A dehydrosqualene desaturase mutant and its application

Abstract

The present invention discloses a dehydrosqualene desaturase mutant and its application. Msp The CrtN gene was heterologously expressed in Yarrowia lipolytica. In addition, the dehydrosqualene desaturase mutant constructed by the present invention was expressed in Yarrowia lipolytica. Compared with the starting strain, i.e., the non-mutated strain, C 30 The production of carotenoids was improved, and mutants such as L448A, L193I, W450N, N172Y, F100D, and S439G C 30 The carotenoid production was increased by up to 1.41 times. The modified genetically engineered strains are more suitable for industrial applications, which can reduce production costs and improve production efficiency.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a dehydrosqualene desaturase mutant and application thereof. Background Art

[0002] Carotenoids are isoprenoid lipids that are found in many prokaryotes and eukaryotes. Carotenoids have a variety of functions, such as antioxidant, anticancer and antimicrobial activities, as well as immunomodulatory functions. Due to these properties, carotenoids have been widely used in the food, cosmetic and pharmaceutical industries. To date, microbial research has mainly focused on C 40 Carotenoids, while C 30 However, there are relatively few studies on carotenoids.

[0003] Yarrowia lipolytica ( Yarrowia lipolytica ) is an unconventional oil-producing yeast belonging to the class Hemiascomycetes. It is called unconventional yeast because it exhibits many characteristics in physiological characteristics, metabolic pathways, and gene expression compared to conventional yeasts such as Saccharomyces cerevisiae. For example, Yarrowia lipolytica has a strong ability to decompose hydrophobic compounds, a wide range of substrate utilization (it can use glucose, glycerol, oil waste, etc. as carbon sources), and a simple structure, easy cultivation, and a clear genetic background; at the same time, the unique lipid droplet structure provides unique conditions for the storage of hydrophobic products such as carotenoids. Because of these unique characteristics, it exhibits strong stress resistance and can tolerate high salt, low temperature, and excessively high acid and alkali environments. Therefore, it is widely distributed in nature and can be isolated from extreme environments such as the seaside and oil fields.

[0004] Dehydrosqualene desaturase (4,4'-diapophytoene desaturase, CrtN, EC:1.3.8.2) mainly contains two functional regions: substrate binding region and FAD cofactor binding region, which can catalyze multi-step dehydrogenation reactions to generate C 30 As for carotenoids, due to the low catalytic efficiency of CrtN and its substrate promiscuity, there are still many difficulties in using this enzyme for industrial large-scale production. Summary of the invention

[0005] The purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and provide a dehydrosqualene desaturase mutant.

[0006] Another object of the present invention is to provide a gene encoding the above-mentioned dehydrosqualene desaturase mutant.

[0007] Another object of the present invention is to provide the above-mentioned dehydrosqualene desaturase mutant in the production of C 30 Application of carotenoids.

[0008] The purpose of the present invention is achieved through the following technical solutions:

[0009] A dehydrosqualene desaturase is a protein obtained by mutating the amino acid sequence shown in SEQ ID NO.1, wherein the mutation in the sequence is one of the following: F100D, L137A, N172Y, L193I, E248G, N336F, A357P, H431A, S439G, L448A, W450N, T477W.

[0010] The above-mentioned dehydrosqualene desaturase can be expressed in an engineered bacterium to produce C 30 Carotenoids.

[0011] The nucleotide sequence of the gene encoding the above-mentioned dehydrosqualene desaturase is obtained according to the codon coding rule.

[0012] The above-mentioned gene encoding dehydrosqualene desaturase is a nucleotide sequence obtained by mutation using mutation primers based on the nucleotide sequence shown in SEQ ID NO.2.

[0013] The above-mentioned dehydrosqualene desaturase is used in the production of C 30 Application of carotenoids.

[0014] A dehydrosqualene desaturase gene in the production of C 30 Application of carotenoids.

[0015] The nucleotide sequence of the dehydrosqualene desaturase gene is a nucleotide sequence obtained by mutation on the basis of the nucleotide sequence shown in SEQ ID NO.2, and is one of the following: positions 298 to 300 are mutated to GAC, positions 409 to 411 are mutated to GCC, positions 514 to 516 are mutated to TAC, positions 577 to 579 are mutated to ATC, positions 742 to 744 are mutated to GGA, positions 1006 to 1008 are mutated to TTC, positions 1069 to 1071 are mutated to CCT, positions 1291 to 1293 are mutated to GCT, positions 1315 to 1317 are mutated to GGA, positions 1342 to 1344 are mutated to GCT, positions 1348 to 1350 are mutated to AAC, and positions 1429 to 1431 are mutated to TGG.

[0016] A production C 30 The method for preparing the engineered bacteria of carotenoids comprises the following steps:

[0017] The dehydrosqualene desaturase gene expression cassette was constructed into a vector, and after site-directed mutagenesis using a mutation primer, it was transferred into the engineered bacteria together with the CRISPR / cas9 operation vector to obtain the production of C 30 Engineering bacteria for carotenoids.

[0018] The dehydrosqualene desaturase gene expression cassette is composed of a promoter pTEF in , the coding gene for dehydrosqualene desaturase and the terminator tXPR2.

[0019] The nucleotide sequence of the gene encoding the dehydrosqualene desaturase is shown in SEQ ID NO.2.

[0020] The promoter pTEF in The nucleotide sequence is shown in the NCBI database sequence accession number NC_006069.1 C from position 1243709 to position 1244239.

[0021] The nucleotide sequence of the terminator tXPR2 is shown in the NCBI database sequence accession number NC_006072.1 F from position 3948508 to position 3949031.

[0022] The CRISPR / cas9 operation vector is pCAS1yl; preferably, it is a CRISPR / cas9 operation vector obtained by assembling pCAS1yl with gRNA-AXP after linearization.

[0023] The starting strain of the engineered bacteria is Yarrowia lipolytica, preferably the Yarrowia lipolytica engineered strain DGA1.

[0024] The Yarrowia lipolytica engineering strain DGA1 is obtained by transferring the DGA1 gene expression cassette into the Yarrowia lipolytica engineering strain Po1f S3; preferably, the pTA-HUH vector containing the DGA1 gene expression cassette and the CRISPR / cas9 operation vector pCAS1yl-D10 are co-transferred into the Yarrowia lipolytica engineering strain Po1f S3, and the DGA1 gene expression cassette is positioned at the genomic D10 integration site.

[0025] The DGA1 gene expression box consists of a promoter pENO2, a DGA1 gene and a terminator tPRC1.

[0026] The nucleotide sequence of the DGA1 gene is shown in the NCBI database sequence accession number YALI0E32769g.

[0027] The nucleotide sequence of the promoter pENO2 is shown in the NCBI database sequence accession number CP029160.1 from position 10603930 to position 10604929.

[0028] The nucleotide sequence of the terminator tPRC1 is shown in the NCBI database sequence accession number NC_006067.1 A from position 2027310 to position 2027664.

[0029] The CRISPR / cas9 operation vector pCAS1yl-D10 is a CRISPR / cas9 operation vector obtained by assembling pCAS1yl with gRNA-D10 after linearization.

[0030] The vector is pTA-HUH.

[0031] The mutation primer is a mutation primer capable of site-directed mutation of at least one of F100D, L137A, N172Y, L193I, E248G, N336F, A357P, H431A, S439G, L448A, W450N and T477W on dehydrosqualene desaturase.

[0032] A production C 30 The engineered bacteria of carotenoids are prepared by the above preparation method.

[0033] The above production C 30 Carotenoid-producing bacteria in the production of C 30 Application of carotenoids.

[0034] A recombinant expression vector comprises the coding gene of the dehydrosqualene desaturase.

[0035] The vector skeleton of the recombinant expression vector is pTA-HUH.

[0036] A production C 30 The method of preparing carotenoids comprises the following steps:

[0037] (1) Produce C 30 The engineered bacteria of carotenoids are inoculated into the culture medium for cultivation;

[0038] (2) The culture medium after cultivation is centrifuged to obtain the bacterial cells, which are then crushed and extracted to obtain C 30 Carotenoids.

[0039] The culture described in step (1) is cultured in YPD medium at 28-32°C for 24-72 hours.

[0040] The extraction in step (2) is performed using an organic solvent; preferably, it is performed using n-dodecane; more preferably, it is performed using n-dodecane added with zirconium oxide grinding beads.

[0041] The C 30 The carotenoid is at least one of 4,4'-diapo-ζ-carotene, 4,4'-diaponeurosporene, 4,4'-diapolycopene, 4,4'-diapolycopene-4-ol, 4,4'-diapolycopene-4,4'-diol, and 4,4'-diapolycopene-4-al; preferably at least one of 4,4'-diapo-ζ-carotene, 4,4'-diaponeurosporene, 4,4'-diapolycopene-4-ol, 4,4'-diapolycopene-4,4'-diol, and 4,4'-diapolycopene-4-al.

[0042] Compared with the prior art, the present invention has the following advantages and effects:

[0043] The present invention verifies through experiments that dehydrosqualene desaturase can use squalene as a substrate, and changes the amino acid residues at the binding sites of the protein molecule, substrate and cofactor by site-directed mutagenesis to improve the catalytic efficiency of dehydrosqualene desaturase, and further improve C 30 The present invention is the first to Msp The CrtN gene was heterologously expressed in Yarrowia lipolytica. The dehydrosqualene desaturase mutant constructed by the present invention was expressed in Yarrowia lipolytica, and the CrtN gene was heterologously expressed in Yarrowia lipolytica. 30 The production of carotenoids was improved, and mutants such as L448A, L193I, W450N, N172Y, F100D, and S439G C 30 The carotenoid production increased by up to 1.41 times, and the production of 4,4'-diapolycopene-4-ol and 4,4'-diapolycopene-4,4'-diol increased by about 155% and 267% respectively in the mutant L448A, and 4,4'-diapolycopene-4-al, which cannot be synthesized in the wild type, was obtained. The modified genetically engineered strain is more suitable for industrial applications, which can reduce production costs and improve production efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 The endogenous MEP pathway in Escherichia coli and the exogenous introduction of C30 Carotenoid pathway.

[0045] Figure 2 This is a diagram showing the results of verifying the use of squalene as a substrate by dehydrosqualene desaturase in Example 1.

[0046] Figure 3 The estimated C 30 Carotenoid biosynthesis pathway.

[0047] Figure 4 The C of the mutant strain detected by the rapid detection method in Example 4 30 Results of carotenoid production changes.

[0048] Figure 5 The main C produced in Yarrowia lipolytica detected by high performance liquid chromatography in Example 4 30 Liquid phase peak diagram of carotenoids.

[0049] Figure 6 The HPLC-MS method for the determination of DGA1- Msp The main C produced in CrtN-WT 30 Mass Spectrum of Carotenoids.

[0050] Figure 7 The main C 30 Mass Spectrum of Carotenoids. DETAILED DESCRIPTION

[0051] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0052] The Yarrowia lipolytica engineered strain Po1f S3 used in the present invention has been disclosed in Chinese invention patent application CN118028344A and is stored in the laboratory of the School of Biological Sciences and Engineering of South China University of Technology.

[0053] The expression vector p15AY used in the present invention has been described in the literature "Construction of luminescent Escherichia coli via expressing luxoperons and their application on toxicity test [J]. Applied Microbiology and Biotechnology, 106(18), 6317-6333. doi:10.1007 / s00253-022-12136-1” and stored in the laboratory of School of Biological Sciences and Engineering, South China University of Technology.

[0054] The overexpression vector pTA-HUH used in the present invention has been described in the literature "Multiplex gene editing of the Yarrowia lipolytica The genome was published in "Journal of Industrial Microbiology & Biotechnology, 2016, 43(8): 1085-1093. doi: 10.1007 / s10295-016-1789-8", donated by Professor Yang Xiaofeng of South China University of Technology, and preserved in the laboratory of the School of Biological Sciences and Engineering of South China University of Technology.

[0055] If no specific experimental conditions are specified in the following embodiments, conventional experimental conditions or experimental conditions recommended by the reagent company are generally followed. The materials and reagents used, unless otherwise specified, are all reagents and materials obtained from commercial sources.

[0056] Example 1 Verification of dehydrosqualene desaturase using squalene as substrate

[0057] 1.1 Construction of gene expression module vector

[0058] (1) Based on the genome sequence of Yarrowia lipolytica in Genbank, the squalene synthase (SQS) gene from Yarrowia lipolytica with 30 amino acids truncated at the N-terminus and 60 amino acids truncated at the C-terminus was obtained by PCR amplification; based on the known amino acid sequence of dehydrosqualene desaturase, the codon-optimized (SEQ ID NO. 2) was synthesized by the company, and the optimized SQS gene was obtained by PCR amplification. Msp CrtN gene fragment; and primers were designed according to the expression vector p15AY sequence:

[0059] Table 1 SQS and Msp Primers related to CrtN gene amplification

[0060]

[0061] Using the genome of Yarrowia lipolytica Po1f ΔKU70ΔKU80 as a template, p15-SQS-30 / p15-SQS-385, p15-MspCrtN-2 / p15-MspCrtN-1, p15-SQS-30 / p15-SQS-MspCrtN-1, and p15-SQS-MspCrtN-2 / p15-MspCrtN-1 were used to obtain SQS30-385, ... Msp CrtN, SQS30-385+ Msp SQS30-385 assembly fragment in CrtN, SQS30-385+ Msp CrtN Msp CrtN assembly fragment. PCR reaction conditions: 95 ℃ pre-denaturation for 5 min, 95 ℃ denaturation for 15 s, 55 ℃ annealing for 15 s, 72 ℃ extension for 2 min, 72 ℃ extension for 10 min after 30 cycles, and storage at 4 ℃.

[0062] (2) The plasmid p15AY was digested with BamHI endonuclease and then recovered and purified. The p15AY linearized fragment was cloned with SQS30-385 and SQS30-385 using the Vazyme assembly kit ClonExpress II One Step Cloning Kit. Msp CrtN, SQS30-385+ Msp SQS30-385 assembly fragment in CrtN, SQS30-385+ Msp CrtN Msp CrtN assembly fragments were assembled to construct p15AY-SQS30-385, p15AY- Msp CrtN、p15AY-SQS30-385+ Msp CrtN plasmid.

[0063] 1.2 Transformation to obtain engineered strains p15AY-SQS30-385, p15AY- Msp CrtN、p15AY-SQS30-385+ Msp CrtN, the steps are:

[0064] (1) The three plasmids p15AY-SQS30-385, p15AY- Msp CrtN、p15AY-SQS30-385+ Msp CrtN was transformed Escherichia coli K-12 MG1655 competent cells, screening for recombinants.

[0065] (2) Recombinants were randomly selected and verified by PCR and sequencing to successfully obtain recombinants containing p15AY-SQS30-385, p15AY- Msp CrtN、p15AY-SQS30-385+ Msp CrtN plasmid-engineered strains.

[0066] (3) Separately transfer the p15AY-SQS30-385 and p15AY- Msp CrtN、p15AY-SQS30-385+ Msp The engineered strain of CrtN plasmid was inoculated on LB plate containing kanamycin and cultured at 37℃ for 24h. Msp The engineered strain containing the CrtN plasmid appears white, while the strain containing p15AY-SQS30-385+ Msp The engineered strains of CrtN plasmids appear orange-red (e.g. Figure 1 ), indicating that it originated from Methylomonas ( Methylomonas sp. ) can use squalene as a substrate.

[0067] Example 2 Construction of the Yarrowia lipolytica engineered strain DGA1

[0068] 2.1 Construction of gene expression module vector

[0069] (1) According to the genome sequence of Yarrowia lipolytica in Genbank, the DGA1 gene (diacylglycerol acyltransferase, DGA1, YALI0E32769g), the upstream promoter fragment pENO2, and the downstream terminator fragment tPRC1 from Yarrowia lipolytica were obtained by PCR amplification, and the Yarrowia lipolytica genome integration site was the upstream and downstream homology arms of the D10 gene integration; and primers were designed according to the sequence of the expression vector pTA-HUH:

[0070] Table 2 Primers related to DGA1 gene amplification

[0071]

[0072] Using the genome of Yarrowia lipolytica Po1f ΔKU70ΔKU80 as a template, primers DGA1-1 / 2, DGA1-3 / 4, DGA1-5 / 6, UP-D10-F / R, and DW-D10-F / R were used to PCR amplify the pENO2, DGA1, tPRC1, UP-D10 (SEQ ID NO.5), and DW-D10 (SEQ ID NO.6) assembly fragments carrying the corresponding terminal homologous sequences. PCR reaction conditions: 95 ℃ pre-denaturation for 5 min, 95 ℃ denaturation for 15 s, 55 ℃ annealing for 15 s, 72 ℃ extension for 2 min, 72 ℃ extension for 10 min after 30 cycles, and storage at 4 ℃.

[0073] (2) The plasmid pTA-HUH was digested with PciⅠ endonuclease and then recovered and purified. The pTA-HUH linearized fragment and the UP-D10 assembly fragment were assembled using the Vazyme assembly kit ClonExpress II One Step Cloning Kit to complete the construction of the pTA-HUH-UP-D10 plasmid.

[0074] (3) The plasmid pTA-HUH-UP-D10 was digested with NdeⅠ endonuclease and then recovered and purified. The pTA-HUH-UP-D10 linearized fragment and the DW-D10 assembly fragment were assembled using the Vazyme assembly kit ClonExpress II One Step Cloning Kit to complete the construction of the pTA-HUH-UP-DW-D10 plasmid.

[0075] (4) The plasmid pTA-HUH-UP-DW-D10 was digested with NruⅠ endonuclease and then recovered and purified. The pTA-HUH-UP-DW-D10 linearized fragment, promoter pENO2, terminator tPRC1, and DGA1 assembly fragment were assembled using the Vazyme assembly kit ClonExpress II One Step Cloning Kit to construct the pTA-HUH-D10-DGA1 plasmid. The plasmid pTA-HUH-D10-DGA1 was digested with SmiⅠ, and the integrated fragment was recovered, purified, and concentrated.

[0076] 2.2 Construction of CRISPR / cas9 operation vector

[0077] (1) By designing the sgRNA target sequence of the chromosome integration site online, the sgRNA target sequence was introduced into the primer, and the sgRNA target sequence was introduced into the CRISPR / cas9 operation vector by homologous recombination. The primers were designed according to the sequence of the expression vector pCAS1yl (Addgene#73226):

[0078] Table 3 Primers related to CRISPR / cas9 vectors for amplifying D10 locus

[0079]

[0080] gRNA sequences:

[0081] gRNA-D10:TAGCTCGCCTTATAACACAG

[0082] (2) The plasmid pCAS1yl was digested with NheⅠ endonuclease and then recovered and purified. The pCAS1yl linearized fragment and the gRNA-D10 assembly fragment were assembled using the Vazyme assembly kit ClonExpress II One Step Cloning Kit to complete the construction of the pCAS1yl-D10 plasmid.

[0083] 2.3 The engineered strain DGA1 was constructed using the lithium acetate transformation method, the steps are as follows:

[0084] (1) Preparation of Yarrowia lipolytica Po1f S3 competent cells

[0085] I. Pick a single colony of Yarrowia lipolytica Po1f S3 from a streaked plate on YPD medium with an inoculation loop and inoculate it into 50 mL of liquid YPD medium. Cultivate at 30°C and 250 rpm in a shaking incubator until the OD 600 =15.

[0086] II. Centrifuge at 12,000 rpm for 4 min at room temperature, collect the cells, rinse twice with 10 mL of sterile water, suspend the cells with 5 mL of 0.1 mol / L lithium acetate (pH 6.0), and incubate at room temperature for 10 min.

[0087] III. Add sterile cooled glycerol to the competent cells to a final concentration of 25% (v / v), aliquot 100 μL into sterile 2 mL centrifuge tubes for yeast transformation or store in a -80 ℃ refrigerator.

[0088] (2) Transform the CRISPR / cas9 operation vector pCAS1yl-D10 obtained in step 2.2 (2) and the linearized recombinant plasmid pTA-HUH-D10-DGA1 obtained in step 2.1 (4) and screen the recombinants.

[0089] I. Gently mix 100 μL of competent cells, 500 ng~1 μg of linearized recombinant plasmid, 500 ng~1 μg of CRISPR / cas9 operation vector and 10 μL of salmon sperm DNA (10 mg / mL), and incubate at 30 ℃ for 15 min.

[0090] II. Add 700 μL of 40% PEG 4000, mix by pipetting, and incubate at 30°C, 250 rpm for 1 h.

[0091] III. Place the centrifuge tube in a 39 ℃ water bath and warm it for 1 hour.

[0092] IV. Add 1 mL of YPD medium, recover the culture at 30°C and 250 rpm for 2 h, centrifuge at 12,000 rpm for 1 min at room temperature, discard the supernatant and resuspend the cells with 1 mL of sterile water.

[0093] V. Centrifuge at 12,000 rpm for 1 min at room temperature to collect the cells, resuspend them in 100 μL of sterile water and spread them on the screening medium SC-URA-LEU solid plate, and culture them at 30°C for 3 to 5 days.

[0094] VI. Recombinants were randomly selected and verified by PCR using the following primers (CX-ENO2-1: GAGCACAGGGTTTAGGAGGT; CX-PRC1t-1: ACGTGTGCTGTGGATTGTTC). The resulting fragment size was 2403 bp, indicating that the target gene was successfully integrated into the Yarrowia lipolytica genome, and the engineered strain DGA1 was obtained.

[0095] Example 3 Obtaining dehydrosqualene desaturase strains and site-directed mutation strains

[0096] 3.1 Build Msp CrtN-WT gene expression module vector

[0097] (1) The company synthesized the known amino acid sequence of dehydrosqualene desaturase after codon optimization and obtained the optimized sequence through PCR amplification. Msp CrtN gene fragment, upstream promoter fragment pTEF in, the downstream terminator fragment tXPR2, the Yarrowia lipolytica genomic integration site is the upstream and downstream homology arms of the AXP gene integration; and primers are designed according to the expression vector pTA-HUH sequence:

[0098] Table 4 Amplification optimization Msp CrtN gene related primers

[0099]

[0100] Synthesized by a gene company Msp The plasmid containing the CrtN gene fragment was used as a template, and the MspCrtN-F / R primers were used to PCR amplify the corresponding terminal homologous sequence. Msp CrtN gene fragment; using the genome from Yarrowia lipolytica Po1f ΔKU70ΔKU80 as a template, PCR amplification was performed using primers CrtN-AXP-F / Episomal-R, Episomal-F / CrtN-AXP-R, AXP-UP-F / R, and AXP-DW-F / R to obtain pTEF carrying the corresponding terminal homologous sequence in , tXPR2, AXP-UP (SEQ ID NO.7), AXP-DW (SEQ ID NO.8) assembly fragments. PCR reaction conditions: 95 ℃ pre-denaturation for 5 min, 95 ℃ denaturation for 15 s, 55 ℃ annealing for 15 s, 72 ℃ extension for 2 min, 72 ℃ extension for 10 min after 30 cycles, and storage at 4 ℃.

[0101] (2) The plasmid pTA-HUH was digested with PciⅠ endonuclease and then recovered and purified. The pTA-HUH linearized fragment and the AXP-UP assembly fragment were assembled using the Vazyme assembly kit ClonExpress II One Step Cloning Kit to complete the construction of the pTA-HUH-AXP-UP plasmid.

[0102] (3) The plasmid pTA-HUH-AXP-UP was digested with NdeⅠ endonuclease and then recovered and purified. The pTA-HUH-AXP-UP linearized fragment and the AXP-DW assembly fragment were assembled using the Vazyme assembly kit ClonExpress II One Step Cloning Kit to complete the construction of the pTA-HUH-AXP-UP-DW plasmid.

[0103] (4) The plasmid pTA-HUH-AXP-UP-DW was digested with NruⅠ endonuclease and then recovered and purified. The pTA-HUH-AXP-UP-DW linearized fragment and the promoter pTEF in , terminator tXPR2, Msp CrtN assembly fragments were assembled to construct pTA-HUH-AXP- Msp CrtN-WT plasmid. Msp After digestion of CrtN-WT, the integrated fragment was recovered, purified and concentrated.

[0104] 3.2 Construction of CRISPR / cas9 operation vector

[0105] (1) Introduce the sgRNA target sequence into the primer, use homologous recombination to introduce the sgRNA target sequence into the CRISPR / cas9 operation vector, and design primers according to the expression vector pCAS1yl sequence:

[0106] Table 5 Primers related to CRISPR / cas9 vectors for amplifying AXP loci

[0107]

[0108] gRNA sequences:

[0109] gRNA-AXP: GACCAGGTCGAAGTAGCTGG

[0110] (2) The plasmid pCAS1yl was digested with NheⅠ endonuclease and then recovered and purified. The pCAS1yl linearized fragment and the gRNA-AXP assembly fragment were assembled using the Vazyme assembly kit ClonExpress II One Step Cloning Kit to complete the construction of the pCAS1yl-AXP plasmid.

[0111] 3.3 The engineered strain DGA1- was constructed using the lithium acetate transformation method Msp CrtN-WT

[0112] (1) Preparation of Yarrowia lipolytica DGA1 competent cells

[0113] Prepare Yarrowia lipolytica DGA1 competent cells by referring to the method in step (1) of 2.3.

[0114] (2) The CRISPR / cas9 operation vector pCAS1yl-AXP obtained in step 3.2 (2) and the linearized restriction plasmid pTA-HUH-AXP- Msp CrtN-WT was transformed and recombinants were screened.

[0115] Transformation was performed according to the method in step (2) of 2.3, and the orange-red recombinants were selected. After PCR identification, it was confirmed that the target gene was successfully integrated into the Yarrowia lipolytica genome, and the engineered strain DGA1- Msp CrtN-WT.

[0116] 3.4 Construction of dehydrosqualene desaturase mutant engineered strain using lithium acetate transformation method

[0117] (1) pTA-HUH-AXP- Msp CrtN-WT plasmid was used as a template, and the dehydrosqualene desaturase mutant gene was obtained by the whole plasmid site-directed mutagenesis method. Primers were designed using Primer Premier 5.0, and the designed primer sequences are shown in the following table:

[0118] Table 6 Primers related to amplification of dehydrosqualene desaturase mutant genes

[0119]

[0120] PCR reaction conditions: 94 °C pre-denaturation for 5 min, 98 °C denaturation for 10 s, 55 °C annealing for 30 s, 68 °C extension for 90 s, 68 °C extension for 10 min after 30 cycles, and storage at 4 °C. PCR products were digested with 2 μL of Dpn I to remove methylation, purified and recovered. Then transformed E. coliTop10 competent cells were cultured for 12 hours and single colonies were picked. After overnight culture, plasmids were extracted and verified by DNA sequencing whether the phenylalanine at position 100 of dehydrosqualene desaturase was successfully replaced by aspartic acid, or the leucine at position 137 was replaced by alanine, or the asparagine at position 172 was replaced by tyrosine, or the leucine at position 193 was replaced by isoleucine, or the glutamic acid at position 248 was replaced by glycine, or the asparagine at position 336 was replaced by phenylalanine, or the alanine at position 357 was replaced by proline, or the histidine at position 431 was replaced by alanine, or the serine at position 439 was replaced by glycine, or the leucine at position 448 was replaced by alanine, or the tryptophan at position 450 was replaced by asparagine, or the threonine at position 477 was replaced by tryptophan. The mutant plasmids pTA-F100D, pTA-L137A, pTA-N172Y, pTA-L193I, pTA-E248G, pTA-N336F, pTA-A357P, pTA-H431A, pTA-S439G, pTA-L448A, pTA-W450N, and pTA-T477W were successfully obtained through sequencing verification.

[0121] (2) After the mutant plasmid is digested with SmiⅠ endonuclease, the integrated fragment is recovered, purified and concentrated.

[0122] (3) Transform the CRISPR / cas9 operation vector pCAS1yl-AXP obtained in step 3.2 (2) and the linearized restriction plasmids pTA-F100D, pTA-L137A, pTA-N172Y, pTA-L193I, pTA-E248G, pTA-N336F, pTA-A357P, pTA-H431A, pTA-S439G, pTA-L448A, pTA-W450N, and pTA-T477W obtained in step 3.4 (2) respectively, and screen the recombinants.

[0123] Transformation was performed according to the method in step (2) of 2.3, and orange-red recombinants were selected. PCR identification confirmed that the target gene was successfully integrated into the Yarrowia lipolytica genome, and the engineered strains DGA1-F100D, DGA1-L137A, DGA1-N172Y, DGA1-L193I, DGA1-E248G, DGA1-N336F, DGA1-A357P, DGA1-H431A, DGA1-S439G, DGA1-L448A, DGA1-W450N, and DGA1-T477W were obtained.

[0124] Example 4 Effect of site-directed mutation of dehydrosqualene desaturase on C 30 Effect of carotenoid production

[0125] 4.1 Removal of screening markers

[0126] The strain constructed in Example 3: DGA1- Msp Single colonies of CrtN-WT strain and mutant engineered strain were picked into 48-well plates containing 1 mL of YPD medium and cultured at 30°C, 800 r / min for 24 h. Then a small amount of bacterial solution was dipped into YPD solid medium with an inoculation loop and cultured at 30°C for 48 h.

[0127] 4.2 Expanded cultivation

[0128] (1) Initial screening of the well plate: Pick DGA1- Msp Single colonies of the CrtN-WT strain and mutant engineered strain were placed in a 24-well plate containing 2.5 mL of YPD medium and cultured at 30°C, 800 rpm for 48 h.

[0129] (2) Shake flask rescreening: Pick DGA1- Msp Single colonies of CrtN-WT strain and mutant engineered strain were added to a 24-well plate containing 2.5 mL of YPD medium and cultured at 30°C, 800 r / min, for 24 h to obtain seed solution. The seed solution was plated at the final OD 600 =0.1 was transferred to a 250 mL shake flask containing 50 mL YPD medium and cultured at 30°C, 250 r / min for 48 h.

[0130] 4.3 Extraction of carotene

[0131] After the fermentation, take 1 mL of bacterial solution, centrifuge at 12000 r / min for 1 min, and discard the waste liquid. Resuspend the cells with ddH2O, centrifuge, discard the waste liquid, and repeat the washing twice. Add 1 g of zirconium oxide grinding beads and 1 mL of n-dodecane to the fermented cells and vortex for 30 min to extract C 30 Carotenoids.

[0132] 4.4 Detection of carotene production

[0133] (1) Rapid detection method of carotene production by ELISA

[0134] The shaken mixture of bacteria, zirconium oxide and n-dodecane was centrifuged at 12000 r / min and 4°C for 1 min. The upper organic phase was transferred to a 96-well ELISA plate and the intracellular C 30 Relative content of carotenoids.

[0135] Among them, the above-mentioned enzyme marker detects C 30 The relative content of carotenoids is measured under the absorbance light with a detection wavelength of 470 nm.

[0136] Among them, due to C 30 There is no corresponding standard for carotenoids, but C 40 Theoretical absorbance of lycopene (E=3410) and C 30 The theoretical absorbance of carotenoid (4,4'-diapolycopene) is the same (E=3410), so C is used. 40 Lycopene was used as a standard sample to prepare a standard curve for calculating C 30 Carotenoid production.

[0137] (2) Quantitative detection and verification using high performance liquid chromatography

[0138] In order to more accurately determine the C 30 The content of carotenoids was further detected by HPLC. The specific method was to centrifuge the mixture of the shaken bacteria, zirconium oxide and n-dodecane at 12000r / min and 4℃ for 1min, take the upper organic phase and filter it through a filter membrane and add it to a liquid phase vial, and use high performance liquid chromatography to determine the intracellular C 30 Relative content of carotenoids.

[0139] Among them, the above-mentioned high performance liquid chromatography detection of C 30 The relative content of carotenoids is as follows:

[0140] Mobile phase: acetonitrile: methanol = 6:4;

[0141] Chromatographic column: ZORBAX Eclipse XDB-C18 (4.6 mm × 250 mm, 5.0 μm; Agilent Technologies; Santa Clara, USA);

[0142] High performance liquid chromatograph: waters HPLC-1525;

[0143] Elution gradient and flow rate: isocratic elution, 1 mL / min;

[0144] Detection wavelength: 470nm;

[0145] Column temperature: 40℃.

[0146] Using C 40 Lycopene was used as a standard sample to prepare a standard curve for calculating C 30 Carotenoid production.

[0147] (3) Liquid chromatography-mass spectrometry was used to further analyze the sample composition

[0148] In order to confirm the specific composition of the product eluted in step (2) and to exclude the possibility of interference from other components, the eluted product was sent to a testing company for analysis using liquid chromatography-mass spectrometry (LC-MS).

[0149] 4.5 Experimental Results

[0150] (1) The fermentation bacterial extract in the shake flask was detected using a rapid detection method using an ELISA instrument. The recombinant bacteria with dehydrosqualene desaturases with different mutation sites catalyzed the synthesis of C 30 The relative production of carotenoids changes as Figure 4 As shown, the experimental results showed that six mutants including L448A produced C 30 The carotenoid capacity of the mutant DGA1-L448A was significantly improved. 30 The carotenoid production was the largest, with the yield increased to that of the wild-type strain DGA1- Msp 1.41 times that of CrtN-WT.

[0151] (2) The fermentation extracts of the wild type and six mutants with improved yield were further verified by HPLC. The results are as follows Figure 5 As shown in Table 7, the experimental results are consistent with the results of the rapid detection method, proving that the yield has indeed been significantly improved.

[0152] Table 7 C of different strains 30 Carotenoid production test results

[0153]

[0154] (3) DGA1- Msp C extracted from CrtN-WT and DGA1-L448A strains 30 Carotenoid LC-MS test results are as follows Figures 6-7 As shown, Figure 6 For DGA1- Msp The detection results of CrtN-WT strain showed that it mainly contained four components: 4,4'-diapo-ζ-carotene (19%), 4,4'-diaponeurosporene (55%), 4,4'-diapolycopene-4-ol (21%), and 4,4'-diapolycopene-4,4'-diol (5%); Figure 7The test results of DGA1-L448A strain show that the sample mainly contains four components: 4,4'-diapo-ζ-carotene (15%), 4,4'-diapolycopene-4-ol (38%), 4,4'-diapolycopene-4,4'-diol (13%), and 4,4'-diapolycopene-4-al (34%). It basically does not contain other impurities, proving that the eluted component is clearly C 30 Among the products of the mutant L448A, the yield of 4,4'-diapolycopene-4-ol increased by about 155%, the yield of 4,4'-diapolycopene-4,4'-diol increased by about 267%, and 4,4'-diapolycopene-4-al, which could not be synthesized in the wild type, was obtained.

[0155] The experimental results show that the mutant strain is C 30 The total carotenoid production was higher, and some specific structural C 30 The production of carotenoids was significantly increased, demonstrating that the dehydrosqualene desaturase mutant was able to efficiently produce C 30 Carotenoids, in industrial production C 30 Carotenoids have broad application prospects.

[0156] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A dehydrosqualene desaturase, characterized in that: It is a protein obtained by mutation based on the amino acid sequence shown in SEQ ID NO.1, and the mutation in the sequence is L448A.

2. The dehydrosqualene desaturase according to claim 1, characterized in that: The nucleotide sequence of its coding gene is obtained according to the codon coding rules.

3. Use of the dehydrosqualene desaturase according to claim 1 or 2 in the production of C30 carotenoids.

4. A gene encoding a dehydrosqualene desaturase, characterized in that: It is a nucleotide sequence obtained by mutating positions 1342 to 1344 of the nucleotide sequence shown in SEQ ID NO.2 to GCT.

5. A method for preparing an engineered bacterium for producing C30 carotenoids, characterized in that The steps include: The dehydrosqualene desaturase gene expression cassette was constructed into a vector and transferred into the Yarrowia lipolytica engineering strain DGA1 together with the pCAS1yl-AXP CRISPR / cas9 operation vector to obtain an engineering strain that produces C30 carotenoids; The dehydrosqualene desaturase gene expression cassette is composed of the promoter pTEFin, the dehydrosqualene desaturase coding gene of claim 4, and the terminator tXPR2; The pCAS1yl-AXP CRISPR / cas9 operation vector is a CRISPR / cas9 operation vector obtained by assembling pCAS1yl with gRNA-AXP after linearization; The nucleotide sequence of the gRNA-AXP is: GACCAGGTCGAAGTAGCTGG; The Yarrowia lipolytica engineering strain DGA1 is obtained by co-transferring a pTA-HUH vector containing a DGA1 gene expression cassette and a pCAS1yl-D10 CRISPR / cas9 operation vector into a Yarrowia lipolytica engineering strain Po1f S3, and locating the DGA1 gene expression cassette to the D10 integration site of the genome; The DGA1 gene expression cassette is composed of promoter pENO2, DGA1 gene and terminator tPRC1; The NCBI database sequence accession number of the DGA1 gene is YALI0E32769g; The pCAS1yl-D10 CRISPR / cas9 operation vector is a CRISPR / cas9 operation vector obtained by assembling pCAS1yl with gRNA-D10 after linearization; The nucleotide sequence of the gRNA-D10 is: TAGCTCGCCTTATAACACAG.

6. An engineered bacterium for producing C30 carotenoids, prepared by the preparation method according to any one of claim 5.

7. A recombinant expression vector comprising the gene encoding the dehydrosqualene desaturase according to claim 4; The vector skeleton of the recombinant expression vector is pTA-HUH.

8. A method for producing C30 carotenoids, characterized in that The steps include: (1) inoculating the engineered bacteria for producing C30 carotenoids according to claim 6 into a culture medium for cultivation; (2) The culture medium after cultivation is centrifuged to obtain the bacterial cells, which are then crushed and extracted to obtain C30 carotenoids; The culturing in step (1) is culturing in YPD medium at 28-32° C. for 24-72 hours; The extraction described in step (2) is performed using n-dodecane with added zirconium oxide grinding beads.

Images