A molecular marker and breeding method for color selection of liuyang black-bone hens' eggs

Abstract

The application provides a molecular marker and breeding method for Lueyang black-bone hen eggshell color breeding, and particularly relates to the field of molecular breeding. The application finds that a missense mutation (C21R) in an ABCG2 gene is related to Lueyang black-bone hen brown eggshell color variation, and therefore can be used for molecular assisted breeding of Lueyang black-bone hen brown eggshell color. C21R is a missense mutation occurring at the 21st cysteine of the ABCG2 protein, caused by SNP g.17548092T>C. The breeding method is to detect the C21R site genotype of a to-be-tested individual by PCR amplification and Sanger sequencing. According to the detection result, CC type individuals are selected and reserved for breeding, which can assist in breeding a new black-bone hen strain producing deep brown eggshells; and TT type individuals are selected and reserved for breeding, which can assist in breeding a new black-bone hen strain producing light brown eggshells. The application solves the problem that the existing Lueyang black-bone hen has different egg colors due to gene mutation, and can greatly shorten the breeding time of a new black-bone hen strain producing a specific brown eggshell color and reduce the breeding cost.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular breeding, in particular to a molecular marker and breeding method for shell color selection of Lueyang black-bone chicken. BACKGROUND

[0002] Lueyang black-bone chicken is a local poultry breed in Shaanxi Province. The breed has the advantages of large body size, good egg meat quality, rich nutrition, health care function, and strong adaptability to forest land. Due to the lack of crossbreeding and selection, the average annual egg production of Lueyang black-bone chicken is 150.3±32.8, the average egg weight is 48.2±12.3g, and the feed egg ratio of 26-30 weeks is 2.85±0.41, which is far lower than the current commercial egg chicken breed. In addition to poor egg production performance, Lueyang black-bone chicken also has great variability in egg production performance and egg quality indicators. For example, Lueyang black-bone chicken mainly produces brown shell eggs, but there are many color variations such as brown, light brown, brown, brown green, and gray brown. If ordinary black-bone chicken eggs with mixed colors are sold, the selling price is about 6 yuan / kg, the cost is 4.8 yuan / kg, and the net profit is 1.2 yuan / kg. If the black-bone chicken eggs with uniform egg color, egg weight, and egg shape are artificially selected and sold as brand eggs, the selling price is about 10 yuan / kg, and the net profit increases by more than 4 times. However, this sales mode increases labor costs, and the remaining eggs are still sold as ordinary eggs. Based on the identification of molecular markers significantly associated with brown shell color variation, establishing a molecular assisted breeding program to breed new strains of Lueyang black-bone chicken with uniform egg color is an effective way to solve the above egg production problems.

[0003] In summary, how to identify molecular markers that are significantly associated with eggshell color and can be used for molecular assisted breeding of new strains of Lueyang black-bone chicken with uniform egg color is a difficult problem that needs to be overcome in this application. SUMMARY

[0004] The main purpose of the present application is to provide a molecular marker and breeding method for shell color selection of Lueyang black-bone chicken, and to obtain new strains of Lueyang black-bone chicken with uniform egg color through molecular breeding to solve the problem of reduced sales profit due to egg color variation in Lueyang black-bone chicken.

[0005] In order to achieve the above purpose, the present application provides a molecular marker and breeding method for shell color selection of Lueyang black-bone chicken, so as to obtain new strains of Lueyang black-bone chicken with uniform egg color through molecular breeding.

[0006] In a first aspect, the present application provides a molecular marker C21R for shell color selection of Luyang Brown Shell Egg, wherein the molecular marker C21R is a missense mutation occurring at the 21st cysteine of ABCG2 protein, wherein the missense mutation is caused by SNP g.17548092T>C, the ABCG2 protein is encoded by ABCG2 gene, the SNP is located at Chr6:17548092 in galGal5.0 reference genome, T of the SNP g.17548092T>C is a wild type allele, the T is used for encoding the 21st cysteine (C), C is a mutant allele, and the C is used for encoding the 21st arginine (R).

[0007] Specifically, the C forms a CC genotype, and the T forms a TT genotype, wherein the CC genotype is associated with deep brown shell, and is used for molecular assisted selection of a new Luyang Brown Shell Egg strain producing deep brown shell eggs; and the TT genotype is associated with light brown shell, and is used for molecular assisted selection of a new Luyang Brown Shell Egg strain producing light brown shell eggs.

[0008] In a second aspect, the present application provides a primer pair for detecting the molecular marker C21R in the first aspect, wherein the primer pair is used for specifically amplifying a DNA fragment containing the C21R mutation site.

[0009] In a third aspect, the present application provides a detection method for detecting the C21R genotype of ABCG2 gene of Luyang Brown Shell Egg by using the primer pair in the second aspect, and the detection method comprises the following steps:

[0010] Step S1: using DNA of Luyang Brown Shell Egg as a template, performing PCR amplification by using the primer pair, and taking a DNA fragment containing the C21R mutation site obtained by PCR amplification as a PCR amplification product;

[0011] Step S2: performing agarose gel electrophoresis detection on the PCR amplification product obtained in step S1, and confirming the specificity and concentration of the PCR amplification product;

[0012] Step S3: judging whether the specificity and concentration of the PCR amplification product meet the requirements of Sanger sequencing, if yes, performing step S4, and if no, returning to perform the step S1;

[0013] Step S4: performing Sanger sequencing on the PCR amplification product obtained in step S1, and detecting the genotype of the individual to be detected at the C21R site according to the sequencing result, so as to distinguish CC type, CT type and TT type individuals.

[0014] In a fourth aspect, the present application provides a shell color selection method for brown shell eggs based on the molecular marker C21R in the first aspect, and the selection method comprises the following steps:

[0015] Step T1: detecting the genotype of C21R in the ABCG2 gene of the individual of the Silky Fowl by the primer pair of the second aspect and the detection method of the third aspect;

[0016] Step T2: according to the detection result, selecting and retaining the individual of CC type for breeding to obtain a new strain of the Silky Fowl producing dark brown shell eggs; or selecting and retaining the individual of TT type for breeding to obtain a new strain of the Silky Fowl producing light brown shell eggs.

[0017] Optionally, the breeding method is used to be implemented at the stage of the chick.

[0018] The molecular marker, primer pair, detection method and breeding method for breeding the shell color of the brown shell egg provided by the present application, the breeding method detects the genotype of C21R in the ABCG2 gene of the individual of the Silky Fowl according to the primer pair and the molecular marker C21R through PCR amplification and Sanger sequencing; according to the detection result, selecting and retaining the individual of CC type for breeding to obtain a new strain of the Silky Fowl producing dark brown shell eggs; or selecting and retaining the individual of TT type for breeding to obtain a new strain of the Silky Fowl producing light brown shell eggs, wherein the molecular marker C21R is a missense mutation on the 21st cysteine in the ABCG2 gene, and the primer pair includes the forward primer sequence 5'-GTCACCTCAGAAACCCTCAT-3' and the reverse primer sequence 5'-CCACAGTCTTCCGTCTACAT-3'.

[0019] The present application provides a molecular assisted breeding method for breeding the egg shell color of the Silky Fowl in Lueyang, significantly shortens the breeding process of the new strain of the Silky Fowl in Lueyang with uniform egg color, and reduces the breeding cost. BRIEF DESCRIPTION OF DRAWINGS

[0020] The drawings accompanying the specification of the present application serve to provide a further understanding of the present application, the illustrative embodiments of the present application and the explanations thereof serve to explain the present application, and do not constitute an improper limitation on the present application. In the drawings:

[0021] Figure 1 The Sanger sequencing detection of the genotype of the molecular marker C21R provided by the present application is shown in the schematic diagram;

[0022] Figure 2 The detection method process for detecting the genotype of C21R in the ABCG2 gene of the Silky Fowl in Lueyang using the primer pair provided by the present application is shown in the schematic diagram;

[0023] Figure 3 The breeding method process for breeding the shell color of the brown shell egg based on the molecular marker C21R provided by the present application is shown in the schematic diagram;

[0024] Figure 4 The schematic diagram for comparing the three colorimetric indexes between the genotypes of C21R is shown in the schematic diagram.

[0025] Figure 5 The application provides a schematic diagram of agarose gel electrophoresis detection results of a C21R site PCR amplification product.

[0026] The specific embodiments of the application have been shown by the above-mentioned drawings, and will be described in more detail hereinafter. The drawings and the written description are not intended to limit the scope of the concept of the application in any way, but to illustrate the concept of the application to those skilled in the art by referring to specific embodiments. DETAILED DESCRIPTION

[0027] In order to make the purposes, technical solutions and advantages of the application clearer, the technical solutions in the application will be described clearly and completely below in combination with the drawings in the application. Apparently, the described embodiments are part of the embodiments of the application, rather than all the embodiments. Based on the embodiments in the application, all other embodiments obtained by those skilled in the art without creative work fall within the protection scope of the application.

[0028] In the application, the words such as “exemplary” or “for example” are used to represent examples, illustrations or descriptions. Any embodiment or design scheme described as “exemplary” or “for example” in the application should not be interpreted as more preferred or more advantageous than other embodiments or design schemes. In fact, the words such as “exemplary” or “for example” are used to present the related concepts in a specific way.

[0029] Lueyang black-bone chicken is a unique local poultry breed in Shaanxi Province. This breed has the advantages of large body size, good egg and meat quality, rich nutrition, health care function, strong adaptability to forest land grazing, etc. Due to the fact that foreign blood has never been introduced to improve egg production performance through hybridization advantage, the average annual egg production of Lueyang black-bone chicken is 150.3±32.8, the average egg weight is 48.2±12.3 g, and the feed-to-egg ratio of 26-30 week-old chickens is 2.85±0.41. Its egg production performance is far lower than that of current commercial egg chicken breeds, and there is a large population variation in egg production performance and egg quality indicators. Taking eggshell color as an example, Lueyang black-bone chicken mainly produces brown shell eggs, but there are also a few individuals in the population that produce green shell eggs. In terms of brown tone, there are many color variations such as brown, light brown, brown, brown-green, and gray-brown. If ordinary black-bone chicken eggs with mixed colors are sold, the selling price is about 6 yuan / kg, the cost is 4.8 yuan / kg, and the net profit is 1.2 yuan / kg. Therefore, the brown shell color variation of Lueyang black-bone chicken has a very adverse effect on the sale of black-bone chicken egg products and the creation of egg product brands, and greatly reduces the net profit of the sale of black-bone chicken egg products.

[0030] Traditionally, black-boned chicken eggs with uniform color, weight, and shape are selected manually. If these eggs are sold as branded eggs, the price would be around 10 yuan per kilogram, increasing net profit by more than four times. However, this sales model increases labor costs, and the remaining eggs are still sold as ordinary eggs. Based on the identification of molecular markers significantly associated with brown shell color variations, establishing a molecularly assisted breeding program to cultivate a new strain of Lueyang black-boned chicken with uniform egg color is an effective way to solve the aforementioned egg production problems.

[0031] In summary, how to cultivate a new strain of Lueyang black-bone chicken with uniform egg color through molecular breeding is a problem that this application needs to overcome.

[0032] This application provides a molecular marker, primer pair, detection method, and breeding method for selecting brown-shelled eggs. The breeding method uses primer pairs and the molecular marker C21R to detect the genotype of C21R in the ABCG2 gene of individual Silkie chickens through PCR amplification and Sanger sequencing. Based on the detection results, individuals with the CC genotype are selected for breeding to help obtain a new Silkie chicken strain that lays dark brown eggs; or individuals with the TT genotype are selected for breeding to help obtain a new Silkie chicken strain that lays light brown eggs. The molecular marker C21R is a missense mutation at cysteine ​​position 21 in the ABCG2 gene. The primer pair includes the positive-strand primer sequence 5'-GTCACCTCAGAAACCCTCAT-3' and the reverse-strand primer sequence 5'-CCACAGTCTTCCGTCTACAT-3'. This method solves the problem of inconsistent egg color caused by gene mutations in existing Silkie chickens, thereby obtaining a new Silkie chicken strain with uniform egg color through molecular breeding.

[0033] The technical solution of this application and how the technical solution of this application solves the above-mentioned technical problems are described in detail below with specific embodiments. These specific embodiments can be combined with each other, and the same or similar concepts or processes may not be described again in some embodiments. The embodiments of this application will now be described with reference to the accompanying drawings.

[0034] Figure 1The Sanger sequencing detection of the molecular marker C21R locus genotype result provided in the present application is shown in the schematic diagram, which is used to explain the molecular marker C21R used for the shell color selection of Lueyang black-bone chicken, and the molecular marker C21R is a missense mutation at the 21st cysteine in the ABCG2 gene, wherein the missense mutation is caused by SNP g.17548092T>C, the ABCG2 protein is encoded by the ABCG2 gene, the SNP is located at Chr6:17548092 in the chicken galGal5.0 reference genome, the T of the SNP g.17548092T>C is a wild-type allele, the T is used to encode the 21st cysteine (C), and the C is a mutant allele, which is used to encode the 21st arginine (R). The C21R genotype is detected by Sanger sequencing method, and the representative results are shown in Figure 1 The Sanger sequencing can be entrusted to any sequencing company to complete. The red box marks the position of g.17548092T>C, wherein g.17548092T>C refers to a single nucleotide variation from T to C at the 17548092th position of the genomic sequence.

[0035] Further, the present embodiment provides a primer pair for detecting the above-mentioned molecular marker C21R, which comprises a forward primer sequence 5'-GTCACCTCAGAAACCCTCAT-3' and a reverse primer sequence 5'-CCACAGTCTTCCGTCTACAT-3'. The primer pair is used to specifically amplify the DNA fragment containing the C21R mutation site. Before detecting the C21R genotype, the DNA fragment containing the marker site needs to be amplified by PCR, and the primer pair can be synthesized by commercial channel chemistry.

[0036] Further, the C forms a CC genotype, and the T forms a TT genotype, wherein the CC genotype is associated with dark brown shell, and is used for molecular assisted selection of new Lueyang black-bone chicken strains producing dark brown shell eggs; and the TT genotype is associated with light brown shell, and is used for molecular assisted selection of new Lueyang black-bone chicken strains producing light brown shell eggs.

[0037] It can be understood that the sequence one contains the PCR amplified fragment sequence of the C21R locus, and the underlined part is the binding part of the forward and reverse primers, respectively. The SNP (i.e. single nucleotide polymorphism) g.17548092T>C is marked in red font, which causes the mutation of the 21st cysteine in the ABCG2 gene to arginine (missense mutation marked as C21R). The SNP g.17548092T>C (C21R) is related to the variation of the shell color of black-bone chicken, the CC genotype is associated with dark brown shell, the TT genotype is associated with light brown shell, and can be used for molecular marker assisted selection of different brown shell varieties.

[0038] Sequence one: PCR amplified fragment sequence containing C21R locus.

[0039] GTCACCTCAGAAACCCTCAT GCGGTTGAGTTTGACCTGTGTAACAAGGATGTGATGGCGGACACATTTGATCACAGTGTCATTTCTGTTGGAGAAGAGGAAGGAGCAGACAGTTTCCAACGATCTCTTCCAACACGAGATTCTCTCCGATCCCCTCGAGGCTCCATTGTGAGTTTCCATAACATCCAGTACTCCGTTAAGCAGTCCAGTGGATTCCT ATGTAG ACGGAAGACTGTGG

[0040] Sequence two: primer pair for labeling C21R genotype detection.

[0041] Forward: 5'-GTCACCTCAGAAACCCTCAT-3';

[0042] Reverse: 5'-CCACAGTCTTCCGTCTACAT-3'.

[0043] It can be understood that the primer pair in the embodiment, and other primer pairs related to amplification containing C21R locus, are used for detecting C21R genotype and molecular assisted selection of Luyang brown-shelled eggs, and are within the protection scope of the patent.

[0044] The embodiment proposes a molecular marker C21R for Luyang brown-shelled egg shell color selection, which is a missense mutation on the 21st cysteine in the ABCG2 gene. The missense mutation is caused by SNP g.17548092T>C. The ABCG2 protein is encoded by the ABCG2 gene. The SNP is located at Chr6:17548092 in the chicken galGal5.0 reference genome. The T of the SNP g.17548092T>C is the wild-type allele, which is used to encode the 21st cysteine (C). The C is the mutant allele, which is used to encode the 21st arginine (R). The discovery of the molecular marker C21R reveals that SNP g.17548092T>C (C21R) is related to the brown shell color variation of Luyang chicken. The CC genotype is associated with dark brown shell, and the TT genotype is associated with light brown shell. It can be used for molecular marker assisted selection of different brown shell varieties, thereby providing a new feasible idea for breeding new Luyang chicken lines with uniform egg color.

[0045] Figure 2This application provides a schematic flowchart of the method for detecting the C21R genotype in the ABCG2 gene of Lueyang black-boned chicken using primer pairs; as shown below. Figure 2 As shown, this embodiment provides the use of Figure 1 The example describes a method for detecting the C21R genotype in the ABCG2 gene of Lueyang black-boned chicken using primer pairs. The detection method includes the following steps:

[0046] S201: Using the DNA of Lueyang black-boned chicken as a template, PCR amplification was performed using primer pairs, and the DNA fragment containing the C21R mutation site obtained by PCR amplification was used as the PCR amplification product.

[0047] PCR amplification refers to polymerase chain reaction, a molecular biology technique for rapidly amplifying specific genes or DNA sequences in vitro. Its basic principle is to mimic the natural replication process of DNA in living organisms, achieving exponential amplification of DNA fragments in vitro through steps such as denaturation, annealing, and extension.

[0048] The specific implementation process of PCR amplification using primer pairs can be achieved through the following steps:

[0049] Sample collection: Collect samples, such as cells, tissues or blood, from the desired black-boned chicken, ensuring good sample quality and avoiding contamination.

[0050] DNA extraction: DNA is extracted from the sample using appropriate DNA extraction methods. Common extraction methods include phenol-chloroform extraction and high-salt extraction.

[0051] DNA quantification: The concentration of extracted DNA is measured using a spectrophotometer or fluorescence detector to ensure that the DNA concentration is appropriate.

[0052] Preparing the PCR reaction system: This can be done by mixing various reagents (including DNA template, primers, dNTPs, polymerase, buffer, and water) in appropriate proportions according to the concentrations of the components required for the reaction. Alternatively, it can be done using... Figure 1 The primer pairs used in this example were used to perform PCR to amplify a DNA fragment containing C21R. The PCR system consisted of 20 μL of 10 μL 2×Taq PCRStarMix (Dye) (purchased from GenStar, catalog number: A012), 0.5 μL 10 μM positive-strand primer, 0.5 μL 10 μM reverse-strand primer, 1 μL template DNA (50 ng), and 8 μL ddH2O. The PCR amplification conditions were: 95°C denaturation for 3 min, followed by 33 cycles of (95°C denaturation for 30 sec, 60°C annealing for 30 sec, 72°C extension for 20 sec), and a final extension at 72°C for 5 min. The target fragment was 237 bp in length (see...).Figure 1 Example Sequence 1). Detect the specificity and concentration of PCR amplification products using 2% agarose gel electrophoresis.

[0053] Optimization of PCR amplification conditions: Adjust the PCR reaction conditions such as denaturation temperature, annealing temperature and extension time according to the length of the DNA fragment and primer used.

[0054] PCR cycle: Set the cycle program of the PCR instrument, including the cycles of denaturation, annealing and extension, usually 25-35 cycles.

[0055] PCR product analysis: Detect PCR amplification products using agarose gel electrophoresis or other appropriate methods, observe DNA bands to determine whether amplification is successful.

[0056] PCR product purification and sequencing: Purify the PCR product and sequence it to verify the consistency of the amplified DNA sequence with the target sequence.

[0057] S202: Detect the PCR amplification product obtained in step S201 by agarose gel electrophoresis to confirm the specificity and concentration of the PCR amplification product.

[0058] The agarose gel electrophoresis detection refers to a commonly used molecular biology technique, mainly used for the separation, purification and analysis of nucleic acids (DNA and RNA). Agarose gel electrophoresis is a technique that uses agarose gel as a support medium, and makes charged particles (such as nucleic acid molecules) migrate in the gel under the action of electric field, so as to realize separation. Agarose gel has a network structure, which can produce molecular sieve effect, so that nucleic acid molecules of different sizes and charges have different migration speeds in the electric field, so as to achieve the purpose of separation.

[0059] The specific implementation process of detecting the PCR amplification product obtained in step S201 by agarose gel electrophoresis can be realized by the following steps:

[0060] Reagent configuration: Common electrophoresis buffer has TAE and TBE, select appropriate buffer according to needs and dilute to appropriate concentration. Prepare agarose gel, generally use 1% agarose solution, heat to dissolve and then cool to appropriate temperature, add nucleic acid dye (such as ethidium bromide EB or GoldView) and mix well.

[0061] Gel preparation: Pour the agarose solution into the gel preparation mold, insert the comb, and pull out the comb after the gel cools and solidifies.

[0062] Loading: Mix the nucleic acid sample to be detected with the loading buffer, and carefully add it to the loading well of the gel. At the same time, add DNA Marker or known size control DNA to estimate the size of nucleic acid fragments in the sample.

[0063] Electrophoresis: Place the gel into an electrophoresis tank, add electrophoresis buffer, and make sure the buffer covers the surface of the gel. Turn on the power supply and set the appropriate voltage and current to start the electrophoresis. Adjust the electrophoresis time according to the size of the nucleic acid fragments and the electrophoresis conditions until the bands move to the appropriate position of the gel.

[0064] Observation results: As shown in Figure 5 Figure 5 The schematic diagram of agarose gel electrophoresis detection results of the PCR amplification product containing C21R site provided in the present application is used to observe the electrophoresis results in the gel imaging system, confirm the specificity and concentration of the PCR amplification product according to the electrophoresis detection results, record and analyze the size and integrity of the nucleic acid fragments.

[0065] S203: Determine whether the specificity and concentration of the PCR amplification product meet the requirements of Sanger sequencing. If yes, perform step S204; if no, return to perform step S201.

[0066] The genotype analysis technique is used to detect the genotype of the individual to be tested at the C21R site, and the genotype analysis technique includes but is not limited to the following methods: PCR-RFLP, PCR-SSCP, Sanger sequencing, MassARRAY mass spectrometry, and genome sequencing. The specific implementation process of determining whether the specificity and concentration meet the requirements is as follows: compare the specificity and concentration of the PCR amplification product confirmed in step S202 with the set specificity and concentration according to actual needs. If the specificity and concentration of the PCR amplification product confirmed in step S202 meet the set specificity and concentration according to actual needs, perform Sanger sequencing on the PCR amplification product obtained in step S201, determine the genotype of the C21R site through the sequencing results, and thereby distinguish CC, CT, and TT individuals. If the specificity and concentration of the PCR amplification product confirmed in step S202 do not meet the set specificity and concentration according to actual needs, return to perform step S201 to use the DNA of the black-bone chicken as a template and use the primer pair to perform PCR amplification again.

[0067] S204: Perform Sanger sequencing on the PCR amplification product obtained in step S201, detect the genotype of the individual to be tested at the C21R site according to the sequencing results, and thereby distinguish CC, CT, and TT individuals.

[0068] ​The gene analysis technology is used to detect the genotype of the individual to be tested at the C21R site, and the gene analysis technology includes PCR-RFLP, PCR-SSCP, Sanger sequencing, MassARRAY mass spectrometry, second-generation genome sequencing technology, etc. In this embodiment, Sanger sequencing can be used to detect the genotype of the individual to be tested at the C21R site, and other genotype detection technologies can also be used to detect the genotype of the individual to be tested at the C21R site. The specific method is determined according to the actual needs, and this embodiment does not limit the method. It is worth mentioning that other DNA fragments containing the C21R site obtained by using the above-mentioned other genotype detection technologies are used for breeding Luyang brown-shelled eggshell color, which is within the protection scope of the present application.

[0069] In this step, the Sanger sequencing method used in this embodiment uses DNA polymerase to extend the primer pair until a chain termination nucleotide is incorporated. This process is achieved by adding four deoxynucleotide triphosphates (dNTPs) and a limited amount of a dideoxynucleotide triphosphate (ddNTP) to the reaction system. Since the ddNTP lacks the 3'-OH group required for extension, the elongated oligonucleotide is selectively terminated at G, A, T or C. In this way, each sequence determination consists of a set of four separate reactions, each of which produces a set of chain termination products ending with different bases (A, T, C, G) and differing in length by one base. These products are then separated by high-resolution denaturing gel electrophoresis and sorted according to their lengths, and finally detected by autoradiography or non-isotope labeling after gel treatment of X-ray film, so as to determine the genotype of the C21R site through the sequencing result, thereby distinguishing CC, CT and TT individuals.

[0070] Further, the conditions of the PCR amplification include: denaturation at 95℃ for 3min; through 33 cycles, each cycle includes denaturation of DNA at 95℃ for 30 seconds, then the primer is combined with the DNA template at 60℃ for 30 seconds, and finally the DNA chain is extended at 72℃ for 20 seconds; extension at 72℃ for 5min.

[0071] Further, the electrophoresis detection conditions include: 100V electrophoresis for 40min, and EB staining is used.

[0072] EB staining, also known as Ethidium Bromide (EB) staining, is a commonly used biological experimental technique, mainly used for detection and observation of DNA and RNA.

[0073] It can be understood that any other method related to the detection of the genotype of the C21R site and used for the breeding of Luyang brown-shelled eggshell color and the kit developed around these methods are within the protection scope of the present application.Figure 1 the primer pair in the embodiment and Figure 2 Other DNA fragments containing C21R site obtained by the detection method or other methods in the embodiment are also within the protection scope of the present application, such as for breeding Lueyang black-brown eggshell color.

[0074] The present embodiment proposes a method for detecting C21R genotype of ABCG2 gene in Lueyang chicken by using Figure 1 The detection method for detecting C21R genotype of ABCG2 gene in Lueyang chicken in the embodiment uses DNA of Lueyang chicken as template, uses the primer pair to perform PCR amplification, takes the DNA fragment containing C21R mutation site obtained by PCR amplification as PCR amplification product, performs agarose gel electrophoresis detection on the PCR amplification product, confirms the specificity and concentration of the PCR amplification product, judges whether the specificity and concentration meet the requirements of Sanger sequencing, if yes, performs Sanger sequencing on the PCR amplification product, detects the genotype of the individual to be tested at C21R site according to the sequencing result, thereby distinguishing CC type, CT type and TT type individuals, if not, uses the primer pair to perform PCR amplification again with DNA of Lueyang chicken as template to obtain PCR amplification product meeting the requirements. CC type, CT type and TT type individuals are distinguished by the method, thereby providing basis for subsequent breeding.

[0075] Figure 3 The flowchart of the method for breeding Lueyang black-brown eggshell color based on molecular marker C21R provided in the present application is shown in Figure 3 The method for breeding Lueyang black-brown eggshell color based on molecular marker C21R provided in the present embodiment is shown in Figure 1 The method for breeding Lueyang black-brown eggshell color based on molecular marker C21R provided in the present embodiment comprises:

[0076] S301: using Figure 1 The primer pair and Figure 2 The detection method detects the genotype of C21R in ABCG2 gene of Lueyang chicken individual.

[0077] The specific implementation of the detection method for detecting the genotype of C21R in ABCG2 gene of Lueyang chicken individual is as follows: using DNA of Lueyang chicken as template, using primer pair to perform PCR amplification, taking the DNA fragment containing C21R mutation site obtained by PCR amplification as PCR amplification product, performing agarose gel electrophoresis detection on the PCR amplification product, confirming the specificity and concentration of the PCR amplification product, judging whether the specificity and concentration meet the requirements, if yes, performing Sanger sequencing on the PCR amplification product, determining the genotype of C21R site through the sequencing result, thereby distinguishing CC type, CT type and TT type individuals, if not, using primer pair to perform PCR amplification again with DNA of Lueyang chicken as template.

[0078] S302: Based on the test results, select CC type individuals for breeding to obtain a new strain of black-boned chicken that lays dark brown-shelled eggs; or select TT type individuals for breeding to obtain a new strain of black-boned chicken that lays light brown-shelled eggs.

[0079] The detection result can be obtained by determining the genotype of the C21R locus through step S301, thereby distinguishing between CC, CT, and TT type individuals. By selecting CC, CT, and TT type individuals and using the selected individuals for breeding and cultivation, new strains of black-boned chickens that produce dark brown-shelled eggs or light brown-shelled eggs can be obtained.

[0080] Optionally, the above breeding method is used in the chick stage, and the specific implementation process can be referred to in Example 1 and Example 2 below.

[0081] The present invention will be further described in detail below with reference to specific embodiments. The embodiments given are only for illustrating the present invention and are not intended to limit the scope of the present invention. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods. Unless otherwise specified, the materials, reagents, etc. used in the following embodiments are commercially available.

[0082] Example 1: Correlation between C21R and L-value of black-shelled eggshell color

[0083] Dark brown, light brown, brownish-brown, and brownish-green are all qualitative and descriptive records of eggshell color variation. This method of recording traits is highly subjective and not conducive to comparisons between populations and research on the genetic basis. This invention uses the L value (brightness / darkness) in the L*a*b color space to quantify brown shell variation, which can objectively and quantitatively record the variation in the depth of brown shell color in Silkie chickens, laying the foundation for marker screening and breeding.

[0084] 1. Experimental samples and breeding conditions

[0085] The sample used in this study (n=381) was randomly selected from 61 half-sib families of the fourth generation of the core breeding group of black-boned chickens raised at the Longhao Black-boned Chicken Breeding Center in Lueyang County. All individuals were hatched in the same batch and raised in the same chicken house. The brooding temperature was 33-35℃ during the first week, and then decreased by 2-3℃ each week until weaning in the fourth week. The light duration was 22 hours during the first week, and then decreased by 1-1.5 hours each week. At 60 days, the chickens were transferred to the laying hen house and raised individually in single cages. All stages were fed with commercial complete feed (Haidai), with free access to feed and water.

[0086] 2. Eggshell color determination

[0087] Brown shell color variation was quantified using L*a*b color space. L value ranged from 0 to 100, the darker the object color, the smaller the value, the whiter the value the larger. a value is red-green, no value range limit, the smaller the negative value, the greener the object color, the larger the positive value, the redder the object color. b value is blue-yellow, no value range limit, the smaller the negative value, the bluer the object color, the larger the positive value, the yellower the object color. L*a*b values were measured by MiniScan EZ 4000 portable colorimeter (Hunter Associates Laboratory, Inc.) under the condition of D65 standard light source and 10° incident angle. At 31 weeks of age, 3 eggs were collected from each hen, and the color value of the blunt end was measured. The average of 3 eggs was used as the representative value of the shell color of the sample for subsequent correlation analysis.

[0088] 3. DNA extraction

[0089] Blood was collected from the subalvinal vein, anticoagulated with ACD (1:4), and genomic DNA was extracted using a blood genomic non-column extraction kit (Kangwei Century, Catalog No: CW0544M) according to the kit instructions. The obtained DNA was detected for integrity by 1% agarose gel electrophoresis, the concentration of DNA was measured by NanoDrop 2000 (Thermo) spectrophotometer, and the concentration of DNA was adjusted to 50 ng / μL for standby.

[0090] 4. Genotype detection method

[0091] The DNA fragment containing C21R site was amplified using the above primers, PCR amplification system and conditions. After detecting the specificity and concentration of PCR amplification product by agarose gel electrophoresis, Sanger one-way sequencing was performed using reverse strand primers. The sequencing result file was viewed using ChromasPro software, and the genotype of C21R of each sample was recorded.

[0092] 5. Statistical analysis of data

[0093] The association of C21R genotype effect with each color index was tested by one-way ANOVA, and the significance of difference between genotypes was tested by Duncan's multiple comparison method. The significant level was 0.05. One-way ANOVA and multiple comparison were completed by ANOVA program in SAS University Edition software.

[0094] 6. Results

[0095] As Figure 4 shown, Figure 4This diagram illustrates the comparison of the three colorimetric indices provided in this application among C21R genotypes. The comparison shows that C21R (g.17548092T>C) is significantly associated with both the L value (F=8.89, P=0.0002) and the b value (F=3.31, P=0.0377), but not significantly associated with the a value. Regarding the L value, the TT genotype (78.0±4.4) has the lightest color, the TC genotype (76.6±4.3) is in the middle, and the CC genotype (75.3±4.0) has the darkest color, with significant differences among all genotypes. Regarding the b value, the CC genotype (16.2±3.5) eggshells are more yellow, while the TT genotype (14.7±3.2) eggshells are more bluish.

[0096] Figure 4 Each scatter point represents the measurement value of one sample. The black diamond squares represent the mean value for each genotype, and the thin lines on either side represent the standard deviation within each genotype group. The letters in the scatter plot indicate the results of multiple comparisons between genotype groups. The same letter indicates no significant difference between groups (P>0.05), while different letters indicate significant differences between groups (P<0.05).

[0097] Example 2: Comparison of selection effects between traditional phenotypic selection and marker-assisted selection

[0098] 1. C21R Molecular-Assisted Breeding Program

[0099] Based on genotyping results, two CC-type roosters and 16 CC-type hens were selected from the fourth generation of the core breeding group of egg-laying chickens raised by Lueyang Longjia Company, forming two half-sib families with a male-to-female ratio of 1:8; two TT-type roosters and 16 TT-type hens were selected, forming two half-sib families with a male-to-female ratio of 1:8.

[0100] 2. Traditional phenotypic selection scheme

[0101] Sixteen hens with eggshell color L<75 (dark brown shell) were selected from the fourth generation of the core breeding group for egg production. Two roosters from the same family were selected to form two dark brown shell half-sib families with a male-to-female ratio of 1:8. Sixteen hens with eggshell color L>78 were selected. Two roosters from the same family were selected to form two light brown shell half-sib families with a male-to-female ratio of 1:8.

[0102] 3. First-generation pedigree incubation and eggshell color determination

[0103] Both of the above-mentioned breeding schemes were used to establish families using individual cage rearing, artificial insemination, and pedigree incubation. Chicks were tagged with wing tags at hatching in the first generation, and their pedigrees were recorded. At 30 weeks of age in the first generation, three consecutive eggs laid by each hen were collected, and the L*a*b values ​​of the eggs were measured using a MiniScan EZ 4000 portable colorimeter.

[0104] 4. Results of Molecular Marker-Assisted Selection (MAS)

[0105] In Example 1, the present application found that the CC genotype of C21R was associated with dark brown shell, and TT was associated with light brown shell. To verify the effectiveness of brown shell color molecular marker-assisted selection (MAS) based on C21R, we performed a comparative experiment of MAS and traditional phenotype selection. In the MAS scheme, 59 offspring hens of CC type were obtained, and 58 offspring hens of TT type were obtained. The L value of the eggshell color of the CC type was significantly lower than that of the TT type, and the b value was significantly higher than that of the TT type (Table 1). The a value of the CC type was higher than that of the TT type, and the difference tended to be significant (Table 1). These results indicate that the offspring of the hens selected by MAS, the CC type has darker brown shell color, and the TT type has lighter color, providing data support for the effectiveness of MAS.

[0106] Table 1 Comparison of eggshell color chroma indicators of Luyang black-bone chickens between C21R genotypes

[0107]

[0108] Note: The numbers in parentheses in Table 1 are the coefficients of variation of each chroma indicator

[0109] 5. Results of phenotype selection

[0110] To compare the differences in the effects of MAS and traditional phenotype selection, we also performed phenotype selection while performing MAS. By selecting dark brown (L < 75) and light brown (L > 78) hens, the present application obtained 54 offspring hens in the dark brown group and 51 offspring hens in the light brown group. Except for the significant difference in L value, there was no significant difference in a and b values between the dark brown group and the light brown group (Table 2).

[0111] Table 2 Comparison of eggshell color chroma indicators of Luyang black-bone chickens between groups

[0112]

[0113] Note: The numbers in parentheses in Table 2 are the coefficients of variation of each chroma indicator

[0114] 6. Comparison of the effects of MAS and phenotype selection

[0115] As shown in Table 1 and Table 2, MAS had larger differences in the three chroma indicators, while phenotype selection only had a significant difference in L value, and the difference amplitude (ΔL 表型 = 2) was smaller than that of the MAS scheme (ΔL MAS= 5.5). Two breeding programs have obvious differences in the variation range of the indicators, in addition to the differences in the amount of indicators. The present application found that the coefficient of variation of the three color indicators in the MAS program is less than that in the phenotypic selection program. Compared with the phenotypic selection program, ① the MAS program obtains a greater distinction between the dark brown and light brown groups; ② the MAS program obtains better uniformity of eggshell color within the dark brown and light brown groups; ③ the MAS program is not limited by the age of the individual, and can make selection based on genotype discrimination results at the chick stage, significantly shortening the breeding process and saving breeding costs.

Claims

1. A method for breeding Luyang fowl brown-shelled eggs based on molecular marker C21R, characterized in that, The method comprises the following steps: Step T1: detecting the genotype of molecular marker C21R in the ABCG2 gene of Luyang chicken individuals, wherein the molecular marker C21R is a missense mutation on the 21st cysteine of ABCG2 protein, the missense mutation is caused by SNP g.17548092T>C, the ABCG2 protein is encoded by the ABCG2 gene, and the SNP is located at Chr4:17548092 in the Luyang chicken galGal5.0 reference genome; Step T2: according to the detection result, selecting and breeding CC type Luyang chicken individuals to assist in obtaining a new Luyang chicken strain producing dark brown shell eggs; or selecting and breeding TT type Luyang chicken individuals to assist in obtaining a new Luyang chicken strain producing light brown shell eggs.

2. The breeding method according to claim 1, characterized by: The breeding method is used at the Luyang chicken chick stage.

Images