Rice OsSPL10 Mutant Gene and Its Application in Improving the Glufosinate Resistance of Rice

Through EMS chemical mutagenesis and KASP primer detection methods, the rice OsSPL10 mutant gene was obtained, which solved the problem of low breeding efficiency of rice strawfosinate ammonium resistance, achieved high tolerance and efficient breeding, and promoted the sustainable development of agricultural production.

CN119242654BActive Publication Date: 2025-07-11JIANGSU LIXIAHE REGION AGRI RES INST

Patent Information

Application Number
CN202411655217.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-19
Publication Date
2025-07-11
Estimated Expiration
2044-11-19

AI Technical Summary

Technical Problem

The prior art has problems with long breeding cycles and low efficiency in improving the tolerance of rice to glufosinate herbicides, and traditional breeding methods are difficult to promote globally, and genetically modified technology is restricted by regulations and has low public acceptance.

Method used

The OsSPL10 mutant gene of rice was obtained through EMS chemical mutagenesis, and the gene was used for breeding to improve the resistance of rice to glufosinate, and gene detection and screening were performed through KASP primers to ensure the stability of the mutant traits.

Benefits of technology

It has achieved high tolerance of rice to glufosinate, reduced the use of chemical herbicides, improved crop yield and quality, and has wide application prospects and environmental friendliness.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119242654B_ABST
    Figure CN119242654B_ABST
Patent Text Reader

Abstract

The present invention relates to a mutant gene of rice OsSPL10 gene and its application. The nucleotide sequence of the mutant gene is shown in SEQ IN NO.1. This mutant gene can endow rice with resistance to glufosinate herbicide. The present invention uses the EMS chemical mutagenesis technology to treat the rice variety "Yangxian 9B", successfully induces the mutation of the OsSPL10 gene, and this mutation causes the 225th amino acid in the amino acid sequence of the encoded protein to change from cysteine to tyrosine. At the same time, the present application develops a KASP molecular marker for this mutation site. Through molecular marker detection, field glufosinate resistance screening and verification, it is proved that rice with this mutant gene can improve glufosinate resistance. This gene has significant application potential in agricultural production, can reduce the use of herbicides and improve crop yield and quality.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the fields of plant proteins and plant herbicide resistance. Specifically, the present invention relates to an OsSPL10 mutant protein, which can endow plants, especially rice, with the characteristic of herbicide resistance. The present invention discloses the gene sequence and the sequence of the mutant protein, as well as their applications in the field of plant, especially rice, herbicide resistance. Background Art

[0002] Glufosinate, as an efficient non-selective herbicide, belongs to the class of glutamine synthetase inhibitors (GSIs) and is widely used in agricultural production. It inhibits glutamine synthetase in plants, blocks amino acid synthesis, and effectively controls weed growth. Although glufosinate has the advantages of broad spectrum, low toxicity, and good environmental compatibility, its selectivity for crops is not strong. Especially for sensitive crops such as rice, improper use may lead to growth retardation or even death, affecting yield and quality.

[0003] Rice, as an important food crop globally, its sensitivity to glufosinate limits its use in rice cultivation. Long-term reliance on chemical herbicides may also lead to the emergence of weed resistance, increasing the difficulty of agricultural production. Therefore, improving the tolerance of rice to glufosinate is of great significance for ensuring food security and improving agricultural production efficiency. However, traditional breeding methods face many challenges in improving the glufosinate tolerance of rice, such as long breeding cycles, low efficiency, and complex inheritance of traits. In addition, although transgenic technology has successfully cultivated glufosinate-resistant crops in some countries, its global promotion and application are restricted by regulations and public acceptance.

[0004] In view of this, the present invention aims to explore and develop new rice germplasms, especially glufosinate-resistant rice germplasms obtained through chemical mutagenesis technology. This method is not only simple and efficient in operation, but also can obtain glufosinate-resistant traits without introducing foreign genes, making it more acceptable to the public and promising for global promotion and application. Summary of the Invention

[0005] To solve the above problems, the present invention provides a rice OsSPL10 mutant gene obtained by chemical mutagenesis with EMS (ethyl methyl sulfonate), which has glufosinate resistance and can thus be applied to create new germplasm resources with glufosinate resistance.

[0006] Specifically, the present application is implemented through the following technical solutions:

[0007] First, the present application provides a mutant gene of rice OsSPL10, the nucleotide sequence of which is shown in SEQ IN NO.1, and the amino acid sequence of the encoded protein is shown in SEQ IN NO.2.

[0008] Secondly, the present application provides the use of the above-mentioned mutant gene of rice OsSPL10 in rice breeding, that is, using rice containing the mutant gene of OsSPL10 as the male parent and wild-type rice as the female parent for hybridization to improve the glufosinate resistance of the offspring rice.

[0009] Thirdly, the above-mentioned "rice containing the mutant gene of OsSPL10" means that PCR amplification is carried out using the upstream primer OsSPL10-F1, the upstream primer OsSPL10-F2, and the universal primer OsSPL10-R as primers, and the fluorescence signal of the amplification product is read. The rice sample that emits a blue fluorescence signal is the rice containing the mutant gene of OsSPL10; the nucleotide sequences of the above-mentioned upstream primer OsSPL10-F1, upstream primer OsSPL10-F2, and universal primer OsSPL10-R are shown in SEQ IN NO.5 - SEQ IN NO.7 in sequence.

[0010] The above-mentioned "improving the glufosinate resistance of the offspring rice" means that the offspring rice can still grow normally when sprayed with a glufosinate solution with a concentration of 0.40 g / L.

[0011] Fourthly, the present application provides KASP primers for detecting the above-mentioned mutant gene of rice OsSPL10, which are composed of an upstream primer OsSPL10-F1 with a nucleotide sequence shown in SEQ IN NO.5, an upstream primer OsSPL10-F2 with a nucleotide sequence shown in SEQ IN NO.6, and a universal primer OsSPL10-R with a nucleotide sequence shown in SEQ IN NO.7.

[0012] The above-mentioned detection means that the PCR reaction system: 5 μl of 2×PARMS master mix, 0.15 μl of upstream primer OsSPL10-F1, 0.15 μl of upstream primer OsSPL10-F2, 0.4 μl of universal primer OsSPL10-R, 10 - 100 ng of DNA template, and ddH2O is added up to 10 μl.

[0013] PCR reaction procedure: Pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing at 65 - 57°C (-0.8°C / Cycle) for 1 min, 10 cycles; annealing at 94°C for 20 s, extension at 57°C for 1 min, 32 cycles, and the PCR amplification product is stored at 4°C.

[0014] Then, the fluorescence signal of the PCR amplification product is read. Among them, the rice samples that emit blue fluorescence signals contain the mutant OsSPL10 gene, and its corresponding genotype is A.

[0015] Fifth, the present application provides a method for detecting the glufosinate resistance of rice, that is, PCR amplification is carried out using the upstream primer OsSPL10-F1, the upstream primer OsSPL10-F2, and the universal primer OsSPL10-R as primers, and the fluorescence signal of the amplification product is read. The rice samples that emit blue fluorescence signals have glufosinate resistance; the nucleotide sequences of the upstream primer OsSPL10-F1, the upstream primer OsSPL10-F2, and the universal primer OsSPL10-R are shown in SEQ IN NO.5 - SEQ IN NO.7 in sequence.

[0016] In the present application, "glufosinate resistance" refers to rice that can still grow normally when sprayed with a glufosinate solution at a concentration of 0.40 g / L.

[0017] In the present application, through EMS chemical mutagenesis of the indica rice variety Yangxian 9B, it was found that the 674th nucleotide of the CDS sequence of the OsSPL10 gene in rice mutated from guanine G to adenine A, resulting in the 225th amino acid of the protein sequence changing from cysteine (Cys / C) to tyrosine (Tyr / Y), which can endow rice with the function of resisting glufosinate herbicide. In the examples of the present application, through EMS chemical mutagenesis treatment of the rice variety "Yangxian 9B" and combined with glufosinate tolerance screening, a glufosinate-resistant rice germplasm with a mutated OsSPL10 gene was successfully obtained. This germplasm showed high tolerance to glufosinate under field conditions, providing a new method for preparing germplasm resources for agricultural production.

[0018] Rice varieties with the mutant OsSPL10 gene are expected to reduce the use of chemical herbicides while increasing the yield and quality of crops, which is of great significance for environmental protection and the sustainable development of agriculture. In addition, the method of the present invention can also be extended to the screening of herbicide-resistant mutants of other crops and has broad application prospects. Description of the Drawings

[0019] Figure 1 It is a schematic diagram of the screening process of M3 generation glufosinate-resistant rice germplasm.

[0020] Figure 2 Analysis results of the sequence differences of the OsSPL10 gene in mutants.

[0021] Figure 3 It is a schematic diagram of the G / A site of the mutant OsSPL10 gene.

[0022] Figure 4 KASP marker genotyping results.

[0023] Figure 5 It is a resistance identification photo of the new germplasm Yuan 88S-OsSPL10T germplasm. Specific implementation manners

[0024] The rice germplasms involved in the following examples are all preserved and provided by the Institute of Agricultural Sciences of the Lower Yangtze River Region in Jiangsu.

[0025] Example 1 Mining of the glufosinate-resistant mutant material of rice Yangxian 9B

[0026] (1) Seed selection and pretreatment: Select the disease-resistant, high-temperature-resistant and high-quality maintainer line "Yangxian 9B" (cultivated by the Institute of Agricultural Sciences of the Lower Yangtze River Region in Jiangsu, as disclosed in Patent CN 116716430 A) as the mutagenesis object. Soak the seeds in clean water overnight one day before the experiment to ensure that the seeds fully absorb water and activate their growth potential.

[0027] (2) Chemical mutagenesis treatment: The next day, wash and select the healthy seeds, and then soak them in a 1.2% ethyl methanesulfonate (EMS) solution for 10 h. During this process, shake the seeds several times to ensure that they are fully contacted with the mutagen, so as to improve the mutagenesis efficiency.

[0028] (3) Neutralization and washing: Take out the treated seeds (M1 generation), and rinse them with running water overnight to remove the residual mutagen. During this process, use 5% sodium thiosulfate as the terminator and antidote to neutralize the EMS residue, prevent environmental pollution and further damage to the seeds.

[0029] (3) Cultivation of M2 generation seeds: Soak and germinate the treated M1 generation seeds, and then thinly sow them to cultivate strong seedlings. Adopt the single-plant planting method and carry out conventional fertilizer and water management to ensure that they can grow healthily and produce seeds at maturity. After the M1 generation plants mature, self-cross them to obtain M2 generation seeds.

[0030] (4) Screening of M2 generation seeds and re-screening of M3 generation: The next year, sow the M2 generation seeds in the field, and when the seedlings grow to the 3-4 leaf stage, spray a glufosinate solution with a concentration of 0.4 g / L. After 10 days, observe the reaction of the plants, and screen out the plants that still maintain normal green and have good growth conditions, which are the glufosinate-resistant mutant plants. Harvest the seeds of the glufosinate-resistant plants individually to reduce the possibility of gene recombination, and continue to re-screen them in the M3 generation to ensure the stability of the mutant traits. Finally, 5 stable glufosinate-resistant rice germplasms are obtained, which are named as: CAL1-1, CAL1-2, CAL1-3, CAL1-4, CAL1-5. Figure 1Schematic diagram of the screening process for M3 generation seeds. Among them, A is the schematic diagram of rice seedling growth before spraying the glufosinate solution, and B is the schematic diagram of rice seedling growth after spraying the glufosinate solution. It can be seen that the CAL1-1 mutant plants have better glufosinate resistance, and other M3 generation plants wither under the influence of the glufosinate solution.

[0031] Example 2: Exploration of mutant gene loci resistant to glufosinate and marker development

[0032] (1) Exploration of mutant loci

[0033] ① Sequencing. Whole-genome sequencing (sequencing depth 30×) was performed on 3 of the 5 mutants obtained in Example 1 using high-throughput sequencing technology;

[0034] ② Genome sequence alignment. The genomic sequences obtained by sequencing were aligned and analyzed with the third-generation genomic data of "Yangxian 9B" using bioinformatics tools to identify mutant loci in the genome;

[0035] ③ Alignment results. Compared with the wild-type Yangxian 9B, the mutant plants CAL1-1, CAL1-2, and CAL1-3 had a mutation of guanine G to adenine A at the 674th nucleotide of the CDS sequence of the OsSPL10 gene ( Figure 2 ), and the mutated nucleotide sequence is shown in SEQIN NO.1 (the last three nucleotides at its end are stop codons and do not translate proteins); this mutation caused the 225th amino acid of the protein encoded by the OsSPL10 gene to change from cysteine to tyrosine, and the amino acid sequence of the mutant protein is shown in SEQ IN NO.2. This mutant locus is as Figure 3 shown, where (1) is the wild-type genomic position, (2) is the position of the mutant variant site, and the red box in the figure is the G / A mutant site. The sequence at the wild-type genomic position is shown in SEQ IN NO.3, and the sequence at the position of the mutant gene variant site is shown in SEQ IN NO.4.

[0036] (2) Molecular marker development

[0037] 2.1) KASP primer design. Use the online primer design website Primer3 (https: / / primer3.ut.ee / ) to design KASP markers for wild-type and mutants based on the variant site G / A. The upstream primer of Yangxian 9B, OsSPL10-F1: GAAGGTGACCAAGTTCATGCTGAGCAGTAGCTTACCTGCTGC (SEQ IN NO.5, where GAAGGTGACCAAGTTCATGCT is the FAM linker sequence), the upstream primer of the mutant, OsSPL10-F2: GAAGGTCGGAGTCAACGGATTGGAGCAGTAGCTTACCTGCTGT (SEQ IN NO.6, where GAAGGTCGGAGTCAACGGATT is the HEX linker sequence), and the common downstream primer OsSPL10-R: AGTACCACGCCAAGGCCT (SEQ IN NO.7).

[0038] 2.2) Amplification and genotyping. Use the DNA of rice plant leaves as the target DNA, and use SEQ IN NO.5, SEQ IN NO.6, and SEQ IN NO.7 as primers for PCR amplification. The amplified product is used to read the fluorescence signal with a TECAN infinite M1000 microplate reader, and then use the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) to analyze and convert the fluorescence signal to obtain a clear and intuitive genotyping map. According to different colors, the genotype results are output. The wild-type nucleotide - "G" is assigned FAM, and the mutant nucleotide - "A" is assigned HEX. The detection results are as Figure 4 shown. The green dots are the materials carrying "G", the blue dots are the materials carrying "A", and the red dots are the materials carrying the heterozygous type. It shows that this KASP marker successfully genotypes the mutant gene of OsSPL10.

[0039] PCR reaction system: 5 μl of 2×PARMS master mix, 0.15 μl of primer SEQ ID NO:5, 0.15 μl of primer SEQ ID NO:6, 0.4 μl of primer SEQ ID NO:7, 10 ng of DNA template, and ddH2O is added to make up to 10 μl.

[0040] PCR reaction procedure: Pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing at 65 - 57°C (-0.8°C / Cycle) for 1 min, 10 cycles; annealing at 94°C for 20 s, extension at 57°C for 1 min, 32 cycles, and the PCR product is stored at 4°C.

[0041] Example 3 Creation of Glufosinate-Resistant Germplasm Using Mutants and Molecular Markers

[0042] (1) Breeding of glufosinate-resistant germplasm.

[0043] ① Select Yuan 88S (variety right number: CNA20201003006) as the female parent, and cross it with the homozygous mutant CAL1-1 obtained in Example 2 to obtain F1;

[0044] ② Use Yuan 88S as the female parent and backcross it with the F1 plants to obtain BC1F1;

[0045] ③ Plant 40 plants each of BC1F1, and use the molecular marker primers provided in Example 2 (SEQ IN NO.5 - SEQ INNO.7) for detection. Screen the single plants carrying the mutant base "A" and having excellent agronomic traits and backcross them with Wushan Simiao to obtain BC2F1;

[0046] ④ Plant 60 plants each of BC2F1, conduct molecular marker detection (same as Example 2), screen the single plants carrying the homozygous mutant base "A" and having excellent agronomic traits and harvest the seeds to obtain BC2F2;

[0047] ⑤ Conduct molecular marker detection (same as Example 2), and select 2 BC2F3 single plants carrying the homozygous mutant base "A" and having excellent agronomic traits from the self-crossed offspring of BC2F2. One of them was self-named Yuan 88S-OsSPL10 by the applicant T .

[0048] (2) Glufosinate resistance identification of the created germplasm

[0049] Plant Yuan 88S and Yuan 88S-OsSPL10 in the field T , and spray glufosinate on them (concentration: 0.40 g / L, use a sprayer during spraying to ensure uniform coverage of the plant leaves). At the same time, set Yuan 88S without spraying glufosinate as the control. Keep the same light, temperature and moisture conditions for each group; Observe the results on the 10th day as Figure 5 shown, where A is Yuan 88S sprayed with glufosinate, B is Yuan 88S-OsSPL10 sprayed with glufosinate T , and C is the control group of Yuan 88S without spraying glufosinate. It can be seen that Yuan 88S sprayed with glufosinate has completely died, while Yuan 88S-OsSPL10 T shows significant resistance to glufosinate and has no death like Yuan 88S without spraying glufosinate.

[0050] In this example, glufosinate-resistant germplasm was obtained through backcrossing and molecular marker-assisted selection, which can be used in agricultural production to reduce the use of herbicides and improve crop yield and quality.

Claims

1. A mutant gene of rice OsSPL10, the nucleotide sequence of the gene is shown in SEQ IN NO.

1.

2. The application of the mutant gene according to claim 1 in rice breeding.

3. The application according to claim 2, characterized in that, The application means that the rice containing the OsSPL10 mutant gene is used as the male parent, and the wild-type rice is used as the female parent for hybridization to improve the glufosinate resistance of the offspring rice.

4. A set of primers for detecting the mutant gene recited in claim 1, characterized in that, The primer consists of primers with nucleotide sequences shown in SEQ IN NO.5 - SEQ IN NO.

7.

5. A method for detecting the glufosinate resistance of rice, characterized in that, The specific steps are as follows: Using the leaf DNA of rice plants as the target DNA, designing KASP marker primers for wild-type and mutants based on the mutation site G / A, performing PCR amplification, reading the fluorescence signal of the amplification product, and the rice samples carrying the mutant nucleotide type have glufosinate resistance; the mutant nucleotide type refers to the 674th nucleotide of the CDS sequence of the OsSPL10 gene being mutated from G to A; The primers are successively shown in SEQ IN NO.5 - SEQ IN NO.7.

Citation Information

Patent Citations

  • Transcription factor gene Osspl10 of Oryza sativa and application of transcription factor gene Osspl10

    CN110527687A

  • Novel rice glufosinate-ammonium-resistant herbicide genetic locus and application thereof

    CN116042637A

Cited By

  • Rice OsGAR2 mutant gene and application of rice OsGAR2 mutant gene in improvement of ammonium phosphate resistance of rice straw

    CN121022876A