A SNP molecular marker associated with pig feed conversion ratio, its detection primers, and applications.
By performing genotyping and GWAS analysis on Large White pigs, SNP loci on chromosome 8 were screened out and detection primers were designed, which solved the problem of low feed conversion efficiency screening efficiency in breeding and improved breeding efficiency and feed utilization.
Patent Information
- Application Number
- CN202411582213.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-07
- Publication Date
- 2026-01-30
- Estimated Expiration
- 2044-11-07
AI Technical Summary
Existing technologies make it difficult to efficiently screen for SNP loci related to feed conversion ratio in pig breeding, resulting in long breeding cycles, low efficiency, and inaccurate estimation of breeding values, which affects the progress of pig breeding.
By performing genotyping and quality control on the DNA of 5,256 Large White pigs, and combining genome-wide association analysis (GWAS), an SNP locus located at nucleotide 129423208 on chromosome 8 was screened out. Corresponding detection primers were designed to detect strains with the genotype T/T, and to select and breed them to improve feed conversion rate.
This method enables efficient screening of SNP loci associated with pig feed conversion rate, providing a theoretical basis for breeding, reducing pig feed consumption, and improving feed utilization.
Smart Images

Figure CN119242820B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular marker technology, and more specifically to an SNP molecular marker related to pig feed conversion rate, its detection primers, and its uses. Background Technology
[0002] my country is the world's largest producer and consumer of pigs. Pig farming is not only a crucial component of my country's animal husbandry but also a pillar industry of agriculture. In recent years, with advancements in technology and improved management, the overall production capacity of my country's pig farming industry has increased significantly, but a gap still exists compared to developed countries with advanced pig industries. To achieve healthy and rapid development of the industry, further reduce breeding costs, and improve industry efficiency, selecting superior pig breeds is of paramount importance. Breed has always been the core and key factor determining the production capacity of the pig industry. Currently, thanks to rapid technological development, molecular technologies, such as genome-wide association studies (GWAS), are widely used in livestock and poultry breeding. First proposed by Risch et al., GWAS uses genetic variation information and phenotypic information in a population to identify potential variation sites and candidate genes related to target traits, aiming to reveal the genetic mechanisms of important traits. Initially used to assist in the study of complex human diseases, it has now been gradually extended to the identification of single nucleotide polymorphism (SNP) sites of complex economic traits in many animals and plants, including livestock and poultry, and has achieved a series of significant advances.
[0003] Feed conversion ratio (FCR), a crucial economic trait in pigs, reflects the efficiency with which pigs utilize nutrients in feed to maintain metabolism, promote muscle growth, and accumulate fat. It is a key indicator for measuring pig growth traits. The level of FCR directly impacts the cost and economic benefits of pig farming. Statistics show that feed costs account for over 60% of total production costs in the pig farming process. If the FCR of my country's meat pigs were reduced from 2.8:1 to 2.6:1, at least 13 million tons of feed could be saved in the production process, equivalent to 10% of my country's annual grain imports, effectively alleviating the current situation of "competing with livestock for grain." Therefore, reducing feed consumption and improving feed utilization has always been one of the goals of pig breeding. In the breeding process, traditional breeding methods have limited progress due to problems such as long cycle, low efficiency and inaccurate estimation of breeding values. However, the GWAS method can efficiently obtain SNP sites related to feed conversion rate across the entire genome, and use these as molecular markers for subsequent breeding of feed conversion rate traits, providing a theoretical basis for pig breeding.
[0004] Therefore, providing a SNP molecular marker related to pig feed conversion ratio, its detection primers, and its applications is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention
[0005] In view of this, the present invention provides a SNP molecular marker related to pig feed conversion ratio, its detection primers and uses, with the aim of screening a molecular marker related to the feed conversion ratio trait of Large White pigs and providing a corresponding SNP site detection method, thus providing a new site and theoretical basis for marker-assisted selection of the feed conversion ratio trait of Large White pigs.
[0006] To achieve the above objectives, the present invention adopts the following technical solution:
[0007] Feed conversion ratio (FCR) was measured and recorded in 5256 Large White pigs. The collected DNA was genotyped and genotype quality controlled using a Porcine 80K SNP high-density functional site microarray. GWAS was performed on the SNP sites that passed quality control, combined with the phenotypic data of the experimental population, to screen for SNP sites significantly associated with pig feed conversion efficiency. Based on the Sus Scrofa 11.1 version of the Ensemble database, a significant SNP site located at nucleotide 129423208 on chromosome 8 was finally identified. Its nucleotide sequence is shown in SEQ ID NO.1, with the SNP marker located at position 97 of the sequence, and the polymorphism site being T or G. The SNPs screened in this invention can serve as molecular markers for pig feed conversion efficiency. For the chr8:129423208 site, strains with the T / T genotype should be selected for breeding.
[0008] ATCGAAGGAGCCAGGAAATAGACTTATACAAGGATTGTACCTCTAGTACCTAGATCTCATCAGAGGAAGGAAGGGGAGCAGATTTAGAGGAAAAGATCATACTTCCTTTTGTGTCCCCAGCTTCTATTATGTAGCCATCTAT CCTCCAGCACTCAACACACGCATGTTCTATTCTGACAGAGCCAACAAAATGATCCCTTTATAAATAAGAACAAATCATTCCAGGATTCTGCTCCAAATCTGGTCTTCCCATAGCTCAAAGTCAAACTCATTGCAGCAGC; SEQ ID NO.1.
[0009] A SNP molecular marker associated with pig feed conversion ratio, wherein the SNP molecular marker is located at chr8:129423208 in genomic version Ensembl Sscrofa 11.1 and its polymorphic site is T or G.
[0010] Furthermore, the nucleotide sequence containing the SNP molecular marker is shown in SEQ ID NO.1; the SNP molecular marker is located at position 97 of the nucleotide sequence shown in SEQ ID NO.1.
[0011] Furthermore, a primer for detecting the aforementioned SNP molecular marker has the following primer sequence:
[0012] Forward primer: 5'-ATCGAAGGAGCCAGGAAATAGA-3'; SEQ ID NO.2;
[0013] Reverse primer: 5'-GCTGCTGCAATGAGTTTGACTT-3'; SEQ ID NO.3.
[0014] Furthermore, the application of the SNP molecular marker or the primer in detecting the feed conversion ratio trait in pigs.
[0015] Furthermore, strains with the genotype T / T at the chr8:129423208 locus were selected for breeding, as strains with the genotype T / T have high feed utilization rates.
[0016] Furthermore, the breed of pig is the Large White pig.
[0017] Furthermore, the application of the SNP molecular markers or the primers in pig genetic breeding.
[0018] Furthermore, a kit for detecting the SNP molecular markers is characterized by comprising the primers.
[0019] Furthermore, a method for improving pig breeds includes the following steps: detecting the SNP molecular markers described on pig chromosome 8, selecting strains with the genotype T / T for breeding, thereby reducing feed consumption in offspring pigs during production, improving feed conversion ratio, and increasing feed utilization.
[0020] As can be seen from the above technical solution, compared with the prior art, the present invention discloses a SNP molecular marker related to pig feed conversion ratio, its detection primers and uses. The present invention collects DNA from 5256 Large White pigs in an experimental group, uses a Porcine 80K SNP high-density functional site chip for genotyping, and combines the feed conversion ratio phenotype of the experimental group with GWAS analysis based on the MLM model to screen out SNP sites that are significantly related to the feed conversion ratio trait, providing a new molecular marker for the improvement of the feed conversion ratio trait in Large White pigs. Attached Figure Description
[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.
[0022] Figure 1 The attached figure shows the distribution of feed conversion ratio phenotypes in the Large White pig experimental group; the horizontal axis represents the phenotypic values of the experimental group.
[0023] Figure 2 The attached figure is a Manhattan plot of genome-wide association analysis of feed conversion ratio traits; this invention selects SNPs with smaller P-values above the threshold at the chr8:129423208 site for further analysis.
[0024] Figure 3 The attached figure is a QQ plot of the genome-wide association analysis of feed conversion ratio traits;
[0025] Figure 4 The attached figure shows the genotyping of 5256 Large White pigs at the SNP loci screened in this invention; the vertical axis represents the phenotypic value of FCR, and the horizontal axis represents the genotypes TT, TG, and GG in the three groups. Detailed Implementation
[0026] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0027] Example 1: Genome-wide association analysis of genotyping and feed conversion ratio traits
[0028] (1) Ear samples were collected from 5,256 large white pigs. DNA was extracted from the samples and genotyped using a Porcine 80K SNP high-density functional site chip, resulting in a total of 187,255 SNP sites.
[0029] (2) Use Plink v1.90 software to perform quality control on genotype data. The quality control standards are as follows: SNP call rate > 90%, minimum allele frequency (MAF) > 0.01, mind < 0.1, geno < 0.1. Then, fill in the missing genotypes according to the default parameters of Beagle. Perform quality control again on the genotype files after filling, with the standard being MAF > 0.01.
[0030] (3) After quality control, 5256 individuals and 97476 SNP loci were retained for subsequent GWAS studies of feed conversion efficiency traits.
[0031] (4) Using the Auspiron production performance testing system, the feed conversion ratio data of a herd of 5256 Large White pigs during the experiment were recorded, and their distribution is as follows: Figure 1 As shown.
[0032] (5) The association analysis of genotype and phenotype was performed using the GWAS method based on the MLM model. The specific model is: y = Xβ + Vα + Zμ + e. Field and sex were added as fixed effects, and the first three PCs were used as covariates. In this model, y is the phenotype value, β is the fixed effect, α is the SNP vector, μ is the random effect, X, V, and Z are the association matrix, and e is the residual vector.
[0033] (6) This invention employs the Bonferroni method for correction to improve the reliability of experimental results. The genomic significance level threshold is set to 0.05 / N (N is the number of markers). Based on the GWAS results, the P-value of each SNP site is converted to -log. 10 (P), the significance threshold is set to -log 10 (0.05 / N), the -1og value for each SNP site was calculated. 10 A p-value greater than or equal to 6.29 indicates a significant association between the SNP and the trait. Then, Manhattan plots and QQ plots of the feed conversion ratio trait were generated using R packages such as qqman and CMplot. Figure 2 , Figure 3 ).
[0034] (7) In this invention, the SNP with accession number rs325088362, located at nucleotide 129423208 on chromosome 8, was further screened from SNP sites above the significance threshold. The differences in population phenotypic values among different genotypes at this site and the distribution of the number of individuals with the corresponding phenotypic values are as follows: Figure 4 As shown. For the SNP loci finally selected, strains with the genotype T / T should be selected for breeding.
[0035] Example 2: Target DNA sequence amplification and application of SNP sites
[0036] (1) Design primers
[0037] For SEQ ID NO.1, the following primers were designed:
[0038] Forward primer: 5'-ATCGAAGGAGCCAGGAAATAGA-3'; SEQ ID NO.2;
[0039] Reverse primer: 5'-GCTGCTGCAATGAGTTTGACTT-3'; SEQ ID NO.3.
[0040] (2) PCR amplification:
[0041] PCR reaction system: Add 5 μl Taq Mix, 0.3 μl each of forward and reverse primers, 1 μl DNA template, and 3.4 μl ddH2O to a 10 μl reaction system. PCR reaction conditions: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; final extension at 72℃ for 5 min.
[0042] (3) DNA sequencing:
[0043] Finally, the PCR amplified products were sequenced, and bidirectional sequencing of gene fragments was required.
[0044] The sequencing results are shown in SEQ ID NO.4:
[0045] ATCGAAGGAGCCAGGAAATAGACTTATACAAGGATTGTACCTCTAGTACCTAGATCTCATCAGAGGAAGGAAGGGGAGCAGATTTAGAGGAAAAGAKCATACTTCCTTTTGTGTCCCCAGCTTCTATTATGTAGCCATCTATCCTCCAGCACTCAACACACGCATGTTCTATTCTGACAGAGCCAACAA AATGATCCCTTTATAAATAAGAACAAATCATTCCAGGATTCTGCTCCAAATCTGGTCTTCCCATAGCTCAAAGTCAAACTCATTGCAGCAGC; SEQ ID NO.4.
[0046] Note: K in the sequence listing represents the mutation site T / G, and the primer sequences are shown in bold at the beginning and end of the sequence.
[0047] (4) The present invention provides a method for improving the feed conversion ratio of pigs, including the following steps: detecting the SNP site at nucleotide 129423208 on chromosome 8 of pigs, selecting the T / T genotype at this site for breeding, thereby reducing the feed consumption of Large White pigs in the production process and improving feed utilization.
[0048] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. Use of primers for detecting SNP molecular markers in the detection of the feed conversion rate trait in pigs, characterized in that, The SNP molecular marker is located at chr8:129423208 of the genomic version Ensembl Sscrofa 11.1, and the polymorphic site is T or G; The strain with genotype T / T at the site of chr8:129423208 is selected for breeding, and the strain with genotype T / T has high feed utilization rate; The pig is a Large White.
2. Use of primers for detecting SNP molecular markers in the genetic breeding of pigs for the feed conversion trait, characterized in that, The SNP molecular marker is located at chr8:129423208 of the genomic version Ensembl Sscrofa 11.1, and the polymorphic site is T or G; The pig is a Large White.
3. Use according to claim 1 or 2, characterized in that, The primer sequences are as follows: Forward primer: 5'-ATCGAAGGAGCCAGGAAATAGA-3'; SEQ ID NO. 2; Reverse primer: 5'-GCTGCTGCAATGAGTTTGACTT-3'; SEQ ID NO.
3.
4. A method for the improvement of a breed for feed conversion traits in pigs, characterized in that, The method comprises the following steps: Detecting the SNP molecular marker located at chr8:129423208 of the genomic version Ensembl Sscrofa 11.1, and the polymorphic site is T or G, and selecting the strain with genotype T / T for breeding; the pig is a Large White.