Root silica deposition and stress resistance regulation methods based on gene overexpression and silica supply strategies
By introducing the CslF6 gene into dicotyledonous plants and supplementing them with silicon, the problem of dicotyledonous plants such as Arabidopsis thaliana being unable to effectively accumulate silicon was solved, and their resistance to heavy metal, salt stress and high temperature stress was improved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-16
- Publication Date
- 2026-03-10
AI Technical Summary
Many dicotyledonous plants, such as Arabidopsis thaliana, are unable to effectively accumulate silicon, resulting in the inability to form a silicon-based defense barrier and thus failing to improve their resistance to abiotic and biotic stresses.
By employing a gene overexpression and silicon supply strategy, the CslF6 gene was introduced into plants through Agrobacterium infection, causing it to be overexpressed. During the growth process, silicon was supplemented into the root environment to increase the amount of silicon deposited in the roots.
It significantly improved the plant's resistance to heavy metals, salt stress and high temperature stress, reduced the accumulation of heavy metals and chromium in the aboveground parts, and alleviated the symptoms of abnormal root elongation.
Smart Images
Figure CN119242691B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of crop stress resistance, and more particularly, the present application relates to a root silicon deposition and stress resistance regulation method based on gene overexpression and silicon supply strategy. BACKGROUND
[0002] Both China and the global food security are threatened by environmental changes. Increasingly serious industrial pollution and rapid urbanization have been increasing the release of pollutants, including heavy metals such as cadmium and chromium, into the environment, thereby affecting crop growth and human health through the food chain. In addition, human activities have accelerated the release of carbon dioxide and other greenhouse gases, leading to global warming and frequent extreme weather events; the threat of high temperature and drought stress to food security is becoming more and more serious. Therefore, it is urgent to improve the resistance of crops to these different forms of abiotic stress. Silicon, as an important beneficial element for plants, has been shown to be very effective in improving the resilience of crops to a range of abiotic and biotic stresses.
[0003] Although silicon is the second most abundant element in the earth's crust and soil, it only exists in plants in the form of unaggregated silicic acid. This form of silicon can be absorbed by the roots and transported to the aboveground plant parts through transpiration and active transport. More than 90% of Si can be deposited as amorphous silicon dioxide in the apoplast, especially in the cell wall, forming a defense barrier against various stresses. For example, silicon can enhance the mechanical properties of the cell wall to resist lodging, improve the stability of the cell membrane to withstand high temperatures, reduce the entry of heavy metal ions into cells, and inhibit the colonization of pathogens and the feeding of herbivores. Major cereal crops, including rice, wheat and maize, are able to accumulate large amounts of silicon, which helps to improve crop yield and stress resistance, so silicon fertilizer is widely used for these crops. However, there is a very large difference in silicon concentration between different species and plant families, ranging from less than 0.1% to more than 10%. According to the silicon content and the absorption of silicon by plants, they can be divided into silicon-accumulating (stem silicon content 1.5%-10%), passive (0.5-1.5%) and non-accumulating (<0.2%) species. In contrast to monocotyledonous plant species (such as rice), many dicotyledonous plant species (such as Arabidopsis) are non-accumulators of silicon, so they are unable to form an effective silicon-based defense barrier, which limits the positive effect of silicon on their stress resistance. SUMMARY
[0004] The purpose of the present application is to adopt the strategy of "gene overexpression + silicon supply" to increase the deposition of silicon in the roots of low-silicon plants by producing components from high-silicon plants that induce silicon polymerization in the body of low-silicon plants, and to improve stress resistance.
[0005] To achieve the above-mentioned purpose, the specific technical solutions adopted by the present application are as follows:
[0006] In a first aspect, the present application provides a method for regulating root silicon deposition and stress resistance based on gene overexpression and silicon supply strategy, which comprises the following steps: introducing CslF6 gene into target plants by Agrobacterium infection method to obtain a strain capable of overexpressing CslF6 gene; and supplementing silicon element to the environment where the roots of the strain are located during the growth of the strain, so that the roots of the strain obtain silicon element from the environment and improve the stress resistance of the plant.
[0007] As a preferred embodiment of the first aspect, the method for introducing CslF6 gene into target plants by Agrobacterium infection method comprises the following steps: constructing a 35S promoter-driven CslF6 overexpression vector plasmid by PCR cloning, introducing the CslF6 overexpression vector plasmid into Agrobacterium competent cells and infecting callus of target plants, and finally promoting gene integration by co-cultivation, and screening positive callus for differentiation and rooting to obtain the strain capable of overexpressing CslF6 gene.
[0008] As a preferred embodiment of the first aspect, the target plant is rice.
[0009] As a preferred embodiment of the first aspect, the callus of the target plant is rice grain after peeling of rice seeds.
[0010] As a preferred embodiment of the first aspect, the target plant is Arabidopsis thaliana.
[0011] As a preferred embodiment of the first aspect, the callus of the target plant is Arabidopsis thaliana inflorescence.
[0012] In a second aspect, the present application provides a method for regulating root silicon deposition and stress resistance based on gene overexpression and silicon supply strategy, which comprises the following steps: introducing CslF6 gene into Arabidopsis thaliana by Agrobacterium infection method to obtain Arabidopsis thaliana seeds capable of overexpressing CslF6 gene, and planting Arabidopsis thaliana seedlings cultivated from the Arabidopsis thaliana seeds in a substrate under heavy metal stress, and additionally supplementing silicon element to the root environment of Arabidopsis thaliana during the growth of Arabidopsis thaliana, so as to improve the growth condition of Arabidopsis thaliana under heavy metal stress and reduce the accumulation of heavy metals in the aboveground part.
[0013] In a third aspect, the present application provides a method for regulating root silicon deposition and stress resistance based on gene overexpression and silicon supply strategy, which comprises the following steps: introducing CslF6 gene into Arabidopsis thaliana by Agrobacterium infection method to obtain Arabidopsis thaliana seeds capable of overexpressing CslF6 gene, and planting Arabidopsis thaliana seedlings cultivated from the Arabidopsis thaliana seeds in a substrate under high temperature stress, and additionally obtaining silicon element from the root environment of Arabidopsis thaliana during the growth of Arabidopsis thaliana, so as to improve the tolerance of Arabidopsis thaliana to high temperature stress and alleviate the symptoms of abnormal root elongation.
[0014] As a preferred embodiment of the second aspect and the third aspect, the substrate is culture medium or soil.
[0015] As the preferred of the above-mentioned first aspect, second aspect and third aspect, during the growth of the overexpression strain, silicon element is additionally supplemented to the root system environment of the overexpression strain in the form of applying silicic acid.
[0016] Compared with the prior art, the present application has the following beneficial effects:
[0017] Traditional soil silicon application has obvious effect on silicon-accumulating plants, but many silicon-non-accumulating plants have low silicon utilization efficiency and cannot form effective silicon-based defense barriers. The strategy of gene overexpression + silicon proposed in the present application can expand the application range of silicon fertilizer. Secondly, although the currently discovered plant silicon transport proteins can affect the silicon in the aboveground part, they do not affect the silicon in the root part, and it has been proved in many studies that the silicon deposition in the root part is crucial for the plant resistance to heavy metal and salt stress. The present application reports the CslF6 gene affecting the silicon deposition in the root system, which can affect the silicon content in the root part of the silicon-non-accumulating plant, thereby improving the stress resistance. In addition, the overexpression of CslF6 alone and the supply of silicon alone cannot improve the stress resistance of the silicon-non-accumulating plant, but the strategy of gene overexpression + silicon can significantly improve the growth of the plant under stress regulation. BRIEF DESCRIPTION OF DRAWINGS
[0018] Figure 1 Figure of the speed of silicic acid polymerization induced by different cell wall components;
[0019] Figure 2 Figure of the silicon concentration and hardness of the rice root after the strategy of gene overexpression + silicon is adopted;
[0020] Figure 3 Figure of the resistance of Arabidopsis to hexavalent chromium stress after the strategy of gene overexpression + silicon is adopted;
[0021] Figure 4 Figure of the resistance of Arabidopsis to cadmium stress after the strategy of gene overexpression + silicon is adopted;
[0022] Figure 5 Figure of the resistance of Arabidopsis to high temperature stress after the strategy of gene overexpression + silicon is adopted. DETAILED DESCRIPTION
[0023] The present application will be further described and explained with reference to the accompanying drawings and specific embodiments. The technical features of each embodiment in the present application can be combined accordingly without conflict.
[0024] The present application provides a method of combining gene editing and silicon fertilizer application to regulate the silicon deposition in the root system of plants and the stress resistance. The present application first discovers that CslF6 is a key gene for regulating the silicon deposition in the root part of plants, and after overexpressing the gene and additionally supplying silicon, the stress resistance of the plant can be significantly improved.
[0025] In the present application, the specific implementation of the root silicon deposition and stress resistance regulation method based on gene overexpression and silicon supply strategy is as follows: the CslF6 gene is introduced into the target plant by means of Agrobacterium infection, and a strain capable of overexpressing the CslF6 gene is obtained. During the growth of the strain, silicon elements are additionally supplemented to the environment where the roots are located, so that the roots obtain silicon elements from the environment, and the stress resistance of the plant is improved.
[0026] It should be noted that the method of introducing the CslF6 gene into the target plant by means of Agrobacterium infection is as follows: first, a 35S promoter-driven CslF6 overexpression vector plasmid is constructed by PCR cloning, then the CslF6 overexpression vector plasmid is introduced into the competent cells of Agrobacterium and infects the callus of the target plant, finally, gene integration is promoted by co-cultivation, and positive callus is selected for differentiation and rooting to obtain a strain capable of overexpressing the CslF6 gene.
[0027] It should be noted that the above-mentioned target plant can be a monocotyledonous plant (such as rice) or a dicotyledonous plant (such as Arabidopsis thaliana). If the target plant is rice, the callus of the target plant can be the grain after the rice seed is peeled. If the target plant is Arabidopsis thaliana, the callus of the target plant can be the inflorescence of Arabidopsis thaliana.
[0028] It should be noted that the CslF6 gene is a known regulation gene existing in rice, and its sequence is shown in SEQ ID No. 1.
[0029] Many silicon non-accumulating plants have low silicon utilization efficiency and cannot form effective silicon-based defense barriers. The present application is suitable for silicon non-accumulating plants (such as Arabidopsis thaliana). The dicotyledonous plant alone overexpresses CslF6 or supplies silicon, and the effect is not good, but when both are used at the same time, the stress resistance can be significantly improved. Because the CslF6 gene from the typical high-silicon plant rice is introduced into the silicon non-accumulating plant, when the plant grows in a stress environment, the content of glucan on the root cell wall can be increased due to the overexpression of the CslF6 gene, and therefore, silicon is supplemented to the environment near the roots, and silicon can be quickly deposited in the plant roots, thereby forming a defense barrier by increasing the silicon content in the roots of the silicon non-accumulating plant, and the stress resistance of the silicon non-accumulating plant in the stress environment can be improved.
[0030] In the embodiments of the present application, taking Arabidopsis thaliana as an example, the stress resistance of Arabidopsis thaliana in a heavy metal stress environment (such as hexavalent chromium and cadmium stress) or a high temperature stress environment can be improved by the method.
[0031] In the heavy metal stress environment, the root silicon deposition and stress resistance regulation method based on gene overexpression and silicon supply strategy is specifically as follows: the CslF6 gene is introduced into Arabidopsis thaliana by Agrobacterium infection method, Arabidopsis thaliana seeds capable of overexpressing CslF6 gene are obtained, Arabidopsis thaliana seedlings cultivated from the Arabidopsis thaliana seeds are planted in a heavy metal stress substrate, and silicon elements are additionally supplemented to the root system environment of the Arabidopsis thaliana during the growth of the Arabidopsis thaliana, so as to improve the growth condition of the Arabidopsis thaliana under heavy metal stress and reduce the heavy metal accumulation amount of the aboveground part.
[0032] In the high temperature stress, the root silicon deposition and stress resistance regulation method based on gene overexpression and silicon supply strategy is specifically as follows: the CslF6 gene is introduced into Arabidopsis thaliana by Agrobacterium infection method, Arabidopsis thaliana seeds capable of overexpressing CslF6 gene are obtained, Arabidopsis thaliana seedlings cultivated from the Arabidopsis thaliana seeds are planted in a high temperature stress substrate, and silicon elements are additionally supplemented to the root system environment of the Arabidopsis thaliana during the growth of the Arabidopsis thaliana, so as to improve the tolerance of the Arabidopsis thaliana to high temperature stress and alleviate the symptom of abnormal root elongation.
[0033] It should be noted that the above-mentioned substrate can be a culture medium or soil. When silicon is supplemented to the plant overexpressing CslF6, soil application can be directly performed, and leaf spraying is not required. In addition, during the growth of the strain, silicon elements are preferably additionally supplemented to the root system environment of the strain in the form of silicic acid. Because silicon is more easily added to the plant in the form of silicic acid, the concentration of silicic acid is recommended to be 1mM.
[0034] The specific implementation of the present application on different plants and the technical effects are described in detail in the following several embodiments.
[0035] Embodiment 1
[0036] In this embodiment, it is verified by a pre-experiment that the increase of glucan on the cell wall can promote the deposition of silicon, and the specific verification process is as follows:
[0037] Firstly, 0.5g of a series of different cell wall components (including: cellulose, pectin, lignin, xylan 1 (from Saccharum officinarum L.), xylan 2 (from Zea mays L.), xylanase 3 (from Fagus longipetilata Seem.), xyloglucan, glucan, glucomannan) is added to 20mL of 10mM silicic acid, and shaken on a 200rmp shaker, with three repeats for each component. In addition, a pure silicic acid group without adding cell wall components is established as a control group (CK).
[0038] Since un-polymerized silicic acid can react with molybdenum reagent to form silicomolybdate, while polymerized silicic acid cannot. Therefore, based on this principle, five days later, the concentration of un-polymerized silicic acid in the solution was determined using molybdenum blue photometry. The polymerization rate of silicic acid in different groups can be calculated by dividing the difference between the initial concentration (10 mM) and the final concentration of un-polymerized silicic acid by the experimental period (5 days). By comparison, it was found that the silicic acid in the group added with dextran polymerized the fastest Figure 1 ) Theoretically, by overexpressing the CslF6 gene that regulates dextran synthesis, more dextran can be deposited on the cell wall, promoting the deposition of silicon.
[0039] Example 2
[0040] In this embodiment, the strategy of "gene overexpression + silicon supply" is used to improve the silicon concentration and root hardness of rice roots.
[0041] First, the primers of CslF6 gene were designed, and the target gene was amplified by PCR. The sequences of the PCR amplification primers are shown in SEQ ID No. 2 and SEQ ID No. 3, respectively, and are as follows:
[0042] Forward primer CslF6_0(+): aacacgggggactttgcaacatggcgccagcggtggcc
[0043] Reverse primer CslF6_0(-): tgaagacagagctagttacatcatggccaggcgtaggtgaag
[0044] Subsequently, restriction enzyme digestion was performed to prepare the vector containing the 35S promoter and the PCR product. Then, the enzyme digestion products were purified and the target gene CslF6 was ligated with the plasmid vector by DNA ligase. The ligation product was transformed into competent E. coli, and positive clones were screened on medium containing antibiotics. Finally, the correctness of the inserted gene was verified by plaque PCR and sequencing.
[0045] The primer sequences used in plaque PCR are shown in SEQ ID No. 4 and SEQ ID No. 5, respectively, and are as follows:
[0046] Forward primer CslF6(572C)(+): gtcggagaggtagcaggtg
[0047] Reverse primer HS)35seq(-): ttcatttggagagaacacgggggac
[0048] The four primers CslF6(572C), CslF6(1144C), CslF6(1716C), CslF6(2288C) used for sequencing verification of the target gene are shown in SEQ ID No. 6, SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 9, respectively, and are as follows:
[0049] CslF6(572C): gtcggagaggtagcaggtg
[0050] CslF6(1144C): ctggacgaacgcgacggt
[0051] CslF6(1716C): gcgggttgttcctcgaga
[0052] CslF6(2288C): gtggccgtgggatggtgag
[0053] Subsequently, 1 μL of plasmid was added to 50 μL of GV3101 Agrobacterium competent cells, mixed thoroughly, and then taken to an electroporation cup. After electroporation, 1 mL of LB liquid medium was added, mixed thoroughly, and then taken to a 1.5 mL centrifuge tube. The activated Agrobacterium liquid was taken 50 μL and inoculated on LB solid medium, and cultured at 30°C in the dark for 48 h. The rice grains with no mold and normal sprout were selected, disinfected with 75% alcohol for 1 min, washed with sterile water for 1 min each time, disinfected with 15% sodium hypochlorite for 20 min, and washed with sterile water for 3 times for 1 min each time. The disinfected rice grains were inoculated in the induction medium and cultured at 26°C under light for 20 days. The Agrobacterium was picked up in the infection liquid to prepare an Agrobacterium resuspension liquid with OD600=0.2. The callus was picked up in a flask, and the Agrobacterium resuspension liquid was added. After 10-15 min of infection, the liquid was discarded, and the callus was inoculated in the co-culture medium and co-cultured at 20°C for 48-72 h. The callus was inoculated in the screening medium and cultured at 26°C in the dark for 20-30 days. The positive callus was inoculated in the secondary screening medium, and the single colony callus was picked up during the callus picking process. The positive callus was inoculated in the differentiation medium and cultured at 25-27°C under light for 15-20 days. After the 2-5 cm sprouts were differentiated, they were inoculated in the rooting medium and cultured at 30°C under light for 7-10 days. The genomic DNA was extracted from the rice, and the PCR instrument was used for amplification. Finally, the overexpression of CslF6 was confirmed by Western blot. The offspring of the mutants were collected for further experiments.
[0054] Seeds were sterilized with 10% hydrogen peroxide for 10 min and germinated in the dark at 30°C for five days. Wild type (WT) and overexpression (CslF6-OE) rice seedlings were grown in 1 / 4 Murashige and Skoog (MS) medium for 21 days, and then transplanted into 1 / 4 MS medium containing 1.0 mM silicic acid for 14 days. The medium was replaced every 7 days. At harvest, root samples were collected, washed thoroughly with EDTA and deionized water, and dried in an oven. Then, the tissues were digested with a microwave digestion instrument, and the silicon concentration was measured using ICP-OES. There were 5 biological replicates for each rice. In addition, some extra roots were collected for the hardness test.
[0055] Atomic force microscopy (AFM, Bruker Dimension Icon) was used to test the root hardness. Specifically, a portion of the root sample was taken and dispersed into an ethanol solution for ultrasonic treatment, and then a few drops of the dispersed liquid were taken and added dropwise into a mica sheet. AFM images were obtained using a tapping mode at room temperature (25°C) using AFM. The local nanomechanical spring constant (K value) was determined by the slope of the linear part of the curve, which can be used to represent the root hardness. Each group was analyzed three times, and at least three portions were measured each time.
[0056] The results of the silicon concentration and hardness of the rice root after the gene overexpression + silicon supply strategy are shown in Table 1. Figure 2 It was found that the silicon concentration of the rice root was increased by 27% and the hardness was increased by 43% after using the “gene overexpression + silicon supply” strategy.
[0057] Example 3
[0058] In this example, the growth condition of non-silicon accumulating plants (Arabidopsis thaliana) under hexavalent chromium stress and the accumulation of chromium in the aboveground part were improved by the “gene overexpression + silicon supply” strategy.
[0059] First, a 35S promoter-driven CslF6 overexpression vector plasmid was constructed by PCR cloning. 1 μL plasmid was added to 50 μL GV3101 Agrobacterium competent cells, mixed thoroughly, then taken to an electroporation cup, 1 mL LB liquid medium was added after electroporation, mixed thoroughly, then taken to a 1.5 mL centrifuge tube, and cultured at 30°C, 180 rpm on a shaker for 30 min. 50 μL of the activated Agrobacterium liquid was inoculated on LB solid medium, and cultured at 30°C in the dark for 48 h. The Agrobacterium was picked up in a resuspension liquid, and an Agrobacterium resuspension liquid with OD600 = 0.8-1.2 was prepared, silwet-77 was added to a concentration of 0.02%, and the entire inflorescences of Arabidopsis materials were dipped in the liquid for 2-3 s, the film was sealed to maintain humidity > 90%, and the materials were cultured in the dark at 25°C for 24 h. The dipping period was 7 days, and the materials were dipped 3 times. The dipped seedlings were cultured at 23°C, 16 h / 8 h light / dark, and seeds were allowed to mature; the mature fruits were gently rubbed onto clean white paper, wrapped up, and dried at 37°C for 24 h. After drying, the seeds were sieved with a 60-mesh sieve, and the clean seeds were stored at 4°C. The seeds were sterilized with 95% ethanol for 10 min, 75% ethanol for 10 min, and sterile water for 2-3 times, 1 min each time, and evenly spread on the corresponding resistant selection medium, and stored at 4°C for 2-3 days; the plate was taken out and stored at 23-25°C, 16 h / 8 h light / dark for 10-14 days. The surviving seedlings were transplanted into nutrient soil and cultured at 23°C, 16 h / 8 h light / dark. Genomic DNA was extracted from Arabidopsis, and a PCR instrument was used for amplification. Finally, the overexpression of CslF6 was confirmed by Western blot. The offspring of the mutants were collected for further experiments.
[0060] Wild-type and Arabidopsis seeds identified to overexpress CslF6 were used. All Arabidopsis seeds were surface sterilized with 10% (v / v) NaCIO and 1% (v / v) Triton X-100 for 5 min, and then treated with 75% (v / v) ethanol for 1 min. The seeds were washed with deionized water three times, and stored at 4°C for two days before sowing. Then, the sterilized seeds were sown on solid semi-strong MS medium containing 1% (w / v) agar and 0.5% (w / v) sucrose (pH 5.7). All Arabidopsis seedlings were grown vertically at 23°C, with a day-night cycle of 12 / 12 hours. After 7 days, they were transferred to 1 / 2 Hoagland solution, which was replaced every 7 days. After 21 days of transfer to the nutrient solution, wild-type (Col-0) and overexpression Arabidopsis (Col-0 OsCslF6A five-day experiment was performed with a chromium stress concentration of 50 mM (prepared with potassium dichromate, concentration in terms of chromium). Both types of Arabidopsis were set up with silicon (1.0 mM silicic acid) and without silicon. After five days, the fresh weight of five plants in each group was measured. The aerial parts were washed with deionized water. Then they were dried and digested, and the chromium concentration was determined using ICP-OES.
[0061] The results of the chromium stress resistance of Arabidopsis after the gene overexpression + silicon supply strategy are shown in Figure 3 The results show that the chromium resistance of Arabidopsis overexpressing CslF6 alone and Arabidopsis supplied with silicon alone is not much different from the wild type without silicon. However, after the “gene overexpression + silicon supply” strategy, the chromium resistance of Arabidopsis is greatly enhanced, with a 59% increase in fresh weight and a 28% reduction in chromium concentration in the aerial parts.
[0062] Example 4
[0063] In this example, the “gene overexpression + silicon supply” strategy is used to improve the growth of non-silicon accumulating plants under cadmium stress and reduce the accumulation of cadmium in the aerial parts.
[0064] Wild type and CslF6-overexpressing Arabidopsis seeds were used. All Arabidopsis seeds were surface sterilized with 10% (v / v) NaClO and 1% (v / v) Triton X-100 for 5 minutes, and then treated with 75% (v / v) ethanol for 1 minute. The seeds were washed three times with deionized water and stored at 4°C for two days before sowing. Then, the sterilized seeds were sown on solid semi-strong MS medium containing 1% (w / v) agar and 0.5% (w / v) sucrose (pH 5.7). All Arabidopsis seedlings were grown vertically at 23°C with a 12 / 12 hour day-night cycle. After 7 days, they were transferred to 1 / 2 Hoagland solution, which was replaced every 7 days. After 21 days of transfer to the nutrient solution, wild type (Col-0) and overexpression Arabidopsis (Col-0 OsCslF6 A five-day experiment was performed with a cadmium stress concentration of 10 mM (prepared with cadmium chloride, concentration in terms of cadmium). Both types of Arabidopsis were set up with silicon (1.0 mM silicic acid) and without silicon. After five days, the fresh weight of the aerial parts of five plants in each group was measured. The aerial parts were washed with deionized water. Then they were dried and digested, and the cadmium concentration was determined using ICP-OES.
[0065] The results of the cadmium stress resistance of Arabidopsis after the gene overexpression + silicon supply strategy are shown in Figure 4 The results show that the cadmium resistance of Arabidopsis overexpressing CslF6 alone and Arabidopsis supplied with silicon alone is not much different from the wild type without silicon. However, after the “gene overexpression + silicon supply” strategy, the cadmium resistance of Arabidopsis is greatly enhanced, with a 44% increase in fresh weight and a 17% reduction in chromium concentration in the aerial parts.
[0066] Example 5
[0067] In this example, the growth condition of non-silicon accumulating plants under high temperature stress was improved by the strategy of "gene overexpression + silicon supply".
[0068] Wild type and CslF6-overexpressing Arabidopsis seeds were used. All Arabidopsis seeds were surface sterilized with 10% (v / v) NaClO and 1% (v / v) Triton X-100 for 5 min, and then treated with 75% (v / v) ethanol for 1 min. The seeds were rinsed with deionized water three times and stored at 4°C for two days before sowing. Then, the sterilized seeds were sown on solid half-strength MS medium containing 1% (w / v) agar and 0.5% (w / v) sucrose (pH 5.7). All Arabidopsis seedlings were grown vertically at 23°C with a 12 / 12 h photoperiod. After 7 days, they were transferred to 1 / 2 Hoagland's solution, which was changed every 7 days. After 21 days of transfer to the nutrient solution, the wild type (Col-0) and overexpression Arabidopsis (Col-0 OsCslF6 ) with comparable growth were selected for a five-day experiment, with a stress temperature of 29°C (6°C higher than the optimum temperature of Arabidopsis, which is 23°C). Both Arabidopsis were set with silicon supply (1.0 mM silicic acid) and without silicon supply. In addition, a group of wild type without stress was set as a control. It was found that root elongation was a typical symptom of mild high temperature. Therefore, after five days, the root length of five plants in each group was measured.
[0069] The results of the high temperature stress resistance of Arabidopsis after the strategy of gene overexpression + silicon supply are shown in Figure 5 The results show that the root length of Arabidopsis overexpressing CslF6 alone and supplied with silicon alone is not significantly different from that of the wild type without silicon supply, and both are significantly longer than the control group without stress. After the strategy of "gene overexpression + silicon supply", the symptom of root elongation of Arabidopsis is alleviated.
[0070] Based on the above description, the relevant staff can make various changes and modifications without deviating from the scope of the technical idea of the present application. The technical scope of the present application is not limited to the content of the specification, and the technical scope must be determined according to the scope of the claims. The above examples are only a preferred scheme of the present application, but not intended to limit the present application. Those skilled in the art can make various changes and modifications without departing from the spirit and scope of the present application. Therefore, any technical solution obtained by equivalent replacement or equivalent transformation falls within the protection scope of the present application.
Claims
1. An anti-repressive regulation method based on gene overexpression and silicon supply strategy, characterized in that, The sequence shown as SEQ ID No. 1 is introduced into target plant Arabidopsis thaliana by Agrobacterium infection method to obtain a strain capable of overexpressing the gene CslF6 The sequence shown as SEQ ID No. 1 is introduced into target plant Arabidopsis thaliana by Agrobacterium infection method to obtain a strain capable of overexpressing the gene CslF6 During the growth of the strain, silicon is additionally supplemented to the environment where the roots are located in the form of silicic acid to improve the high temperature stress resistance or heavy metal stress resistance of the plant, and the heavy metal is chromium or cadmium.
2. The anti-repressive method based on gene overexpression and silicon supply strategy according to claim 1, wherein, The CslF6 gene is introduced into the target plant by using the agrobacterium infection method. CslF6 The method for introducing the gene into the target plant is as follows: first, a 35S promoter driven CslF6 overexpression vector plasmid is constructed by PCR cloning; then, the CslF6 overexpression vector plasmid is introduced into the agrobacterium competent cell and infects the callus of the target plant; finally, the gene integration is promoted by co-cultivation, and the positive callus is selected for differentiation and rooting to obtain a strain capable of overexpressing the CslF6 gene. CslF6 The method for introducing the gene into the target plant is as follows: first, a 35S promoter driven CslF6 overexpression vector plasmid is constructed by PCR cloning; then, the CslF6 overexpression vector plasmid is introduced into the agrobacterium competent cell and infects the callus of the target plant; finally, the gene integration is promoted by co-cultivation, and the positive callus is selected for differentiation and rooting to obtain a strain capable of overexpressing the CslF6 gene.
3. The anti-repressive method based on gene overexpression and silicon supply strategy according to claim 1, wherein, The target plant is Arabidopsis thaliana.
4. An anti-repressive regulation method based on gene overexpression and silicon supply strategy, characterized in that, The sequence shown in SEQ ID No. 1 was obtained using the Agrobacterium infection method. CslF6 Genes were introduced into Arabidopsis thaliana to obtain genes capable of overexpression. CslF6 Arabidopsis thaliana seeds containing genes, Arabidopsis thaliana seedlings cultivated from Arabidopsis thaliana seeds are planted in a substrate under heavy metal stress, and during the growth of Arabidopsis thaliana, additional silicon elements are provided to its root environment in the form of silica to improve the growth of Arabidopsis thaliana under heavy metal stress and reduce the accumulation of heavy metals in the aboveground parts, wherein the heavy metals are chromium or cadmium.
5. An anti-repressive regulatory method based on gene overexpression and silicon supply strategy, characterized in that, The sequence as shown in SEQ ID No. 1 is introduced into Arabidopsis thaliana by Agrobacterium infection method CslF6 The gene is introduced into Arabidopsis thaliana to obtain Arabidopsis thaliana seeds capable of overexpressing CslF6 The Arabidopsis thaliana seed is planted in a high-temperature stress substrate, and during the growth of the Arabidopsis thaliana, silicon elements are additionally supplemented to the root environment in the form of applying silicic acid, so as to improve the growth of the Arabidopsis thaliana under high-temperature stress and alleviate the symptom of root length extension.
6. The anti-repressive method based on gene overexpression and silicon supply strategy according to claim 4 or 5, characterized in that, The medium is a culture medium or soil.