are as follows Figure 4 As shown, by Figure 4 A indicates that the protease production activity of strain SHAN-1 in different nitrogen source media is in the order of skim milk powder > ammonium sulfate > potassium nitrate > urea. The highest protease production activity was observed in the medium with skim milk powder as the sole nitrogen source. Furthermore, experiments were conducted using different concentration gradients of skim milk powder... Figure 4 D) It was found that when the concentration of skim milk powder in the culture medium was 10 g·L⁻¹ -1 At this time, the enzyme-producing activity of SHAN-1 reaches its peak. Figure 4 B indicates that the protease production activity of this strain in a medium with glucose as the sole carbon source is higher than that in media with the other five carbon sources, and this is especially true when the glucose concentration is 5 g·L⁻¹. -1 At that time, the strain exhibited the highest enzyme production activity.Figure 4 E), so glucose was selected as the optimum carbon source for the enzyme production medium. Figure 4 C was the effect of different metal ions on the protease activity of Bacillus subtilis SHAN-1, Cu 2+ , Fe 3+ , Mn 2+ had inhibitory effect on the enzyme production activity of SHAN-1, while Mg 2+ , Zn 2+ , Ca 2+ could promote the enzyme production of the strain, and Mg 2+ > Ca 2+ > Zn 2+ When the concentration of MgSO4·7H2O was 1.0 g·L -1 , the enzyme production activity of SHAN-1 was the highest, up to 795.88 U / mL.

[0133] Example 4: Study on the enzyme production culture conditions of Bacillus subtilis SHAN-1

[0134] (1) Strain activation: Bacillus subtilis SHAN-1 stored in glycerol at -80℃ was inoculated into seed culture medium (10.0 g·L -1 of tryptone, 5.0 g·L -1 of yeast extract, 10.0 g·L -1 of sodium chloride, and the rest was deionized water), and cultured at 30℃ with 180 rpm shaking for 36 h to obtain a seed solution in the logarithmic growth phase (OD 600 = 0.6-0.8).

[0135] (2) Optimization of culture conditions: the seed solution obtained in step (1) was inoculated into the optimized liquid fermentation medium (10.0 g·L -1 of skim milk powder, 5.0 g·L -1 of glucose, 4.0 g·L -1 of NaCl, 1 g·L -1 of MgSO4·7H2O, and 1 g·L -1 of K2HPO4)., the rest was deionized water) by single factor experiment to change the pH of the medium (5.5, 6, 6.5, 7, 7.5, 8), the reaction temperature was set to 30℃, and the reaction time was set to 36h to explore the optimal reaction time; After determining the optimal reaction pH (i.e. 7.0), the optimal culture temperature (26, 28, 30, 32, 34, 36℃) of the strain to produce enzyme was explored, and the reaction time was set to 36h; Finally, under the conditions of the optimal reaction pH (7.0) and the optimal culture temperature (32℃), the influence of the culture time (24, 36, 48, 60, 72h) on the enzyme production of the strain was explored, and the appropriate conditions were selected by measuring the protease activity of the fermentation broth obtained by single factor experiment.

[0136] The results are shown in Figure 5 , according to the results of variance analysis, when the pH of the medium was 7.0, the protease activity of the strain SHAN-1 was significantly higher than that under other pH conditions (P<0.05), reaching 837.48U / mL. As can be seen from Figure 5 -B, the enzyme activity of the strain was the highest when the culture temperature was 30-32℃, and the enzyme activity at 32℃ was 3.7% higher than that at 30℃, indicating that the optimal enzyme production temperature of the strain SHAN-1 should be 32℃. When the temperature was lower than 28℃ or higher than 36℃, the enzyme activity of the strain decreased significantly, indicating that too high or too low temperature inhibited the enzyme production of the strain. As can be seen from Figure 5 -C, when the culture time was 48h, the enzyme activity was the highest, reaching 906.89U / mL, which was significantly higher than that when the culture time was 36h (P<0.05), increasing by 4.05%, and when the strain was cultured for 60h, the enzyme activity decreased significantly, which may be due to the consumption of nutrients in the medium, which caused the strain to be unable to survive normally. The protease activity of the fermentation broth of the strain cultured under the optimal conditions in Example 4 was 906.89U / mL.

[0137] Example 5: Synthesis of IAA by Bacillus subtilis SHAN-1

[0138] (1) Prepare LB medium containing L-tryptophan. Formula: tryptone 10g·L -1 , yeast extract 5g·L -1 , sodium chloride 10g·L -1 , L-tryptophan 200mg·L -1 , the rest was deionized water. Prepare Salkowski colorimetric solution. Formula: 50mL 35% HClO4, 1mL 0.5mol·L -1 FeCl3, the rest was deionized water.

[0139] (2) The activated strain was inoculated into LB medium and LB medium containing 200 mL of L-tryptophan at a rate of 1.5%. Three replicate experiments were set up and the culture conditions were 32℃ and 180 rpm in a shaker for 48 h.

[0140] (3) Determination of IAA content by ultraviolet spectrophotometry:

[0141] ① Plot the IAA standard curve. Accurately weigh 10 mg of IAA, dissolve it first in a small amount of ethanol, then add water to make up to 100 mL. -1 (concentration is 100 μg·mL) -1 (This is used as a stock solution; 0, 0.5, 1.0, 5.0, 10.0, 15.0, 20.0, and 25.0 μg·mL are prepared using the stock solution.) -1 A series of standard solutions were prepared and mixed with Salkowski colorimetric solution at a volume ratio of 1:1, and incubated at room temperature in the dark for 30 min. An equal volume mixture of distilled water and Salkowski colorimetric solution was used as a control. The OD values ​​of each concentration were measured using a spectrophotometer. 530 Value; plotted on the x-axis, OD 530 Plotting the values ​​on the ordinate yields the IAA standard curve.

[0142] ② Centrifuge the bacterial suspension at 10,000 rpm for 10 min, take 2 mL of the supernatant and add 2 mL of Salkowski colorimetric solution, shake well, and let stand in the dark at room temperature for 30 min. Use an equal volume mixture of uninoculated liquid culture medium and Salkowski colorimetric solution as a control, and then measure its OD using a spectrophotometer. 530 Value. The corresponding IAA content was calculated using the IAA standard curve. Colorimetric results are shown below. Figure 6 The bacterial cultures in both LB medium without tryptophan and LB medium containing tryptophan showed a pale red color, with the latter being redder than the former. This may be because the strain can convert L-tryptophan into IAA. In ordinary LB medium, the strain decomposes the nitrogen source in the medium, and the tryptophan in the metabolic products is used by the strain to generate IAA. Therefore, the colorimetric result in LB medium without tryptophan is slightly red.

[0143] Finally, based on the standard curve, it was calculated that Bacillus subtilis SHAN-1 could produce IAA under these culture conditions, and the IAA content determined by colorimetric method was 71.80 μg·mL. -1 .

[0144] (4) Determination of IAA content by high performance liquid chromatography:

[0145] ① Centrifuge the bacterial suspension at 10,000 rpm for 10 min, filter the supernatant through a 0.45 μm nylon filter membrane, and place 1 mL of the supernatant in a high performance liquid chromatography bottle for analysis.

[0146] ② The detection conditions were set as follows: the detection wavelength was 210 nm, the column temperature was 35 ℃, the mobile phase was methanol (v): acetonitrile (v): pH citrate buffer (v) = 20:20:60, and the flow rate was 1.0 mL / min.

[0147] ③ Plot the IAA standard curve. Accurately weigh 10 mg of IAA, dissolve it first in a small amount of ethanol, then add water to make up to 100 mL. -1 (concentration is 100 μg·mL) -1 (This is used as a stock solution; 0, 0.5, 1.0, 5.0, 10.0, 15.0, 20.0, and 25.0 μg·mL are prepared using the stock solution.) -1 A series of standard solutions were prepared. A standard curve for IAA was obtained using high-performance liquid chromatography (HPLC). The corresponding IAA concentration was calculated to be 72.57 μg·mL⁻¹ based on the IAA standard curve. -1 .

[0148] Example 6: Study on the salt tolerance characteristics of Bacillus subtilis SHAN-1

[0149] (1) Strain activation: Bacillus subtilis SHAN-1, preserved in glycerol at -80℃, was inoculated into seed culture medium (10.0 g·L⁻¹ tryptone). -1 Yeast extract 5.0 g·L -1 Sodium chloride 10.0 g·L -1 The remainder was deionized water. The mixture was cultured at 30℃ and 180 rpm for 36 hours with shaking to obtain cells in the logarithmic growth phase (OD). 600 Seed liquid (0.6-0.8%).

[0150] (2) Salt tolerance of the strain: The activated strain in (1) was inoculated into LB medium containing NaCl2 at a volume percentage of 2.5% at 6, 10, 14, 18, and 20% (w / v) and cultured in a constant temperature shaker at 32℃ and 180 rpm for 48 h. Uninoculated LB medium was used as a blank control. Each treatment was repeated 3 times. After the culture was completed, the OD was measured. 600 Value. Result as follows Figure 7As shown in the figure, the strain can survive in the concentration range of 1-24% (w / v). When the salt concentration is less than 10%, the OD value of the bacterial solution is above 0.8, indicating that the strain SHAN-1 can survive well and reach the logarithmic growth phase in this concentration range. When the NaCl concentration is greater than 10%, the OD value of the bacterial solution shows a downward trend, indicating that the strain is under salt stress in this range, and the stress intensifies with the increase of the salt concentration, but it does not die in the highest concentration (20%) set in this test and can still survive, so it can be concluded that the strain has high salt tolerance.

[0151] (3) Effect of high salt conditions on the production of protease by SHAN-1 strain: The activated strain in (1) was inoculated into liquid fermentation medium containing NaCl 2, 6, 10, 14, 18, 20% (w / v), each treatment was repeated 3 times, after the culture, the protease activity in the fermentation broth was determined according to the method for determining the protease activity in Example 4, the relative enzyme activity under each NaCl concentration was calculated, and the results are shown in Figure 7 As shown in the figure, the relative activity of protease produced by the strain is above 73.75% when the salt concentration is 0-10%, indicating that the strain can survive normally and still produce normal enzyme in this salt concentration range. When the concentration is 14%, the relative enzyme activity is 42.80%, and when the NaCl concentration is greater than 14%, the strain can still produce enzyme, but the enzyme activity is reduced, indicating that the enzyme production ability of the strain is inhibited by high salt concentration at this time.

[0152] (4) Effect of high salt conditions on the production of IAA by SHAN-1 strain: The activated strain in (1) was inoculated into LB medium containing L-tryptophan 200 mg·L -1 -1, and the NaCl concentration was set to 2, 6, 10, 14, 18, 20% (w / v), and the culture was carried out at 32°C and 180 rpm in a constant temperature shaker for 48 h. After the culture, the IAA concentration in the fermentation broth was determined by the method for determining the IAA content in Example 5, and the results are shown in Figure 7 As a whole, with the increase of the salt concentration of the medium, the IAA concentration produced by the strain gradually decreased, indicating that the ability of the strain to produce IAA was stressed by the salt concentration. However, when the NaCl concentration was 0-10%, the produced IAA concentration could still reach above 44.67 μg / mL, which still indicated that the SHAN-1 strain could maintain high activity under high salt conditions.

[0153] The liquid medium formula in step (3) is: skimmed milk powder 10.0 g·L -1 -1, glucose 5.0 g·L -1 -1, MgSO4·7H2O 1 g·L -1 -1, K2HPO4 1 g·L -1 -1, and the rest is deionized water.

[0154] Example 7: Preparation of protease using Bacillus subtilis SHAN-1

[0155] (1) Strain activation: Bacillus subtilis SHAN-1 preserved in glycerol at -80°C was inoculated into seed culture medium and cultured at 30°C, 180 rpm for 36 h to obtain seed liquid in the logarithmic growth phase (OD 600 = 0.6-0.8).

[0156] (2) The seed liquid in step (1) was inoculated into liquid fermentation medium at an inoculation amount of 3% (v / v) and placed in a constant temperature shaker to be cultured at 32°C, 180 rpm for 48 h to obtain fermentation liquid containing protease.

[0157] (3) The fermentation liquid after 48 h of culture in step (2) was centrifuged at 10,000-12,000 rpm, 4°C for 10 min, and the supernatant was collected. The bacterial cells in the supernatant were removed by a filter membrane with a pore size of 0.22 μm, and the filtrate was the crude protease liquid fermented by Bacillus subtilis SHAN-1.

[0158] The seed culture medium in step (1) was tryptone 10.0 g·L -1 , yeast extract 5.0 g·L -1 , sodium chloride 10.0 g·L -1 .

[0159] The formula of the liquid fermentation medium in step (2) was skim milk powder 10.0 g·L -1 , glucose 5.0 g·L -1 , NaCl 4.0 g·L -1 , MgSO4·7H2O 1 g·L -1 , K2HPO4 1 g·L -1 , and the balance was deionized water; pH was 7.0.

[0160] Example 8: Purification and enzymatic properties of protease produced by Bacillus subtilis SHAN-1

[0161] (1) Purification of protease: The protease produced by Bacillus subtilis SHAN-1 was purified by ammonium sulfate fractionation. The specific steps are as follows: a beaker containing crude enzyme solution was placed in a magnetic stirring meter, and under the condition of magnetic stirring, ammonium sulfate crystals were slowly added to the beaker, so that the saturation concentration of ammonium sulfate was 0-30%, 30%-50%, 50%-70%, and 70%-90%, respectively. After the ammonium sulfate crystals were completely dissolved, centrifugation was performed at 4°C for 10 min at a speed of 8000 rpm, and the precipitate was collected. The collected precipitate was completely dissolved in a pH 7.0, 20 mmol / L phosphate buffer solution, dialyzed for 36 h at 4°C using a 14 kDa dialysis bag, and the protease activity was measured.

[0162] (2) Determination of molecular weight: The enzyme protein in the highest enzyme activity range of the saturation concentration of ammonium sulfate in (1) was subjected to polyacrylamide gel electrophoresis (SDS-PAGE) test, and the results are shown in Figure 8 -C, and after comparison with Marker, it was found that the molecular weight of the target protein was about 75 kDa.

[0163] (3) Effect of temperature on enzymatic reaction: Single factor test was used to explore the optimum reaction temperature of the protease produced by Bacillus subtilis SHAN-1 by changing the reaction temperature in the protease activity determination (i.e. the water bath temperature in step (2)). The reaction temperature was set to 20, 25, 30, 35, 40, 45, 50, 55, and 60°C, and the substrate pH was 7.0. The results are shown in Figure 8 -A, it can be seen that the activity of the protease reaches the highest at 40°C, and higher or lower temperatures inhibit the activity of the enzyme, so 40°C is determined as the optimum temperature for the protease produced by the strain.

[0164] (4) Effect of pH on enzymatic reaction: Single factor test was used to explore the optimum reaction temperature of the protease produced by Bacillus subtilis SHAN-1 by changing the pH of the substrate. Different pH casein substrates were prepared, with pH set to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12, and the enzyme activity determination steps were the same as in Example 4. The results are shown in Figure 8 -B. According to the figure, the protease has activity in weak acid, weak base and neutral environment, but almost loses activity in strong acid (pH <4) or strong base (pH >9) environment, and shows the highest enzyme activity at pH 7, so pH 7 is determined as the optimum pH for the protease reaction produced by the strain.

[0165] Example 9: Method for fermenting peanut meal using Bacillus subtilis SHAN-1

[0166] The fermentation method of Bacillus subtilis SHAN-1 for peanut meal is as follows:

[0167] (1) Sample preparation: The peanut meal used in the present application is purchased from an oil pressing workshop in Meizhou City, Guangdong Province. First, the peanut meal is dried in an oven at 60°C for 2 h, then ground into powder with a sample grinder, and sieved through a 60-mesh sieve, and then packed in a sealed bag for use.

[0168] (2) Preparation of bacterial suspension: Bacillus subtilis SHAN-1 stored in glycerol at -80°C is inoculated into liquid fermentation medium at an inoculation amount of 3% (v / v), with a liquid volume of 30% by volume in each bottle, and 150 mL is prepared for use, and cultured at 30°C and 180 rpm for 48 h, to obtain a bacterial suspension containing protease produced by the strain.

[0169] (3) Alkaline hydrolysis: 20% by mass of peanut meal is weighed and placed in a biofermentor, and 70% by mass of secondary water is injected, and stirred at 300 rpm and 30°C. Accurately weigh 2% by mass of NaOH and add it to the fermentor, and set the alkaline hydrolysis conditions to 60°C, 350 rpm, and hydrolyze for 12 h.

[0170] (4) Enzymatic hydrolysis: adjust the pH of the contents of the fermentor to above 10, accurately weigh 5 g / L of alkaline protease, and add it to the fermentor, and set the enzymatic hydrolysis temperature to 50°C and the rotation speed to 300 rpm, and hydrolyze for 20 h.

[0171] (5) Bacterial hydrolysis: measure the pH of the liquid in the fermentor and adjust it to the range of 6.5-7.5. Then inoculate the bacterial suspension prepared in step (2) into the fermentor at an inoculation amount of 5% by volume, and add liquid fermentation medium containing L-tryptophan to the total volume of the system, and set the fermentation temperature to 32°C and the rotation speed to 350 rpm, and hydrolyze for 48 h to obtain peanut meal fermentation liquor 1, and the sample solution is as shown in Figure 9 -A.

[0172] The liquid fermentation medium containing L-tryptophan in step (5) is L-tryptophan 200 mg·L -1 , skim milk powder 6.0 g·L -1 , glucose 5.0 g·L -1 , NaCl 4.0 g·L -1 , MgSO4·7H2O 1 g·L -1 , K2HPO4 1 g·L -1 , and the balance is deionized water.

[0173] Example 10: Method for fermenting peanut meal by Bacillus subtilis SHAN-1

[0174] The method for fermenting peanut meal by Bacillus subtilis SHAN-1 screened in the application example 1 is as follows:

[0175] (1) Sample preparation: The peanut meal used in the present application was purchased from an oil pressing workshop in Meizhou City, Guangdong Province. First, the peanut meal was dried in an oven at 60℃ for 2h, then ground into powder with a sample grinder and sieved through a 100 mesh sieve, and then packed in a sealed bag for use.

[0176] (2) Preparation of bacterial suspension: Bacillus subtilis SHAN-1 stored in glycerol at -80℃ was inoculated into liquid fermentation medium at an inoculation amount of 3% (v / v), with a liquid volume of 30% in each bottle, and 150mL was prepared for use. The preparation was cultured at 30℃ and 180rpm for 48h, and a bacterial suspension containing protease produced by the strain was obtained. Saccharomyces cerevisiae was inoculated into PDB medium, with a liquid volume of 30% in each bottle, and 150mL was prepared for use. The preparation was cultured at 28℃ and 180rpm for 24h, and a bacterial suspension of the Saccharomyces cerevisiae was obtained.

[0177] (3) Alkaline hydrolysis: 20% peanut meal by mass was placed in a biofermentor, and 70% secondary water by mass was injected, and stirred at 300rpm and 30℃. 2% NaOH by mass was accurately weighed and added to the fermentor, and the alkaline hydrolysis conditions were set as 60℃, 350rpm, and 12h of alkaline hydrolysis.

[0178] (4) Enzymatic hydrolysis: The pH of the contents of the fermentor was adjusted to above 10, 5g / L alkaline protease and 5g / L lipase were accurately weighed and added to the fermentor, and the enzymatic hydrolysis temperature was set to 50℃ and the rotation speed was set to 300rpm, and the enzymatic hydrolysis was carried out for 20h.

[0179] (5) Bacterial hydrolysis: The pH of the liquid in the fermentor was measured and adjusted to the range of 6.5-7.0. The SHAN-1 bacterial suspension and Saccharomyces cerevisiae bacterial suspension prepared in step (2) were inoculated into the fermentor at an inoculation amount of 5% by volume, and liquid fermentation medium containing L-tryptophan and PDB medium were added to the fermentor according to the total volume of the system. The fermentation temperature was set to 30℃ and the rotation speed was set to 350rpm, and the bacterial hydrolysis was carried out for 48h to obtain a peanut meal fermentation liquid, sample 2, as shown in Figure 9 -A.

[0180] The liquid fermentation medium containing L-tryptophan in step (5) is L-tryptophan 200mg·L -1 , skim milk powder 6.0g·L-1 Glucose 5.0 g·L -1 NaCl 4.0 g·L -1 MgSO4·7H2O 1 g·L -1 K2HPO4 1 g·L -1 The rest is deionized water.

[0181] Example 11: Protein molecular weight, yield and nutrient content determination of the fermentation broth of Bacillus subtilis SHAN-1 fermented peanut meal

[0182] SDS-PAGE, organic matter content determination, protein content determination, polypeptide content determination, and water-soluble sugar content determination were carried out using the peanut meal fermentation broth in Example 9 and Example 10.

[0183] (1) Determination of molecular weight: polyacrylamide gel electrophoresis (SDS-PAGE) test was carried out on the peanut meal fermentation broth in Example 9 and Example 10, and the treatment was set as unfermented peanut meal suspension, peanut meal fermentation broth 1 (peanut meal fermentation broth in Example 9) and peanut meal fermentation broth 2 (peanut meal fermentation broth in Example 10). The results are shown in Figure 9 -B. After comparison with Marker, it was found that the protein molecular weight of the fermented peanut meal was more concentrated below 15 kDa, and the band corresponding to the peanut meal fermentation broth 2 was longer and darker, indicating that the fermentation method could more thoroughly degrade the peanut meal, making it degrade into small molecular weight proteins. In addition, the bands of the two fermentation broths were close, and there were still two relatively clear bands between 30-35 kDa.

[0184] (2) Degradation yield determination: the peanut meal fermentation broth in Example 9 and Example 10 was filtered with filter paper, and the filter residue was placed in an oven together with the filter paper, dried at 60℃ for 18h, then weighed. The mass of peanut meal dissolved in the solution was calculated according to the mass of the remaining peanut meal residue and the mass of the peanut meal raw material, and the yield of peanut meal was obtained, and the results are shown in Table 2.

[0185] (3) Organic matter content determination: according to the industry standard "Determination of Organic Matter Content in Water-soluble Fertilizers NY / T 1976-2010", the specific steps are as follows: centrifuge the peanut meal fermentation liquor of Example 8 and Example 9 at 3000 rpm for 10 min, take 1.0000 g of supernatant and place it in a 100 mL volumetric flask, dilute with water, mix well. Immediately take 5.0 mL of sample solution into a digestion tube, and add 5.0 mL of potassium dichromate solution and 10.0 mL of sulfuric acid to it, and place a bent funnel at the mouth of the tube. Place the digestion tube in a preheated digestion furnace at 200-230°C, open the fume hood, and start timing when a drop of condensate falls from the lower end of the bent funnel, digest for 10 min ± 0.5 min, remove the small main tube, rinse the inner wall of the condenser tube with water, and transfer all the liquid in the digestion tube to a 200 mL triangular flask. Add 3-5 drops of o-phenanthroline indicator to the triangular flask, titrate with ferrous sulfate solution, and when the solution color turns brown red, it is the end point of titration, record the volume of ferrous sulfate solution consumed and perform data analysis. The experimental setup uses water as a blank control, and each treatment and blank is repeated 3 times. The results are shown in Table 2.

[0186] (4) Protein content determination: prepare a standard protein solution (10 mg·mL -1 ) for drawing a standard curve. Centrifuge the peanut meal fermentation liquor of Example 8 and Example 9 at 3000 rpm for 5 min, collect the supernatant for testing. Take 1 mL of the test solution in a test tube, add 4 mL of biuret reagent and mix well, then place it at room temperature for 15 min before performing colorimetric determination at 540 nm wavelength, and record the absorbance. The results are shown in Table 2.

[0187] (5) Amino acid content determination: prepare an amino acid standard solution of 5 μg·mL -1 for drawing a standard curve. Centrifuge the peanut meal fermentation liquor of Example 8 and Example 9 at 3000 rpm for 5 min, collect the supernatant. Take 1 mL of the supernatant in a 20 mL test tube, add 1 mL of distilled water, 3 mL of hydantoin, 0.1 mL of 0.1% ascorbic acid, seal with a stopper and heat in boiling water for 15 min, then quickly cool with cold water and shake from time to time. When the solution turns blue-violet, dilute to 20 mL with 60% ethanol, shake well and perform colorimetry at 570 nm wavelength. From the standard curve, the μg amount of each amino acid is obtained, and the beneficial amino acid content is calculated. The results are shown in Table 2.

[0188] (6) Water-soluble sugar content determination: centrifuge the peanut meal fermentation liquor of Example 8 and Example 9 at 3000 rpm for 5 min, collect the supernatant for testing. Take 50 mL of the test solution in a 100 mL volumetric flask, add 6 mol·L -1HCl 5 mL, placed in a water bath to heat for 10 min. After cooling, add 2-3 drops of phenolphthalein indicator, with 6 mol·L -1 NaOH solution to neutralize to just appear light red, add water to constant volume, transfer into a burette, used to titrate boiling Fehling reagent.

[0189] As shown in Table 2, fermentation broth 1 is peanut meal fermentation broth prepared by the method of Example 10, and fermentation broth 2 is peanut meal fermentation broth prepared by the method in Example 11. From the results, it can be seen that the yield of peanut meal extracted by fermentation process is greatly improved, and the organic matter content is also significantly higher than that of fermentation broth 1, and the reason may be that under the action of lipase and yeast, the fat and polysaccharides and other substances are degraded into small molecular substances and enter the solution. In addition to the yield, compared with the blank control by water extraction alone, the contents of each substance of fermentation broth 1 and fermentation broth 2 are all improved, the organic matter content is 204.35% and 247.65% higher than the blank, the protein content is 444.06% and 483.81% higher, the free amino acid content is 296.46% and 274.90% higher, and the water-soluble sugar content is 44.21% and 52.01% higher, respectively. It shows that the fermentation method of peanut meal provided in the present application can well degrade peanut meal into functional substances with high solubility, which provides a strong condition for the better application of peanut meal fermentation broth in agriculture.

[0190] Table 2 Yield and nutrient content of peanut meal fermentation broth

[0191]

[0192] Note: The same column of data after different lowercase letters indicate significant difference (P < 0.05).

[0193] Example 12: Study on the antioxidant activity of fermentation broth of Bacillus subtilis SHAN-1 fermented peanut meal

[0194] (1) DPPH·oxidation test: 2 mL of peanut meal fermentation broth of Example 8 and Example 9 was mixed with equal volume of 0.1 mmol·L -1 DPPH methanol solution (80% methanol) was mixed vigorously, and the solution was kept at room temperature for 30 minutes in the dark. The optical density of the solution was measured at 517 nm, and a control was prepared by replacing the peanut meal fermentation broth with methanol. The DPPH·radical scavenging rate (%) was calculated.

[0195] (2) ABTS·oxidation test: 2.6 mmol·L -1 Potassium persulfate solution 50 mL and 7.4 mmol·L -1ABTS· solution 50 mL was mixed and made into ABTS· stock solution by refining at room temperature for 24 h in dark. The stock solution was stored at 4 °C in dark. When used, the stock solution was diluted into working solution with absorbance of 0.700 ± 0.020 at 734 nm. 0.2 mL of the peanut meal fermentation liquor of Example 8 and Example 9 was taken and added with 3.8 mL of ABTS· working solution. The mixture was placed at room temperature for 10 min in dark. The absorbance was measured at 734 nm. The radical scavenging rate (%) of ABTS· was calculated.

[0196] (3) Superoxide anion radical (O2· - ) oxidation test: 0.2 mL of sample solution 10 mg / mL was taken and added with 4.5 mL of Tris-HCl buffer solution pH 8.2, 50 mmol / L and 4 mL of distilled water. After mixing, the mixture was incubated at 27 °C for 10 min as reagent A. 3 mmol / L of pyrogallol solution prepared with 10 mmol / L HCl solution was incubated at 25 °C for 10 min as reagent B. Reagent A was mixed with 0.3 mL of 10 mmol / L HCl solution as blank zero. Reagent A and 0.3 mL of reagent B were mixed. The absorbance was measured at 320 nm within 3 min. Deionized water was used instead of sample as control to repeat the above process to obtain the slope K0of absorbance change. The radical scavenging rate (%) of O2· was calculated. -1 -1 -

[0197] The test results are shown in Table 3. The results show that the three radical scavenging rates of fermentation liquor 1 and fermentation liquor 2 are higher than those of the control (water extraction), especially the ABTS radical scavenging rate, which is 235.56% and 317.49% higher than that of the control, respectively. This indicates that after extraction by alkaline hydrolysis and enzymatic hydrolysis, most of the macromolecular proteins are degraded into small molecular polypeptides and amino acids, greatly improving the antioxidant capacity of the fermentation liquor. In addition, the three radical scavenging rates of fermentation liquor 2 are higher than those of fermentation liquor 2. The reason may be that more soluble antioxidant active substances are produced by fermentation with the method of Example 11, thereby improving the antioxidant capacity of the fermentation liquor.

[0198] Table 3 Antioxidant properties of peanut meal fermentation liquor

[0199]

[0200] Note: Different lower case letters in the same column indicate significant difference (P < 0.05).

[0201] Example 13: Effect of Bacillus subtilis SHAN-1 bacterial suspension on the germination of flowering cabbage seeds

[0202] ​​​With Youqing 49 as experimental material, full seed of Chinese flowering cabbage was selected and soaked with sterile water and bacterial suspension respectively. The bacterial suspension was the bacterial solution resuspended to a concentration of 1.0 x 10 6 CFU / mL, 1.0 x 10 7 CFU / mL and 1.0 x 10 8 CFU / mL, the soaking time was 24 h, the amount was 50 mL, 50 seeds were used in each group, 3 repeats were set for each treatment, seed sprouting was observed after soaking, germination rate was calculated, and the results are shown in Table 4. The treatments with bacterial strain resuspension were higher than the water control, indicating that the fermentation broth of Bacillus subtilis SHAN-1 had a promoting effect on the germination of crops. The germination rate of the treatment with a concentration of 1.0 x 10 6 CFU / mL was significantly higher than the other three groups (P < 0.05), which was 6.5% higher than the water control, while there was no significant difference between the treatments with 1.0 x 10 7 CFU / mL and 1.0 x 10 8 CFU / mL, so the fermentation broth of strain SHAN-1 with a concentration of 1.0 x 10 6 CFU / mL had a good promoting effect on the seed germination of crops.

[0203] Table 4 Effect of fermentation broth of strain SHAN-1 on seed germination and growth of Chinese flowering cabbage

[0204]

[0205] Note: Different lowercase letters in the same column indicate significant difference (P < 0.05).

[0206] Example 14: Effect of Bacillus subtilis SHAN-1 on the growth of Chinese flowering cabbage seedlings

[0207] With Youqing 49 as experimental material, the seeds with uniform size and shape were inoculated in square plastic culture dishes, one seed per grid. The concentration of the bacterial suspension was 1.0 x 10 6 CFU / mL, 1.0 x 10 7 CFU / mL and 1.0 x 10 8The seedlings of Brassica parachinensis were cultured with the resuspended bacterial suspension at CFU / mL, 15 mL was added to each dish, and the bacterial suspension was supplemented every 3 days. The bacterial suspension was supplemented with 1 / 6 Hoagland's nutrient solution to 1 / 3 of the culture dish every day. A water control group (CK) cultured with water only and a control group cultured with 1 / 6 Hoagland's nutrient solution only were set up, and each treatment was set up in triplicate. The culture was cultured in a 28°C incubator. After 15 days of culture, the plant height and root length of each Brassica parachinensis were measured, the results are shown in Table 4, and photographs were taken for record. At the same time, the IAA oxidase activity of Brassica parachinensis was measured. 0.5 g of fresh Brassica parachinensis plants were weighed in a sterile mortar, 5 mL of pre-cooled phosphate buffer (pH = 6.1) was quickly added, and grinding was performed in an ice bath. The mixture was centrifuged at 4°C and 4000 rpm for 10 min, and then the supernatant was centrifuged at 4°C and 4000 rpm for 10 min. The obtained supernatant was the crude enzyme solution. The IAA oxidase activity of Brassica parachinensis was determined according to the colorimetric method in Zhang Zhiliang, ed. Plant Physiology Guide. Each treatment was set up in triplicate, and the results are shown in Table 4.

[0208] The experimental results are shown in Table 4 and Figure 10 Compared with the water control group, the growth of Brassica parachinensis treated with the bacterial suspension was fast, the leaf color was green, and the leaf area was larger. Compared with the 1 / 6 Hoagland's nutrient solution treatment, the growth of Brassica parachinensis treated with the bacterial suspension at a concentration of 1.0 x 10 7 CFU / mL was close to that of the bacterial suspension treatment at a concentration of 1.0 x 10 8 CFU / mL, but the growth of Brassica parachinensis treated with the bacterial suspension at a concentration of 1.0 x 10 6 CFU / mL was the best. From the plant height and root length data in Table 6, it can be seen that the plant height of Brassica parachinensis treated with the bacterial suspension at a concentration of 1.0 x 10 6 CFU / mL was higher than that of the blank and the nutrient solution group, and was 1.9 times that of the water control group. The plant height was 26.69% and 29.29% higher than that of the bacterial suspension treatments at a concentration of 1.0 x 10 7 CFU / mL and 1.0 x 10 8 CFU / mL, respectively. The root length of Brassica parachinensis treated with the bacterial suspension at a concentration of 1.0 x 10 7 CFU / mL was slightly higher than that of the bacterial suspension treatment at a concentration of 1.0 x 10 8 CFU / mL, and was 0.81% and 2.05% higher, respectively. The root length was also slightly higher than that of the 1 / 6 Hoagland's nutrient solution treatment. In addition, from the IAA oxidase data of the Brassica parachinensis of each treatment, it can be seen that the IAA oxidase activity of the water control group and the 1 / 6 Hoagland's nutrient solution treatment was higher, and the IAA oxidase activity of the plants treated with the bacterial suspension was lower. The activity of Brassica parachinensis treated with the bacterial suspension at a concentration of 1.0 x 10 6 CFU / mL was as low as 1.79 mg IAA·g -1 DW·h -1, indicating that the IAA oxidase activity of the plants can be effectively reduced after the SHAN-1 bacterial suspension, reducing the oxidative decomposition of IAA, promoting the absorption of IAA by the plants, and thus achieving the effect of promoting plant growth. In summary of the above results, the IAA and other substances contained in the fermentation broth of strain SHAN-1 have a promoting effect on the growth of crops, and the effect of the bacterial suspension with a concentration of 1.0 x 10 6 CFU / mL is more obvious.

[0209] Example 15: Effect of Bacillus subtilis SHAN-1 fermented peanut meal fermentation broth on color change and sugar increase of citrus

[0210] The peanut meal fermentation broth prepared in Example 9 and Example 10 was used during the color change period of citrus fruits to explore the effect of peanut meal fermentation broth on the color change of citrus fruits.

[0211] Test site: Wangu Town, Zengcheng District, Guangzhou City, Guangdong Province

[0212] Test crop: Jinqiu sand orange

[0213] The test treatments are shown in Table 5 below.

[0214] Table 5 Test treatments and application methods

[0215]

[0216] The color change after each treatment was recorded by taking pictures, as shown in Figure 11 . At the harvest period, citrus samples were collected to determine the fruit peel color difference LAB value, soluble solids content, soluble sugar content, titratable acid, and vitamin C content. The fruit peel color difference LAB value was determined using a color difference meter (3nh SC-10). The determination of soluble solids content was carried out according to the standard "NY / T 2637-2014 Determination of soluble solids content in fruits and vegetables by refractometer method". The determination of soluble sugar content was carried out according to the standard "NY / T 2742-2015 Determination of soluble sugar in fruits and products by 3,5-dinitrosalicylic acid colorimetric method". The determination of titratable acid content was carried out using the indicator titration method in the national standard "Citrus Fresh Fruit Inspection Methods" (GB / T 8210-2011). The determination of vitamin C content was carried out according to Method Three in "Determination of Ascorbic Acid in Food" (GB 5009.86-2016), 2,6-dichloroindophenol method.

[0217] The color change of single fruit from different treatments Figure 11A) It can be seen that the treatment of spraying peanut bran fermentation liquor is faster and more uniform than the control group, wherein the effect of 300 times application of peanut bran fermentation liquor of Example 9 is better than that of 500 times, the effect of 500 times is equivalent to that of the commercial competitor. The color change of the peanut bran fermentation liquor of Example 10 is the best, the skin color is uniform and shiny, and the effect of 300 times spraying is more obvious than that of 500 times. This feature is consistent with the peanut bran fermentation liquor of Example 9. Figure 11 B The appearance of the citrus fruits harvested at the same time can be compared by different treatments. It can be seen that the citrus fruits of the water control group are small in size and the peel color is uneven, while the fruits of peanut bran fermentation liquor 2 (i.e. peanut bran fermentation liquor of Example 10) are large in size and uniform in color, and the size of the fruits sprayed at 300 times is more uniform than that sprayed at 500 times. In addition, the effect of peanut bran fermentation liquor 1 (i.e. peanut bran fermentation liquor of Example 9) sprayed at 500 times is worse than that sprayed at 300 times, but is equivalent to that of the commercial competitor. This is consistent with the single fruit color change, indicating that the peanut bran fermentation liquor developed in this study has a certain promoting effect on the color change and growth of citrus.

[0218] The quality indicators in the citrus fruits after each treatment application are shown in Table 6. Overall, T3 has a significant promoting effect on the sugar accumulation of the citrus fruits. Compared with the commercial competitor, the soluble solids content of T3 is 20.29% higher, the soluble solids content of T4 is 10.43% higher than that of the competitor, and the soluble solids content of T1 and T2 is 12.79% and 12.56% respectively, which is 4.24% and 2.36% higher than that of the competitor, indicating that the peanut meal fermentation liquid of Example 10 has a positive effect on improving the soluble sugar content of the citrus. Vitamin C, also known as ascorbic acid, is beneficial to human health in moderate intake, and is also an important indicator for judging fruit quality. In this study, the determination results of the vitamin C content show that the four treatments are significantly higher than the competitor, and T3 is 19.13% higher than the competitor, and T1 and T2 are 7.17% and 3.76% higher than the competitor respectively, indicating that the peanut meal fermentation developed in this study can effectively improve the vitamin C content of the citrus fruits, and improve the flavor and nutritional value. For the effect of the strain SHAN-1 peanut meal fermentation liquid on the sugar increase of the citrus fruits, soluble sugar and soluble acid are important indicators. As shown in Table 6, the soluble sugar content of the citrus fruits after spraying the peanut meal fermentation liquid is significantly higher than that of the commercial competitor, and the titratable acid content is lower than that of the commercial competitor, among which, T3 and T4 reduce more, and the soluble sugar content is 15.96% and 12.02% higher respectively, and the titratable acid content is 15.00% and 9.52% lower than that of the competitor respectively. The reason why the fermentation liquid prepared in Example 10 has better effect than that prepared in Example 9 is that the lipase and yeast added in the fermentation method can degrade fat and polysaccharides and other substances into small molecules in the solution, and these substances have a promoting effect on the quality and nutritional value of the citrus. In summary, the peanut meal fermentation liquid prepared in this study has a promoting effect on the acid reduction and sugar increase of the citrus, and can improve the quality and flavor of the fruits to a certain extent.

[0219] Table 6 Effect of the strain SHAN-1 peanut meal fermentation liquid on the sugar increase of the citrus fruits

[0220]

[0221] Note: Different lowercase letters after the same column data indicate significant difference (P < 0.05).

[0222] The above examples are the preferred embodiments of the present application, but the embodiments of the present application are not limited to the above examples, and any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present application should be equivalent replacement methods, and are included in the protection scope of the present application.

Claims

1. A strain of Bacillus subtilis ( Bacillus subtilis SHAN-1, characterized in that, It was deposited on March 3, 2023, at the China General Microbiological Culture Collection Center (CGMCC) of the Institute of Microbiology, Chinese Academy of Sciences, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 26729.

2. A microbial agent, characterized in that, The fermentation product containing Bacillus subtilis SHAN-1 as described in claim 1 and Bacillus subtilis SHAN-1 as described in claim 1.

3. The microbial agent according to claim 2, characterized in that, The fermentation product of Bacillus subtilis SHAN-1 contains protease.

4. The microbial agent according to claim 3, characterized in that, The fermentation product of Bacillus subtilis SHAN-1 also contains auxin.

5. The microbial agent according to claim 2, characterized in that, The fermentation product was obtained by fermenting peanut bran with Bacillus subtilis SHAN-1 and Saccharomyces cerevisiae.

6. The method for preparing the fermentation product of Bacillus subtilis SHAN-1 according to claim 1, characterized in that, Includes the following steps: The above-mentioned Bacillus subtilis SHAN-1 was inoculated into a fermentation substrate for fermentation; the fermentation substrate included a nitrogen source, a carbon source, and metal ions, wherein the nitrogen source contained 10 g·L⁻¹. -1 The skim milk powder, wherein the carbon source comprises a concentration of 5 g·L -1 The glucose, wherein the metal ions comprise 1 g·L -1 Mg 2+ .

7. The method according to claim 6, characterized in that, The fermentation substrate also contains L-tryptophan.

8. Application, characterized in that: The application is any one of the following A1) to A6): A1) The application of Bacillus subtilis SHAN-1 as described in claim 1 in the preparation of protease; A2) The application of Bacillus subtilis SHAN-1 as described in claim 1 in the preparation of auxin; A3) The application of Bacillus subtilis SHAN-1 as described in claim 1 or the inoculant as described in any one of claims 2 to 5 in promoting plant growth; A4) The application of Bacillus subtilis SHAN-1 as described in claim 1 or the inoculum as described in any one of claims 2 to 5 in promoting seed germination; A5) The application of Bacillus subtilis SHAN-1 as described in claim 1 or the inoculum as described in any one of claims 2 to 5 in increasing the sugar content of citrus fruits; A6) The application of Bacillus subtilis SHAN-1 as described in claim 1 or the bacterial agent as described in any one of claims 2 to 5 in reducing the acid content of citrus fruits.

Images