Murine combined lactobacillus and application thereof in large yellow croaker feed additive

Abstract

The invention discloses a mouse combined lactobacillus and an application of the mouse combined lactobacillus in a large yellow croaker feed additive. The mouse combined lactobacillus S27 is preserved in the China Center for Type Culture Collection on October 14, 2024, and the preservation number is CCTCC (China Center for Type Culture Collection) No.M 20242189. The invention further discloses a preparation method of the mouse combined lactobacillus. The strain is separated and identified from healthy large yellow croaker intestinal tracts, has antibacterial activity and non-hemolytic activity, can be used as a feed additive, has the functions of promoting the growth performance of large yellow croakers and preventing and treating the visceral white-spot disease, provides a new idea for replacing antibiotics to treat the visceral white-spot disease, and also provides a reliable standby strain for a fish-derived microecological preparation.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and particularly relates to a mouse combined lactobacillus and application thereof in a large yellow croaker feed additive. Background Art

[0002] Yellow croaker, commonly known as yellow croaker, belongs to the order Perciformes, family Sciaenidae, and genus Pseudocrocea. It is one of the most important economic fish in China. In the process of cage culture of yellow croaker, with the continuous increase in the density of culture, bacterial diseases frequently occur, posing a huge threat to the sustainable development of yellow croaker culture. Bacterial diseases can occur throughout the year, among which Pseudomonas proteus ( Pseudomonas plecoglossicida ) is particularly serious, with a mortality rate of up to 70% - 80%, causing great economic losses to the large yellow croaker farming industry. Since no effective commercial vaccine has been developed to prevent and control the disease, antibiotics are still the main treatment for Pseudomonas proteus. However, over-reliance on antibiotics not only exacerbates the drug resistance of Pseudomonas proteus, but also destroys the intestinal microbiota of large yellow croaker and leads to antibiotic residues. Therefore, the development of alternative antibiotics has become a top priority, among which probiotics have attracted much attention as an alternative strategy.

[0003] Probiotics have the characteristics of promoting growth and preventing and treating diseases. Currently, many probiotics have been widely used in the field of human and veterinary medicine, mainly lactic acid bacteria and Bacillus. Ligilactobacillus murinus ) belongs to the genus Lactobacillus and the family Lactobacillaceae. Lactobacillus muris has gained wide recognition as a probiotic and is widely distributed in natural ecosystems. In the intestine, Lactobacillus muris is a quantifiable biomarker that indicates the health of the intestine. Increasing the abundance of Lactobacillus muris in the intestine can increase the level of beneficial metabolites, promote growth, and inhibit pathogen colonization, which has a positive effect on the host. Summary of the invention

[0004] In view of the problems existing in the above-mentioned prior art, the present invention aims to provide a mouse-associated Lactobacillus and its application in large yellow croaker feed additives, which can promote the growth of large yellow croaker and has the effect of preventing and treating visceral white spot disease.

[0005] The technical solution adopted by the present invention is as follows: A mouse-associated Lactobacillus S27, the strain is classified and named as mouse-associated Lactobacillus ( Ligilactobacillus murinus )S27, deposited in the China Center for Type Culture Collection on October 14, 2024, with the deposit number: CCTCC No.M 20242189.

[0006] Furthermore, the above-mentioned mouse-associated lactobacillus S27 has an inhibitory effect on Pseudomonas aeruginosa, Vibrio alginolyticus and Aeromonas hydrophila.

[0007] A feed additive, comprising the bacterial body and fermentation liquid of the Lactobacillus associating rats S27 according to claim 1.

[0008] Furthermore, the preparation steps of the bacterial cells and fermentation liquid of the above-mentioned mouse-associated Lactobacillus S27 are as follows: The mouse-associated Lactobacillus S27 was inoculated into MRS liquid culture medium, and activated at 37°C for 12 h to obtain seed liquid. The seed liquid was then transferred to new MRS liquid culture medium at an inoculation rate of 1 vol%, and fermented at 37°C for 24 h. The culture was centrifuged at 5500 rpm for 10 min. The collected precipitate was the bacterial body of mouse-associated Lactobacillus S27, and the collected supernatant was the fermentation liquid of mouse-associated Lactobacillus S27.

[0009] Furthermore, the bacterial concentration of Lactobacillus serovar S27 was adjusted to 3×10 10 CFU / mL.

[0010] The above feed additive is used in biological control preparations for preventing and controlling aquatic diseases or in large yellow croaker feed.

[0011] Furthermore, the aquatic disease is white spot disease of large yellow croaker viscera caused by Pseudomonas proteus.

[0012] Furthermore, when raising large yellow croaker, the feed additive is evenly sprayed on the large yellow croaker feed, and the feed containing Lactobacillus murine S27 is obtained after being shade-dried.

[0013] Furthermore, the feed additive is added in an amount of 3 × 10 8 CFU / g~3×10 9 CFU / g.

[0014] Compared with the prior art, the beneficial effects of the present invention are: (1) The mouse-associated lactobacillus S27 of the present invention can significantly increase the final body weight, body weight growth rate, specific growth rate and feed efficiency of large yellow croaker, thereby improving the growth performance of large yellow croaker.

[0015] (2) The mouse-associated lactobacillus S27 of the present invention can prevent and treat visceral white spot disease, reduce the bacterial load of various tissues of large yellow croaker after infection with Pseudomonas aeruginosa, and improve the survival rate of large yellow croaker.

[0016] (3) The mouse-associated Lactobacillus S27 of the present invention has potential application prospects in the field of replacing antibiotics for the prevention and treatment of visceral white spot disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 : Pictures of the colony morphology of Lactobacillus murine S27.

[0018] Figure 2 : Images of Lactobacillus murine S27 under oil microscope (A) and scanning electron microscope (B).

[0019] Figure 3 :Phylogenetic tree diagram of Lactobacillus murine S27.

[0020] Figure 4 : Schematic diagram of the hemolytic screening results of mouse combined Lactobacillus S27.

[0021] Figure 5 : The antibacterial effect of the fermentation broth of mouse combined Lactobacillus S27 on different aquatic pathogens; Among them: Pseudomonas aeruginosa (A), Aeromonas hydrophila (B) and Vibrio alginolyticus (C).

[0022] Figure 6 : Bacterial loads of Pseudomonas proteans in spleen (A), liver (B) and intestine (C) of large yellow croaker infected with Pseudomonas proteans for 72 and 120 h after mice were fed with Lactobacillus S27 for 8 weeks. DETAILED DESCRIPTION

[0023] The technical solution of the present invention is further described in detail below through specific embodiments.

[0024] In the present invention, unless otherwise specified, the equipment and raw materials used can be purchased from the market or are commonly used in the art. The methods in the following embodiments, unless otherwise specified, are all conventional methods in the art.

[0025] The reagents used in the following examples, unless otherwise specified, can be purchased from conventional biochemical reagent stores.

[0026] The formula of MRS liquid culture medium is: 10 g peptone, 5 g yeast extract, 10 g beef extract, 20 g glucose, 2 g dipotassium hydrogen phosphate, 2 g ammonium citrate, 5 g sodium acetate, 0.58 g magnesium sulfate, 0.25 g manganese sulfate, 80 mL Tween, 1.0 L distilled water, pH value is 6.5±0.2. When preparing MRS solid culture medium, add 15 g agar and sterilize at 115℃ for 15 min.

[0027] The formula of TSB liquid culture medium is: 15 g tryptone, 5 g soytone, 5 g sodium chloride, 1.0 L distilled water, pH 7.3±0.2. When preparing TSA culture medium, add 15 g agar and sterilize it by high pressure at 121℃ for 15 min.

[0028] The formula of 2216E liquid culture medium is: 5 g peptone, 1 g yeast extract powder, 0.1 g ferric citrate, 19.45 g sodium chloride, 5.98 g magnesium chloride, 3.24 g sodium sulfate, 1.8 g calcium chloride, 0.55 g potassium chloride, 0.16 g sodium carbonate, 0.08 g potassium bromide, 0.034 g strontium chloride, 0.022 g boric acid, 0.004 g sodium silicate, 0.0024 g sodium fluoride, 0.0016 g ammonium nitrate, 0.008 g disodium hydrogen phosphate, pH value 7.6±0.2. When preparing 2216E solid culture medium, add 15 g agar and sterilize at 121℃ for 15 min.

[0029] Example 1 Isolation and identification of Lactobacillus spp. S27 (1) Lactobacillus murine S27 was isolated from the intestinal samples of large yellow croaker, which was caught in Ningde, Fujian. The whole intestine of large yellow croaker was fully minced and mixed with sterile PBS (pH 7.2) (w / v 1:9), and then diluted to 10% by adding sterile PBS. -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 and 10 -7 6 concentrations, take 100 μL of the above dilutions of different concentrations and evenly spread them on MRS solid culture plates, and place them in round-bottom vertical anaerobic culture bags, and culture them in a 37℃ incubator for 48 h. Pick a single colony on the plate, streak it on the MRS solid culture plate with an inoculation loop, and culture it at 37℃ for 48 h for purification. After three generations of continuous purification, a pure culture numbered S27 was obtained. Figure 1 As shown, the S27 colony is white, round, convex in the middle, smooth on the surface, with irregular edges and opaque shape.

[0030] (2) Bacterial genomic DNA was extracted using a bacterial genomic DNA extraction kit (DP302, Tiangen Biochemical Technology (Beijing) Co., Ltd.), and the extracted DNA was amplified by PCR using universal primers 27F and 1492R (27F: AGAGTTTGATCCTGGCTCAT; 1492R: ACGGCTACCTTGTTACGACTT). The total reaction system for PCR amplification was 50 μL, and the specific reaction system was: Taq PCR Master Mix 25 μL, 1 μL of 10 μmol / L forward primer (27F), 1 μL of 10 μmol / L reverse primer (1492R), 22 μL of nuclease-free water, and 1 μL of DNA template. The PCR reaction program was: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 90 s, 30 cycles; extension at 72°C for 10 min; storage at 4°C. The PCR products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing analysis. The sequences were aligned by Blast on NCBI, and a phylogenetic tree was constructed using the neighbor-joining method using MEGA11 software.

[0031] (3) Results: Figure 2 As shown in the figure, the Gram staining method was used to take pictures under the microscope oil lens, and the results showed that Lactobacillus murine S27 was a Gram-positive bacterium; the morphological observation of the strain using a scanning electron microscope showed that Lactobacillus murine S27 was long rod-shaped, with a diameter of about 0.8 μm and a length of about 3 to 5 μm. Figure 3 As shown, the phylogenetic tree based on the 16S rDNA sequence (SEQ ID NO: 1) confirmed that strain S27 was related to Lactobacillus murineus ( Ligilactobacillus murinus ) were grouped into one type and named as Lactobacillus murine S27.

[0032] Example 2 Hemolytic Screening of Mouse-Lactobacillus S27 When the MRS solid culture medium is cooled to 45-50°C after high-pressure sterilization, add sterile defibrinated sheep blood preheated to room temperature (the amount added is 5% of the volume of the MRS solid culture medium), rotate the flask to mix thoroughly while avoiding the formation of bubbles, and invert the plate to cool to obtain a blood agar plate. Pick a single colony of S27 on the plate and streak it on the blood agar plate, incubate it at 37°C for 24 hours, and confirm its hemolytic nature. Strains that produce green areas around the colonies (α-hemolysis) and have no effect on blood agar (γ-hemolysis) are identified as non-hemolytic strains, while strains that produce blood lysis areas around the colonies (β-hemolysis) are identified as hemolytic strains. Figure 4As shown, Lactobacillus murine S27 had no effect on blood agar and was identified as a non-hemolytic strain, indicating that the Lactobacillus murine S27 strain could not adversely affect the host through hemolysis.

[0033] Example 3 Antibiotic sensitivity test of mouse combined lactobacillus S27 According to the technical requirements of the antimicrobial susceptibility test of the health industry standard of the People's Republic of China, this implementation adopts the drug sensitivity paper agar diffusion method to detect the sensitivity of Lactobacillus muris S27 to eight antibiotics: penicillin, ampicillin, tetracycline, doxycycline, clindamycin, erythromycin, enrofloxacin and chloramphenicol. Lactobacillus muris S27 was inoculated into MRS liquid medium and cultured until OD 600 =1.1 (approximately 3×10 8 CFU / mL), take 1 mL of the above bacterial solution and add it to 100 mL of MRS medium containing 0.75% (w / v) agar cooled to about 45°C, mix well and pour into the culture dish. After solidification, place the drug-sensitive paper on the solid culture medium, culture at 37°C for 24 hours, and measure the diameter of the inhibition zone. The results are shown in Table 1, which show that mouse combined lactobacillus S27 shows different degrees of sensitivity to the above antibiotics.

[0034] Table 1 Sensitivity of Lactobacillus murinus S27 to antibiotics Note: R stands for resistant, I stands for intermediate, and S stands for sensitive.

[0035] Example 4 Test on the inhibitory effect of mouse combined with Lactobacillus S27 on aquatic pathogens A single colony of Lactobacillus associating with rats S27 was inoculated into 5 mL of MRS liquid culture medium, and activated and cultured at 37°C for 12 h to obtain a seed solution; the seed solution was then transferred to a new MRS liquid culture medium at an inoculation rate of 1 vol%, and fermented and cultured at 37°C for 24 h to obtain a pure culture; after the fermentation culture was completed, the pure culture was centrifuged at 5500 rpm for 10 min to remove the bacteria, and the supernatant was collected, which was the fermentation liquid of Lactobacillus associating with rats S27.

[0036] The inhibitory activity of the fermentation broth of mouse combined Lactobacillus S27 against three aquatic pathogens was determined by plate agar diffusion method. The test strains were Pseudomonas proteus, Aeromonas hydrophila and Vibrio alginolyticus. Pseudomonas proteus and Aeromonas hydrophila were cultured in TSA medium, and Vibrio alginolyticus was cultured in 2216E medium. When each test strain reached the logarithmic growth phase (approximately 1×10 9CFU / mL), add 100 μL of the culture solution of the above strains to 100 mL of the corresponding sterile medium (containing agar) cooled to about 45°C, then mix thoroughly and pour into the plate. After cooling and solidification, use a sterile puncher to punch a hole in the center, inoculate 100 μL of the fermentation solution of mouse Lactobacillus S27 in each hole, diffuse on the clean bench for 1 hour, and culture at 27°C for 24 hours. After that, observe and count the size of the inhibition zone. If the tested pathogens are inhibited, a transparent inhibition zone will appear on the plate. The results are shown in Table 2 and Figure 5 As shown, the fermentation broth of mouse combined Lactobacillus S27 has inhibitory activity against three aquatic pathogens, namely Pseudomonas proteus, Vibrio alginolyticus and Aeromonas hydrophila.

[0037] Table 2 Inhibition diameter of S27 against aquatic pathogens Among them, Pseudomonas proteus PQLYC4 was provided by the College of Oceanography, Fujian Agriculture and Forestry University, and the reference is An outbreak of visceral white nodules disease caused by Pseudomonas plecoglossicida at a water temperature of 12°C in culturedlargeyellow croaker ( Larimichthyscrocea ) in China.

[0038] Example 5 Test on growth promotion and prevention of visceral white spot disease in mice by combining Lactobacillus S27 640 healthy large yellow croakers were selected and randomly divided into 8 1.0 m×1.5 m×1.5 m cages. The experiment was divided into a control group (CON) and an S27 group, with 4 replicates in each group. The control group was fed with ordinary large yellow croaker feed (large yellow croaker compound feed, Fujian Tianma Technology Group Co., Ltd.), and the S27 group was fed with feed containing Lactobacillus murine S27. The fish were fed twice a day at a fixed time in the morning and evening, and each time they were fed until they were visually full, and the residual bait was removed. The culture time was 8 weeks.

[0039] Preparation of feed containing Lactobacillus associatus S27: A single colony of Lactobacillus associatus S27 was inoculated into 5 mL of MRS liquid culture medium, and activated and cultured at 37°C for 12 h to obtain seed liquid; then the seed liquid was transferred to a new MRS liquid culture medium at an inoculation rate of 1 vol%, and cultured at 37°C for 24 h, and then centrifuged at 5500 rpm for 10 min. The collected precipitate was the cell of Lactobacillus associatus, and the collected supernatant was the fermentation liquid of Lactobacillus associatus. The fermentation liquid of Lactobacillus associatus S27 was added to adjust the concentration of the bacterial suspension to 3×10 10CFU / mL for subsequent use. The concentration of bacterial suspension was adjusted to 3×10 9 CFU / mL, spray 100mL (i.e. 3×10 8 CFU / g), dried in the shade and stored at 4℃ for future use.

[0040] The final body weight and feed consumption of each group of large yellow croaker were recorded, and the body weight growth rate, specific growth rate and feed efficiency of each group were calculated using the following formula: Weight gain rate = 100 × (W t − W0) / W0; Specific growth rate = 100 × (lnW t − lnW0) / t; Feed efficiency = (W t – W0) / FC; Among them, W t = represents final body weight, W0 represents initial body weight, t represents culture period, and FC represents feed consumption. The effect of Lactobacillus murinus S27 on the resistance of large yellow croaker to Pseudomonas proteans infection was evaluated by immersion method simulating natural infection. Sixty large yellow croakers were randomly selected from each group and then exposed to 1×10 5 CFU / mL Pseudomonas proteus PQLYC4 in seawater for 1 h, with a water temperature of about 21°C. After the challenge, the fish were quickly fished out and soaked in fresh seawater for 10 minutes, and then placed in a culture tank containing about 150 L of fresh seawater. The culture tank was replaced with fresh seawater once a day, and feed containing Lactobacillus murine S27 was fed every 2 days during the culture period. The observation period was 15 days.

[0041] Survival rate = 100 × (S0-S t ) / S0 S0 represents the number of fish at the beginning of the test, S t Indicates the number of fish at the end of the test.

[0042] In addition, additional infection experiments were performed to evaluate the bacterial load of Pseudomonas proteus in tissues. The infection was carried out under the same conditions as above, with 50 large yellow croakers in each group. At 72 h and 120 h of infection, 8 fish were randomly selected from each group to detect the bacterial load of Pseudomonas proteus in tissues. Total genomic DNA from the intestine, spleen, and liver was extracted using the TIANamp Marine Animal DNA Kit (DP324, Tiangen Biochemical Technology (Beijing) Co., Ltd.) according to the manufacturer's instructions. The load of Pseudomonas proteus in tissues was detected using qRT-PCR (probe method). ikB The fragment T vector (Takara, 6013) was diluted 10-fold to prepare the standard curve. ikBThe primers, probes, reaction system and reaction procedures are as follows: F: TGCTGAAGGACGAGCGTTCG; R: ATCATCTTGCCGACAACAGC; probe: FAM-CCTGAACACCAACAAGACGCCGGT-BHQ1. The total reaction system was 20 μL, and the specific reaction system was: Premix Ex Taq (Probe qPCR) (2×) 10 μL, 10 μmol / L forward primer (F) 0.2 μL, 10 μmol / L reverse primer (R) 0.2 μL, 10 μmol / L probe (probe) 0.4 μL, nuclease-free water 8.2 μL, DNA template 1 μL. The reaction program was: 95℃30s; 95℃5s, 60℃30s, 40 cycles.

[0043] The results are shown in Table 3. The mouse combined with Lactobacillus S27 can significantly increase the final body weight, body weight growth rate, specific growth rate and feed efficiency of large yellow croaker, thereby improving the growth performance. Figure 6 As shown, Lactobacillus murine S27 significantly reduced the bacterial load in the liver, spleen, and intestine of large yellow croaker after infection with Pseudomonas proteus, thereby improving the survival rate after infection.

[0044] Table 3 Growth indexes and survival rate of large yellow croaker Note:*** p <0.001,** p <0.01,* p <0.05.

[0045] The above is a detailed introduction to a mouse-associated lactobacillus provided by the present invention and its application in a large yellow croaker feed additive. Specific examples are used herein to illustrate the principles and implementation methods of the present invention, and the description of the above embodiments is only used to help understand the method of the present invention and its core idea. It should be pointed out that for those of ordinary skill in the art, without departing from the principles of the present invention, the present invention can also be improved and modified in a number of ways, and these improvements and modifications also fall within the scope of protection of the claims of the present invention.

Claims

1. A mouse-associated Lactobacillus S27, characterized in that: The strain was classified and named as Lactobacillus murineus ( Ligilactobacillus murinus ) S27, deposited in the China Center for Type Culture Collection on October 14, 2024, with the deposit number: CCTCC No. M 20242189.

2. The Lactobacillus murine S27 according to claim 1, characterized in that: The mouse-associated lactobacillus S27 has an inhibitory effect on Pseudomonas proteus, Vibrio alginolyticus and Aeromonas hydrophila.

3. A feed additive, characterized in that: The feed additive comprises the bacterial body and fermentation liquid of Lactobacillus associating S27 described in claim 1.

4. The feed additive according to claim 3, characterized in that: The steps for preparing the bacterial cells and fermentation liquid of the mouse-associated Lactobacillus S27 are as follows: The mouse-associated Lactobacillus S27 was inoculated into MRS liquid culture medium, and activated at 37°C for 12 h to obtain seed liquid. The seed liquid was then transferred to new MRS liquid culture medium at an inoculation rate of 1 vol%, and fermented at 37°C for 24 h. The culture was centrifuged at 5500 rpm for 10 min. The collected precipitate was the bacterial body of mouse-associated Lactobacillus S27, and the collected supernatant was the fermentation liquid of mouse-associated Lactobacillus S27.

5. The feed additive according to claim 3, characterized in that: When used, the fermentation liquid of Lactobacillus serovar S27 was used to adjust the bacterial concentration of Lactobacillus serovar S27 to 3×10 10 CFU / mL.

6. Use of the feed additive according to claim 3 in biological control preparations for preventing and controlling aquatic diseases or in large yellow croaker feed.

7. The use according to claim 6, characterized in that: The aquatic disease is white spot disease of large yellow croaker viscera caused by Pseudomonas proteus.

8. The use according to claim 6, characterized in that: When raising large yellow croaker, the feed additive is evenly sprayed on the large yellow croaker feed, and the feed containing mouse-associated Lactobacillus S27 is obtained after being shade-dried.

9. The use according to claim 6, characterized in that: The amount of feed additive added is 3 × 10 8 CFU / g~3×10 9 CFU / g.

Images