Nitrogen-containing heterocyclic compound and application thereof

Abstract

The invention relates to a nitrogen-containing heterocyclic compound derivative and application thereof. The compound of the present invention can exert a therapeutic effect on various neurological disorders such as neurodegenerative diseases, neurodegenerative diseases, neuropsychiatric disorders, memory loss, cognitive dysfunction / impairment, and learning regression disorders by effectively enhancing synaptic plasticity without side effects.

Description

Technical Field

[0001] The present invention relates to a nitrogen-containing heterocyclic compound and its use. More specifically, the present invention relates to a compound, composition or method for preventing or treating neurotic disorders or neurodegenerative disorders. Background Art

[0002] Synaptic plasticity and the critical period

[0003] Neural nets are networks composed of neurons. Synapses are nodes in a neural net where neurons exchange information with each other. In a neural net, synapses are "plastic" in that their number and strength change throughout life as synaptic inputs are added, removed, or elaborated in response to ongoing neural activity. Synaptic plasticity refers to this neural activity-dependent modification of synapses caused by changes in the strength and / or efficiency of synaptic delivery.

[0004] Higher-order functions such as learning, cognition, synthesis, judgment, art, and creativity depend on the ability to form neural networks (called cortical neural networks) in the cerebral cortex. The synaptic plasticity of the cortical neural network reaches its peak in the early postnatal period, which is called the critical period. After the critical period, the synaptic plasticity of the cortex gradually decreases with age, and eventually becomes a state where experience no longer causes active changes in the cerebral cortex. However, interestingly, recent studies have shown that under certain conditions, synaptic plasticity can be restored to a high level even after the critical period ends: in animal models, peripheral nerve injury reactivated synaptic plasticity in the somatosensory thalamocortical circuit that delivers peripheral sensory signals to the cerebral cortex (reference [Yu et al., 2012, Neuron.74:731-42]; reference [Petrus et al., 2014, Neuron.81:664-73]; reference [Gao et al., J Neurosci.34:10770-9]).

[0005] Reduced synaptic plasticity is also associated with adult brain degeneration. In particular, synaptic plasticity in thalamocortical circuits is significantly limited with age. As mentioned above, if the critical period can be restarted, reactivating or enhancing cortical synaptic plasticity through therapeutic means may be used to treat diseases caused by reduced synaptic plasticity.

[0006] Histone deacetylase inhibitors

[0007] Most of the cell's DNA exists in a denser, more compressed form called chromatin. Compression occurs by wrapping the DNA around a group of proteins called histones. The degree of chromatin compression depends on the acetylation level of the histones. Typically, histone acetyltransferases (HATs) perform acetylation that allows access to DNA, and histone deacetylases (HDACs) perform deacetylation that blocks access to DNA. Since transcription only occurs when access is allowed, chromatin compression acts as a regulatory mechanism for gene expression (reference [Verdin and Ott, 2015, Nat Rev Mol Cell Biol 16: 258-264]).

[0008] So far, 11 mammalian HDACs have been identified. These HDACs are roughly divided into four categories based on the degree of homology with yeast HDACs. Class I HDACs include HDAC1, 2, 3, and 8; Class II HDACs are divided into Class IIa (HDAC4, 5, 7, and 9) and Class IIb (HDAC6 and 10) based on structural similarity. Class III HDACs include SIRT1-7, and Class IV HDACs include HDAC11.

[0009] Class I HDACs are mainly confined to the nucleus, while class II HDACs shuttle between the nucleus and cytoplasm through phosphorylation of specific serine residues. The N-terminal domain of HDAC interacts with several tissue-specific transcription factors and acts as a transcriptional repressor. The C-terminal domain of HDAC has deacetylase activity. However, class IIa HDACs do not have deacetylase activity because this type of HDAC carries a loss-of-function mutation in which the tyrosine (Tyr) residue of the C-terminal catalytic domain is replaced by histidine (His).

[0010] HDAC4

[0011] HDAC4 is expressed throughout the body. HDAC4 is particularly highly expressed in the brain, heart, and skeletal muscle (documents [Grozinger et al., 1999, Proc. Natl. Acad. Sci. USA 96, 4868-4873]; document [Darcy et al., 2010, J. Comp. Neurol. 518, 722-740]). In the brain, HDAC4 levels peak shortly after birth (documents [Sando et al., 2012, Cell 151, 821-834]). HDAC4 was detected in corticotropin-releasing hormone (CRH) neurons (100±0%), oxytocin neurons (98±2%), vasopressin neurons (100±0%), orexin neurons (100±0%), AgRP neurons (100±0%), POMC neurons (92±4%), histamine neurons (85±7%), dopamine neurons (100±0%), serotonin neurons (93±2%), and norepinephrine neurons (100±0%) (reference [Takase et al., 2013, PloS ONE 8: e58473]).

[0012] Cytoplasmic HDAC4 responds to low potassium or excitotoxic glutamate conditions that induce apoptosis by rapidly translocating to the nucleus. Ectopic overexpression of HDAC4 in the nucleus promotes neuronal cell death and inhibits the transcriptional activity of survival factors such as MEF2 and CREB (reference [Bolger and Yao, 2005, J Neurosci. 2005; 25: 9544-9553]). Neurons containing HDAC4 are uniform in size and widely distributed in neuropils including the paraventricular nucleus (PVN), lateral hypothalamus (LHA), hypothalamic arcuate nucleus (ARC), tuberous mammary nucleus (TMN), dorsal raphe (DR) and locus coeruleus (LC). In particular, HDAC4 co-localizes with PSD95 (reference [Mielcarek et al., 2013, PLoS Biol. 11: e1001717]; reference [Takase et al., 2013, PloS ONE 8: e58473]), suggesting a role for HDAC4 in synaptic plasticity (reference [Sando et al., 2012, Cell 151, 821-834]; reference [Mielcarek et al., PLoS Biol. 11: e1001717]).

[0013] In animal experimental models, tissue-specific deletion of HDAC4 in rat hippocampus eliminates behavioral changes induced by prolonged stress (document [Sailaja et al., 2012, Proc. Natl. Acad. Sci. USA 109, E3687-E3695]). HDAC4 overexpression increases sensitivity to H2O2 damage by inhibiting the activity of peroxisome proliferator-activated receptor α (PPARα), thereby accelerating the death of cerebellar granule neurons (document [Bolger and Yao, 2005, J. Neurosci. 25, 9544-9553]; document [Li et al., 2012, Nat. Med. 18, 783-790]; document [Sando et al., 2012; Cell 151, 821-834]; document [Yang et al., 2011, FEBS Lett. 585, 761-766]). Overexpression of HDAC4 in the rat hippocampus induces depressive-like behavior (reference [Sarkar et al., 2014, Neuropsychopharmacology 39, 2221-2232]).

[0014] In the Drosophila model, overexpression of HDAC4 in adult mushroom body neurons, which are important structures for memory formation, impaired long-term courtship memory but had no effect on short-term memory (reference [Fitzsimons et al., 2013, PloS ONE8: e83903]). Subsequent studies investigating the relationship with the intracellular distribution of HDAC4 showed that mushroom body morphogenesis, eye development, and long-term memory loss were associated with nuclear HDAC4 abundance (reference [Main et al., 2021, Front. Mol. Neurosci. 14: 616642]).

[0015] Elevated levels of human HDAC4 were found in postmortem HD anterior temporal lobar degeneration (FTLD) brains (reference [Yeh et al., 2013, Brain Res. 1504, 16-24]; reference [Whitehouse et al., 2014, Neuropathol. Appl. Neurobiol. 41, 245-257]). HDAC4 was identified as a component of Lewy bodies in Parkinson's disease brains and a component of nuclear inclusions in neuronal nuclear inclusion disease (reference [Takahashi-Fujigasaki and Fujigasaki, 2006, Neuropathol. Appl. Neurobiol. 32, 562-566]. HDAC4 was observed to be significantly overexpressed in specific cortical areas of autistic patients (reference [Nardone et al., 2014, Transl. Psychiatry 4: e433]).

[0016] HDAC inhibitors and synaptic plasticity

[0017] Histone modification has been proposed as a potential method to restore cortical plasticity in adulthood. Valproic acid is known to be a histone deacetylase (HDAC) inhibitor. In a clinical study in which participants took valproic acid capsules, the critical period was restarted, and even adults could achieve absolute pitch learning that was only possible during the critical period (reference [Gervain et al., 2013, Front Syst Neurosci.7:102]). When adult rats were exposed to an enriched environment compared to normal cage conditions, the total amount of H3 acetylation in the visual cortex increased compared to the control group, and ocular dominance plasticity that only appeared during the critical period was observed after the critical period (reference [Baroncelli L et al., 2016, J Neurosci.36:3430-40]).

[0018] After treatment with the HDAC inhibitor suberoylanilide hydroxamic acid (SAHA), the H3 acetylation level in the visual cortex increased to the level generally observed in young mice, especially the H3 acetylation of the P3 promoter of brain-derived neurotrophic factor (BNDF), which is important for developmental synaptic plasticity and long-term memory in the visual cortex (Baroncelli L et al., 2016, J Neurosci. 36: 3430-40). Increased BDNF expression was also observed in neurospheres (Bagheri et al., 2019, Int. J. Mol. Sci. 20: 1109).

[0019] SAHA or other HDAC inhibitors are reported to have the effect of improving the symptoms of Huntington's disease (HD) mouse models (reference [Ferrante et al., 2003]; reference [Hockly et al., 2003, J Biol. Chem. 278, 16059-16072]; reference [Gardian et al., 2005, J. Biol. Chem. 280, 556-563]). HDAC4 is correlated with the length of polyglutamine expressed in Huntington's disease. It co-localizes with cytoplasmic inclusion bodies and various peripheral organ lesions such as skeletal muscle atrophy and heart failure in Huntington's disease (reference [Zielonka et al., 2014, Front. Physiol. 5: 380]; reference [Mielcarek et al., 2014, PLoS Genet. 10: e1004550]; reference [Mielcarek et al., 2014, PloS ONE 9: e108961]; reference [Zielonka et al., 2014, Exp. Clin. Cardiol. 20, 2547-2554]). If HDAC4 levels are reduced in the R6 / 2 mouse model of Huntington's disease, the formation of cytoplasmic aggregates in various regions of the brain is delayed, motor coordination and nervous system phenotypes are improved, and the effect of prolonging life span is achieved (reference [Mielcarek et al., 2013, PLoS Biol. 11: e1001717]).

[0020] Interestingly, BDNF cortical transcription levels were restored after SAHA treatment in R6 / 2 mice (reference [Mielcarek et al., 2011, PloS ONE 6: e27746]). Since HDAC4 and HDAC5 can inhibit specific BDNF transcription, this effect was shown to be reversed by SAHA treatment, so the memory enhancement and neuroprotective effects of HDAC inhibitors may be related to increased BDNF expression (reference [Koppel and Timmusk, 2013, Neuropharmacology 75, 106-11]).

[0021] HDAC4 can play a central role in brain physiology and can be a useful target for treating a variety of neurodegenerative disorders. However, currently available HDAC inhibitors widely inhibit HDACs and are therefore not suitable for inhibiting specific HDACs. Although SAHA can enhance synaptic plasticity, it causes serious side effects, including fatigue, nausea, diarrhea, or thrombocytopenia, so SAHA is not suitable for use in humans (literature [Meghan E. et al., 2011, Bone. 48: 1117-1126]).

[0022] Therefore, it would be useful to develop selective HDAC inhibitors for targeted therapy. Summary of the invention

[0023] Technical issues to be solved

[0024] The object of the present invention is to solve all the above-mentioned problems.

[0025] An object of the present invention is to provide a nitrogen-containing heterocyclic compound, a stereoisomer thereof or a pharmaceutically acceptable salt thereof for enhancing synaptic plasticity.

[0026] Another object of the present invention is to provide a pharmaceutical composition for treating or preventing neurotic disorders or neurodegenerative disorders, which comprises, as an active ingredient, a nitrogen-containing heterocyclic compound for enhancing synaptic plasticity, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof.

[0027] Another object of the present invention is to provide a method for treating or preventing neurotic disorders or neurodegenerative disorders, comprising administering to a subject a nitrogen-containing heterocyclic compound for enhancing synaptic plasticity, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof.

[0028] Another object of the present invention is to provide a pharmaceutical composition for combined administration and a combined administration method using the same, which comprises a nitrogen-containing heterocyclic compound for enhancing synaptic plasticity, a stereoisomer thereof or a pharmaceutically acceptable salt thereof and a second therapeutic agent.

[0029] The purpose of the present invention is not limited to the above-mentioned purpose. The purpose of the present invention will become more clear through the following description and can be achieved by adopting the means described in the claims and their combination.

[0030] Technical solutions to technical issues

[0031] The representative configuration of the present invention for achieving the above-mentioned object is as follows:

[0032] According to one aspect of the present invention, there is provided a compound represented by formula (1), a stereoisomer thereof or a pharmaceutically acceptable salt thereof:

[0033]

[0034] R 1 C 1-6 Alkyl, C 3-12 Cycloalkyl, aryl or heteroaryl, wherein one or more hydrogen atoms in the group are unsubstituted or are independently replaced by halogen atoms, C 1-6 Alkyl, C 1-6 Alkoxy, nitro, with more than one C 1-6 Alkyl substituted or unsubstituted amino, or hydroxy substituted,

[0035] A is C=O or a bond,

[0036] Q is -(CR 4 R 5 ) m - or key, at this time, R 4 and R 5 are each independently hydrogen or C 1-6 Alkyl, m is an integer from 1 to 6,

[0037] R 2 For hydrogen, C 1-6 Alkyl or aryl,

[0038] R 3 is hydrogen, carboxyl, N-hydroxycarboxamide or carboxamide, wherein one or more hydrogen atoms in the group are not replaced or replaced by C 1-6 Alkyl substitution,

[0039] n is 0 or 1.

[0040] In one embodiment, R 1 C 1-6 Alkyl, C 3-12 Cycloalkyl, phenyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, pyrrolyl, furyl or thienyl, wherein one or more hydrogen atoms in the group may be unsubstituted or each independently substituted by a halogen atom, C 1-6 Alkyl, C 1-6 Alkoxy, nitro, with more than one C 1-6 The alkyl group may be substituted with an unsubstituted amino group or a hydroxy group.

[0041] In one embodiment, R 1 It may be methyl, cyclohexyl, phenyl, 4-methoxyphenyl, 4-(tert-butyl)phenyl, 2-chlorophenyl, 3-chlorophenyl, 4-chlorophenyl, 4-fluorophenyl, 4-bromophenyl, 3,4-dichlorophenyl, 2-chloro-4-fluorophenyl, p-tolyl, m-tolyl, pyridin-4-yl, thien-2-yl, furan-2-yl, pyridin-3-yl, pyridin-2-yl, pyrimidin-5-yl, pyrimidin-2-yl, 4-nitrophenyl, 4-aminophenyl, 3-nitrophenyl, 3-aminophenyl, 4-methoxy-pyridin-3-yl, 6-methoxy-pyridin-3-yl, 4-(dimethylamino)phenyl or 4-hydroxy-phenyl.

[0042] In one embodiment, R 2 Can be H or C 1-6 alkyl.

[0043] In one embodiment, R 3 It may be H, carboxyl, methylcarboxyl, ethylcarboxyl, N-hydroxycarboxamide, carboxamide or sodium carboxylate.

[0044] According to another aspect of the present invention, there is provided a compound represented by formula (2-A) or (2-B), a stereoisomer thereof or a pharmaceutically acceptable salt thereof:

[0045]

[0046] In the formula,

[0047] R 4 C 1-6 Alkyl, C 3-12 Cycloalkyl, phenyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, pyrrolyl, furyl or thienyl, wherein one or more hydrogen atoms in the group are unsubstituted or are independently replaced by halogen atoms, C 1-6 Alkyl, C 1-6 Alkoxy, nitro, substituted by one or more C1-6 alkyl groups or unsubstituted amino or hydroxy groups,

[0048] R 5 and R 6 Each is independently hydrogen or C1-6 alkyl.

[0049] According to another aspect of the present invention, there is provided a compound represented by formula (4), a stereoisomer thereof or a pharmaceutically acceptable salt thereof:

[0050]

[0051] In the formula,

[0052] R 2 For hydrogen, C 1-6 Alkyl or aryl,

[0053] R 3 is hydrogen, carboxyl, N-hydroxycarboxamide or carboxamide, wherein one or more hydrogen atoms in the group are not replaced or replaced by C 1-6 Alkyl substitution,

[0054] n is 0 or 1.

[0055] According to another aspect of the present invention, there is provided a compound represented by formula (5), a stereoisomer thereof or a pharmaceutically acceptable salt thereof:

[0056]

[0057] In the formula,

[0058] R 2 For hydrogen, C 1-6 Alkyl or aryl,

[0059] R 4is phenyl or phenyl substituted by one or more halogens,

[0060] n is 0 or 1.

[0061] In one embodiment, the compound can be a compound selected from the compounds shown in Table 2 to Table 4, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof.

[0062] In one embodiment, the compound may be BnH12001 or its enantiomer.

[0063] In one embodiment, the stereoisomers may be optical isomers.

[0064] In one embodiment, the compound may be an inhibitor of HDAC. In another embodiment, the HDAC may be HDAC4.

[0065] In one embodiment, the compound can enhance synaptic plasticity.

[0066] According to another aspect of the present invention, there is provided a pharmaceutical composition comprising the compound, its stereoisomer or a pharmaceutically acceptable salt thereof as an active ingredient.

[0067] In one embodiment, the composition can be used to prevent or treat neurotic disorders or neurodegenerative disorders.

[0068] In another embodiment, the compound, its stereoisomer or a pharmaceutically acceptable salt thereof can be delivered to the brain at a concentration of about 0.1 to about 3 μM.

[0069] In another embodiment, the disorder may be Alzheimer's disease.

[0070] In another embodiment, the disorder may be PTSD.

[0071] In one embodiment, the composition may further comprise a second therapeutic agent.

[0072] In another embodiment, the second therapeutic agent can be aducanumab.

[0073] According to another aspect of the present invention, there is provided a method for preventing or treating a neurotic disorder or a neurodegenerative disorder, comprising administering the compound, a stereoisomer thereof or a pharmaceutically acceptable salt thereof to an individual in need of preventing or treating a neurotic disorder or a neurodegenerative disorder.

[0074] According to another aspect of the present invention, there is provided a use of the compound, its stereoisomer or its pharmaceutically acceptable salt in medicine or in the preparation of medicine.

[0075] According to one embodiment, the use is for reactivating or enhancing brain synaptic plasticity.

[0076] According to another embodiment, the use is for preventing or treating a neurotic disorder or a neurodegenerative disorder.

[0077] Effects of the Invention

[0078] The compounds of the present invention can exert therapeutic effects on various neurological disorders or neurodegenerative disorders by effectively enhancing or reactivating synaptic plasticity without side effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0079] Figure 1a Shown are the results of assays of cell viability in the human cell line SH-SY5Y in response to administration of BnH12001 (0, 0.1, 1, 10, 100 μM).

[0080] Figure 1b Shown are the results of assays of cell viability in the human cell line 293T in response to administration of BnH12001 (0, 0.1, 1, 10, 100 μM).

[0081] Figure 2 The graph shows the results of measuring the expression of BDNF and GluN2B after 293T cells were treated with the compound BnH12001.

[0082] Figure 3a to Figure 3c The graph shows the results of measuring the expression of HDAC4, BDNF, and GluN2B after SH-SY5Y cells were treated with the compound BnH12001.

[0083] Figure 4a Shows the injection site of the osmotic pump (Os pump) in the mouse experiment.

[0084] Figure 4b Shown are the patch recording sites in mouse experiments.

[0085] Figure 4c Shown are the results of measuring the excitation / inhibition balance in the barrel cortex (layer 4) of mice in response to BnH12001 administration (Os pump, intracerebroventricular injection, 3 μM).

[0086] Figure 4d Shown are changes in thalamocortical (TC) excitatory postsynaptic current (EPSC) potency in the barrel cortex (layer 4) of mice in response to administration of BnH12001 (Os pump, intracerebroventricular injection, 3 μM).

[0087] Figure 5a Shown are the results of measuring excitation / inhibition balance in the barrel cortex (layer 4) of mice in response to oral administration of BnH12001 (1 mg / kg).

[0088] Figure 5b Shown are changes in TCEPSC potency in the barrel cortex (layer 4) of mice in response to oral administration of BnH12001 (1 mg / kg).

[0089] Figure 5c Shown are changes in TC EPSC potency in mouse barrel cortex (layer 4) in response to administration of various doses (0.03, 0.1, 0.3, 1, 3, 10 mg / kg) of BnH12001.

[0090] Figure 6a Shown is the administration schedule used to analyze the efficacy of BnH12001 enantiomer (3S, 6R, 98%<) alone or in combination with aducanumab to enhance synaptic plasticity in vitro in an animal model of Alzheimer's disease.

[0091] Figure 6b Shown are the results of LTP assays of field excitatory postsynaptic potentials in the hippocampus of an Alzheimer's mouse model following administration of BnH12001 enantiomers (3S, 6R, 98%<) alone or in combination with aducanumab.

[0092] Figure 6c Shown are the results of measuring the excitation / inhibition balance in the sensory cerebral cortex of an Alzheimer's mouse model after administration of BnH12001 enantiomers (3S, 6R, 98%<) alone or in combination with aducanumab (right) and changes in TC EPSC potency (left).

[0093] Figure 7 The binding properties of BnH12001 to HDAC4 are shown.

[0094] Figure 8a and Figure 8b Shown is the knockdown effect of HDAC4 shRNA on HDAC4, BDNF and GluN2B expression in the human cell line SH-SY5Y.

[0095] Figures 9a to 9c Shown are the effects of BnH12001 on the expression of BDNF and GluN2B.

[0096] Fig.10a and Fig.10b Shown is the time-dependent effect of BnH12001 on HDAC4 expression.

[0097] Fig.11a and Fig.11b Shown are the effects of BnH12001 on thalamocortical EPSC potency.

[0098] Fig.12aShown are changes in TC EPSC potency in mouse barrel cortex (layer 4) in response to oral administration (1 mg / kg) of BnH12001 enantiomer (3R, 6S, 98% <) and BnH12001 enantiomer (3S, 6R, 98% <).

[0099] Figure 12b Shown are the results of determination of excitation / inhibition balance in the barrel cortex (layer 4) of mice based on oral administration (1 mg / kg) of BnH12001 enantiomer (3R, 6S, 98%<) and BnH12001 enantiomer (3S, 6R, 98%<).

[0100] Fig.13a Shown is the effect of BnH12001 enantiomer (3S, 6R, 98%<) on the expression of BDNF and GluN2B in primary cultured cortical neurons.

[0101] Fig.13b Shown are the effects of BnH12001 enantiomers (3S, 6R, 98%<) on the expression of HDAC4, BDNF, and GluN2B in 8-week-old C57BL / 6J mice.

[0102] Fig.13c Shown is the effect of BnH12001 enantiomer (3S, 6R, 98%<) on the expression of GluN2B in 13 month old C57BL / 6J mice. DETAILED DESCRIPTION

[0103] The present invention is described in detail below with reference to specific drawings for specific embodiments in which the present invention can be implemented, but the present invention is not limited thereto and, if properly described, is limited only by the appended claims and the scope of protection required by the claims. Unless otherwise specified, the terms used in the description of the present invention should be understood as their ordinary meanings and apply to the embodiments or examples of the invention in which these terms are defined and the same terms used in this specification.

[0104] Throughout the detailed description of the present invention, when compositions and kits are described as having or comprising specific components, it is contemplated that the compositions and kits of the present invention consist of the recited components or further exist consisting of the components.

[0105] In applications where an factor or component is included and / or comprises or is selected from a list of factors or components mentioned, it should be understood that the factor or component may be any one of the factors or components mentioned, or the factor or component may be selected from the group consisting of the factors or components.

[0106] It should be understood that the order or sequence of steps used to perform a particular action is not important as long as the invention remains feasible. Moreover, more than two steps or actions may be performed simultaneously.

[0107] At various places in the present specification, variables or parameters are disclosed in groups or ranges. The specific description is specifically intended to include all individual subcombinations of these groups and ranges.

[0108] In this specification, the use of examples or illustrative expressions such as "such as ~" or "including ~" is only intended to better illustrate the present invention, and does not limit the present invention unless otherwise stated. Any expression in this specification should not be interpreted as indicating that any unclaimed factor is essential to the implementation of the present invention.

[0109] I. Definitions

[0110] In this specification, singular terms also refer to the plural form (ie, at least one) unless the context is inappropriate.

[0111] Unless otherwise stated, in this specification, "and / or" means "and" or "or".

[0112] Unless otherwise understood from the context and usage, “at least one” includes each of the items mentioned after it and various combinations of more than two of the items mentioned.

[0113] “Comprise,” “comprises,” “comprising,” “Include,” “includes,” “including,” “have,” “has,” or “having” (including grammatical equivalents thereof) should generally be construed as open-ended and non-limiting, e.g., not excluding other unrecited elements or steps unless the context specifically states or understands otherwise.

[0114] "About" means approximately, in the range of, roughly, or about. When the term "about" is used with a numerical range, it modifies the range by extending the upper and lower boundaries of the listed numerical values. Generally, the term "about" is used in this specification to modify the numerical value by a variation of 10% above and below the indicated value.

[0115] "Individual," "patient," and "subject" are used interchangeably and include any animal, including mammals (e.g., primates including mice, rats, other rodents, rabbits, dogs, cats, pigs, cows, sheep, horses, or humans).

[0116] "Treat", "treating", "treatment" includes any effect that improves, alleviates, reduces, modulates, improves, relieves or eliminates, or ameliorates the symptoms of a condition, disease, disorder, etc. Treatment can be a cure, an amelioration, or at least a partial amelioration of a disorder. In certain embodiments, treatment refers to curing a disease.

[0117] "Active agent" is used to refer to a biologically active compound or a pharmaceutically acceptable salt thereof. In some embodiments, an "active agent" is a compound or a pharmaceutically acceptable salt thereof that has a pharmaceutical use. For example, an active agent can be an anti-neurodegenerative therapeutic agent.

[0118] The "compound" refers to a chemical substance having a structure represented by a chemical formula described in the present specification, a stereoisomer thereof (including a mixture of stereoisomers), or a pharmaceutically acceptable salt thereof.

[0119] "Pharmaceutically acceptable" includes molecular entities and formulations that do not produce adverse, allergic or other untoward reactions when properly administered to animals or humans.

[0120] "Pharmaceutically acceptable salt" refers to a salt that retains the biological effects and properties of a free base or free acid. For example, a pharmaceutically acceptable salt can be prepared by adding an inorganic base or an organic base to a free acid. Salts from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, magnesium salts, and the like. Salts from organic bases include, but are not limited to, primary amines, secondary amines, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins, such as, but not limited to, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, diethylamine, lysine, arginine, N-ethylpiperidine, piperidine, piperazine, and the like.

[0121] "Pharmaceutically acceptable excipients" and "pharmaceutically acceptable carriers" refer to substances that facilitate the administration of an active agent to a subject and absorption by the subject, and can be included in the compositions of the present invention without causing significant adverse toxicological effects on the patient. Non-limiting examples of pharmaceutically acceptable excipients include water, NaCl, saline, lactated Ringer's, normal sucrose, normal glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavoring agents, saline solutions (e.g., Ringer's solution), alcohols, oils, gelatin, carbohydrates (e.g., lactose, amylose or starch), fatty acid esters, hydroxymethylcellulose, polyvinylpyrrolidine, pigments, and the like. Such preparations can be sterilized and, as desired, can be mixed with adjuvants that do not react adversely with the compounds of the present invention, such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts that affect osmotic pressure, buffers, colorants, and / or aromatic substances. Those skilled in the art will appreciate that other pharmaceutical excipients are useful for the present invention.

[0122] Exemplary pharmaceutically acceptable carriers or components thereof include sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium carboxymethylcellulose, ethylcellulose and methylcellulose; tragacanth powder; malt; gelatin; talc; solid lubricants, such as stearic acid and magnesium stearate; calcium sulfate; synthetic oils; vegetable oils, such as peanut oil, cottonseed oil, sesame oil, olive oil and corn oil; polyols, such as propylene glycol, glycerol, sorbitol, mannitol and polyethylene glycol; alginic acid; phosphate buffer; emulsifiers, such as Wetting agents, such as sodium lauryl sulfate; coloring agents; flavoring agents; tableting agents; stabilizers; antioxidants; preservatives; pyrogen-free water; isotonic saline; and phosphate buffered saline.

[0123] "Pharmaceutical composition" or "pharmaceutical formulation" refers to the combination of an active agent and an inert or active carrier.

[0124] "Effective amount" refers to an amount of a compound or composition (e.g., a compound or composition of the invention) sufficient to achieve a beneficial or desired result. An effective amount can be administered, applied, or dosed once or more and is not intended to be limited to a particular formulation or route of administration.

[0125] "Administering" refers to oral administration, suppository administration, topical contact administration, intravenous administration, parenteral administration, intraperitoneal administration, intramuscular administration, intralesional administration, intrathecal administration, intracranial administration, intraventricular administration, intranasal administration or subcutaneous administration, or implantation of a sustained-release device (e.g., mini-Os pump). Administration can be carried out by any route, including parenteral administration and transmucosal administration (e.g., oral, sublingual, palate, gums, nasal cavity, vagina, rectum or transdermal). Parenteral administration includes, for example, intravenous administration, intramuscular administration, intraarterial administration, intradermal administration, subcutaneous administration, intraperitoneal administration, intraventricular administration and intracranial administration. Other delivery methods include, but are not limited to, the use of liposome preparations, intravenous injections, transdermal patches, etc. "Co-administering" refers to the administration of the composition described in this specification while, before or after applying more than one additional therapy (e.g., anticancer agents, chemotherapeutic agents or neurodegenerative disease therapeutic agents). The compound of the present invention can be administered alone or can be co-administered to the patient. Co-administering refers to administering the compound simultaneously or sequentially, including administering alone or in combination (more than one compound or preparation). Thus, the formulations may also be combined with other active substances as desired (eg in order to reduce metabolic degradation).

[0126] The pharmaceutical formulations of the present invention can be administered to mammals, such as humans, but can also be administered to other mammals, such as animals requiring veterinary treatment, such as livestock (e.g., dogs, cats, etc.), farm animals (e.g., cattle, sheep, pigs, horses, etc.), and experimental animals (e.g., rats, mice, guinea pigs, etc.).

[0127] The "cognitive function" of a subject can be defined as an intellectual activity or function. Examples of intellectual activities or functions include, but are not limited to, attention, processing speed, learning and memory, executive function, verbal fluency, and working memory. For example, if the composition of the present invention improves one or more intellectual activities or functions of a subject with impaired cognitive function, it can improve cognitive function.

[0128] "Histone deacetylase" or "HDAC" is intended to refer to any of a family of enzymes that remove Nε-acetyl groups from the ε-amino groups of lysine residues of proteins (e.g., histones or tubulin). Unless the context indicates otherwise, the term "histone" is intended to refer to any histone of any species, including H1, H2A, H2B, H3, H4, and H5.

[0129] "HDAC-mediated disease or disorder" or "histone deacetylase-mediated disease or disorder" refers to a disease or disorder for which HDAC and / or the action of HDAC is important or necessary for the onset, progression or expression.

[0130] "Inhibiting HDAC enzyme activity" or "inhibiting HDAC" refers to reducing the catalytic activity of HDAC or reducing HDAC activity that is not related to catalytic activity.

[0131] "Neurological disorders" include neurodegenerative diseases, neuropsychiatric diseases, memory loss, cognitive dysfunction / impairment, and regression learning disabilities.

[0132] "Neurodegenerative disease" refers to any disease that can be reversed, prevented, controlled, treated, ameliorated or eliminated by an agent that stimulates the generation of new neurons.

[0133] "Memory" refers to the ability to retrieve information about past events or knowledge.

[0134] "Age-related memory loss" refers to a continuum of conditions characterized by a deterioration in neurological function that has not yet reached the level of dementia, as further defined herein, as defined in the document [Diagnostic and Statistical Manual of Mental Disorders: 4th Edition of the American Psychiatric Association (DSM-IV, 1994)].

[0135] "Injury-related memory loss" is memory loss caused by damage to the brain and may also involve neurological damage.

[0136] "Cognitive impairment" refers to a state in which cognitive function is not as robust as that of age-matched normal subjects, including a state of cognitive decline.

[0137] Unless otherwise specified, the "alkyl" used in this specification refers to a C1 to C 10 Saturated straight-chain, branched-chain or cyclic primary, secondary or tertiary hydrocarbons, including methyl, CF3, CCl3, CFCl2, CF2C l, ethyl, CH2CF3, CF2CF3, propyl, isopropyl, cyclopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, cyclopentyl, isopentyl, neopentyl, hexyl, isohexyl, cyclohexyl, cyclohexylmethyl, 3-methylpentyl, 2,2-dimethylbutyl and 2,3-dimethylbutyl. The term includes substituted and unsubstituted alkyl, especially haloalkyl, more especially fluoroalkyl. Non-limiting examples of parts that can replace alkyl are known to those skilled in the art, for example, as disclosed in the literature [Greene et al., Protective Groups in Organic Synthesis, John Wiley and Sons, Second Edition, 1991] to which this specification is referred, selected from the group consisting of unprotected or protected halogen (fluorine, chlorine, bromine or iodine), hydroxyl, amino, alkylamino, arylamino, alkoxy, aryloxy, thiol, nitro, cyano, sulfonic acid, sulfate, phosphoric acid, phosphate or phosphate ester as needed.

[0138] As used in this specification, unless otherwise indicated, "aryl" refers to an aromatic monocyclic or polycyclic system containing 6 to 14 carbon atoms, specifically including phenyl, biphenyl or naphthyl, preferably phenyl. The term includes substituted and unsubstituted parts. As known to those skilled in the art, for example, as disclosed in the literature [Greene et al., Protective Groups in Organic Synthesis, John Wiley and Sons, Second Edition, 1991] to which this specification is referred, aryl can be selected from unprotected or protected halogen (fluorine, chlorine, bromine or iodine), hydroxyl, amino, alkylamino, dialkylamino, arylamino, alkoxy, aryloxy, thiol, nitro, cyano, sulfonic acid, sulfate, phosphoric acid, phosphate or phosphate ester, as required, and any part of the part recorded is substituted.

[0139] As used in this specification, "heteroaryl", unless otherwise specified, refers to an aromatic monocyclic or polycyclic system having 5 to 14 ring atoms, wherein 1 to 4 ring atoms are independently O, N or S, and the remaining ring atoms are carbon atoms, preferably an aromatic monocyclic system having 5 or 6 ring atoms, wherein 1 to 4 ring atoms are independently O, N or S, and the remaining ring atoms are carbon atoms, specifically including pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, pyrrolyl, furanyl, thienyl, imidazolyl or oxazolyl. As known to those skilled in the art, for example, as disclosed in the literature [Greene et al., Protective Groups in Organic Synthesis, John Wiley and Sons, 2nd edition, 1991] to which this specification is referred, the heteroaryl group may be substituted as required with any of the described moieties including, but not limited to, one or more moieties selected from the group consisting of unprotected or protected halogen (fluorine, chlorine, bromine or iodine), hydroxyl, amino, alkylamino, dialkylamino, arylamino, alkoxy, aryloxy, thiol, nitro, cyano, sulfonic acid, sulfate, phosphoric acid, phosphate or phosphate ester.

[0140] II. Active Compounds

[0141] In one aspect of the present invention, there is provided a compound of formula (1), a stereoisomer thereof or a pharmaceutically acceptable salt thereof:

[0142]

[0143] In the formula,

[0144] R 1 C 1-6 Alkyl, C 3-12 Cycloalkyl, aryl or heteroaryl, wherein one or more hydrogen atoms in the group may be unsubstituted or each independently substituted by a halogen atom, a C 1-6 Alkyl, C 1-6 Alkoxy, nitro, with more than one C 1-6 Alkyl substituted or unsubstituted amino or hydroxyl,

[0145] A is C=O or a bond,

[0146] Q is -(CR 4 R 5 ) m - or key, at this time, R 4 and R 5 are each independently hydrogen or C 1-6 Alkyl, m is an integer from 1 to 6,

[0147] R 2 For hydrogen, C 1-6 Alkyl or aryl,

[0148] R 3 It can be hydrogen, carboxyl, N-hydroxycarboxamide or carboxamide, wherein one or more hydrogens in the group are not replaced or replaced by C 1-6 Alkyl substitution,

[0149] n is 0 or 1.

[0150] In one embodiment, the stereoisomer may be an optical isomer. Preferably, the compound may be in the form of a (3R, 6S)-optical isomer or a (3S, 6R)-optical isomer.

[0151] In one embodiment, R 1 Can be C 1-6 Alkyl, C 3-12 cycloalkyl, phenyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, pyrrolyl, furanyl or thienyl. 1 One or more hydrogen atoms in the group may be independently replaced by halogen atoms, C 1-6 Alkyl, C 1-6 Alkoxy, nitro, with more than one C 1-6 Alkyl is substituted or unsubstituted amino or hydroxy. Preferably, R 1 One or more hydrogen atoms in the group may be independently replaced by halogen atoms, C 1-6 Alkyl, C 1-6 Alkoxy or more than one C 1-6 The alkyl group may be substituted with an unsubstituted amino group.

[0152] In one embodiment, R 1 Can be C 1-6 Alkyl, C 3-12 Cycloalkyl, phenyl, phenyl substituted by one or more halogens, phenyl substituted by one or more C 1-6 Alkyl-substituted phenyl, substituted with one or more halogen and one or more C 1-6 Alkyl-substituted phenyl, substituted with one or more C 1-6 Alkoxy-substituted phenyl, unsubstituted or substituted with one or more amino groups (the amino group is substituted with one or more C 1-6 substituted with one or more nitro groups), phenyl, pyridyl, substituted with one or more C 1-6 Alkoxy substituted pyridyl, pyrimidinyl, pyrazinyl, pyrrolyl, furanyl or thienyl.

[0153] In another embodiment, R 1It may be methyl, cyclohexyl, phenyl, 4-methoxyphenyl, 4-(tert-butyl)phenyl, 2-chlorophenyl, 3-chlorophenyl, 4-chlorophenyl, 4-fluorophenyl, 4-bromophenyl, 3,4-dichlorophenyl, 2-chloro-4-fluorophenyl, p-tolyl, m-tolyl, pyridin-4-yl, thien-2-yl, furan-2-yl, pyridin-3-yl, pyridin-2-yl, pyrimidin-5-yl, pyrimidin-2-yl, 4-nitrophenyl, 4-aminophenyl, 3-nitrophenyl, 3-aminophenyl, 4-methoxy-pyridin-3-yl, 6-methoxy-pyridin-3-yl, 4-(dimethylamino)phenyl or 4-hydroxy-phenyl.

[0154] In one embodiment, R 2 Can be H or C 1-6 alkyl.

[0155] In one embodiment, R 3 It may be H, carboxyl, methylcarboxyl, ethylcarboxyl, N-hydroxycarboxamide, carboxamide or sodium carboxylate.

[0156] In one embodiment, A and Q may not be bonds at the same time.

[0157] In one embodiment, m may be an integer from 1 to 6, an integer from 1 to 3, or an integer from 1 to 2.

[0158] In one embodiment, a compound of formula (2-A) or (2-B) may be provided:

[0159]

[0160] In the formula,

[0161] R 4 C 1-6 Alkyl, C 3-12 Cycloalkyl, aryl or heteroaryl, wherein one or more hydrogen atoms in the group may be unsubstituted or each independently substituted by a halogen atom, a C 1-6 Alkyl, C 1-6 Alkoxy, nitro, with more than one C 1-6 Alkyl substituted or unsubstituted amino or hydroxyl substituted, R 5 and R 6 are independently hydrogen or C 1-6 alkyl.

[0162] In one embodiment, R 4 Can be C 1-6 Alkyl, C 3-12 cycloalkyl, phenyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, pyrrolyl, furanyl or thienyl. 4 One or more hydrogen atoms in the group may be independently replaced by halogen atoms, C 1-6Alkyl, C 1-6 Alkoxy, nitro, with more than one C 1-6 The alkyl group may be substituted with an unsubstituted amino group or a hydroxy group.

[0163] In one embodiment, R 4 Can be C 1-6 Alkyl, C 3-12 Cycloalkyl, phenyl, phenyl substituted with one or more halogens, one or more C 1-6 Alkyl-substituted phenyl, one or more halogens and one or more C 1-6 Alkyl-substituted phenyl, one or more C 1-6 Alkoxy-substituted phenyl, unsubstituted or with one or more C 1-6 Alkyl substituted one or more amino substituted phenyl, one or more nitro substituted phenyl, pyridyl, one or more C 1-6 Alkoxy substituted pyridyl, pyrimidinyl, pyrazinyl, pyrrolyl, furanyl or thienyl.

[0164] In another embodiment, R 4 It may be methyl, cyclohexyl, phenyl, 4-methoxyphenyl, 4-(tert-butyl)phenyl, 2-chlorophenyl, 3-chlorophenyl, 4-chlorophenyl, 4-fluorophenyl, 4-bromophenyl, 3,4-dichlorophenyl, 2-chloro-4-fluorophenyl, p-tolyl, m-tolyl, pyridin-4-yl, thien-2-yl, furan-2-yl, pyridin-3-yl, pyridin-2-yl, pyrimidin-5-yl, pyrimidin-2-yl, 4-nitrophenyl, 4-aminophenyl, 3-nitrophenyl, 3-aminophenyl, 4-methoxy-pyridin-3-yl, 6-methoxy-pyridin-3-yl, 4-(dimethylamino)phenyl or 4-hydroxy-phenyl.

[0165] In one embodiment, a compound of formula (4) may be provided:

[0166]

[0167] In the formula,

[0168] R 2 For hydrogen, C 1-6 Alkyl or aryl,

[0169] R 3 is hydrogen, carboxyl, N-hydroxycarboxamide or carboxamide, wherein one or more hydrogens in the group may be unsubstituted or replaced by C 1-6 Alkyl substitution,

[0170] n is 0 or 1.

[0171] Preferably, R 2 It can be hydrogen or C 1-6 alkyl.

[0172] In one embodiment, a compound of formula (5) may be provided:

[0173]

[0174] In the formula,

[0175] R 2 For hydrogen, C 1-6 Alkyl or aryl,

[0176] R 4 is phenyl or phenyl substituted by one or more halogens, preferably 2-chloro-4-fluorophenyl,

[0177] n is 0 or 1.

[0178] Preferably, R 2 It can be hydrogen or C 1-6 alkyl.

[0179] In one embodiment, the compound of formula (1) can be provided in the form of a pharmaceutically acceptable salt thereof. Preferably, the salt can be a sodium salt.

[0180] In one embodiment, the compound of formula (1) includes but is not limited to the compounds shown in the following Table 1. BnH12001 shown in the following Table 1 is used interchangeably with "BnH12001 (racemate)" or "12-004".

[0181] [Table 1]

[0182]

[0183]

[0184]

[0185] In one aspect, the compounds and compositions described in this specification may be inhibitors of HDAC. Preferably, the HDAC is HDAC4.

[0186] In another aspect, the compounds and compositions described herein are synaptic plasticity modulators. Preferably, the synaptic plasticity is synaptic plasticity in the barrel cortex (eg, layer 4) of the brain.

[0187] III. Pharmaceutical Compositions

[0188] Generally, the compounds described in this specification can be formulated into pharmaceutical compositions using methods well known to those skilled in the art. The concentration of the active compound in the pharmaceutical composition will vary according to the absorption, inactivation and excretion rate of the drug and other factors known to those skilled in the art. It should be noted that the dosage value will also vary with the severity of the disease to be alleviated. It should also be understood that for any particular subject, the specific application regimen should be adjusted over time according to the needs of the individual and the professional judgment of the personnel administering the composition or supervising the administration of the composition, and the concentration ranges described in this specification are only illustrative and are not intended to limit the scope or implementation of the claimed composition. The active ingredient can be administered in one go or divided into multiple smaller doses and administered at different time intervals.

[0189] The inhibitor concentration that reduced HDAC activity to 50% of that that did not inhibit HDAC activity was determined as the IC 50 In some embodiments, the reduction in HDAC is at least 50%, such as at least about 75%, such as at least about 90%. In some embodiments, the reduction in HDAC activity is at least 95%, such as at least 99%. In some embodiments, the IC values ​​of the compounds described in this specification are 50 The value is less than 100 nanomolar. In some embodiments, the IC of the compounds described in this specification is 50 The value is 100 nanomolar to 1 micromolar. In some embodiments, the IC of the compounds described in this specification 50 Values ​​range from 1 to 25 micromolar.

[0190] In some embodiments, the inhibition is specific, i.e., the histone deacetylase inhibitor reduces the ability of the histone deacetylase to remove acetyl groups from proteins at a concentration lower than the concentration of the inhibitor required to produce another unrelated biological effect. In some embodiments, the concentration of the inhibitor required for histone deacetylase inhibitory activity is at least 2 times lower than the concentration required to produce an unrelated biological effect, such as at least 5 times lower, such as at least 10 times lower, such as at least 20 times lower.

[0191] In some embodiments, the pharmaceutical composition comprises about 25 mg, about 50 mg, about 75 mg, about 100 mg, about 150 mg, about 200 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 600 mg, about 700 mg, about 800 mg, about 900 mg, about 1000 mg, about 1250 mg, about 1500 mg, about 1750 mg, about 2000 mg, about 2250 mg, about 2500 mg, about 2750 mg, or about 3000 mg of the compound.

[0192] In some embodiments, the pharmaceutical composition comprises about 0.01 mg / kg to about 125 mg / kg of subject body weight / day, preferably about 1 mg / kg to about 50 mg / kg of subject body weight / day, once or more per day to achieve the desired therapeutic effect.

[0193] In a specific embodiment, the composition contains, for example, 0.0001 to 99.9 wt %, preferably 0.001 to 50 wt % of the compound based on the total composition weight. The content ratio is a value based on the dry amount after solvent removal.

[0194] In certain embodiments, the composition comprises a 5% (w / v), 10% (w / v), 15% (w / v), 20% (w / v), 25% (w / v), 30% (w / v), 35% (w / v) or 40% (w / v) aqueous solution of one or more compounds. In some embodiments, the effective amount of the composition comprises a 25% (w / v) solution of one or more compounds.

[0195] In certain embodiments, the pharmaceutical composition of the present invention further comprises one or more pharmaceutically acceptable excipients. In certain embodiments, one or more pharmaceutically acceptable excipients are selected from the group consisting of diluents, buffers, preservatives, stabilizers, solubilizers or any combination thereof.

[0196] In certain embodiments, the pharmaceutical composition can be formulated into a liquid dosage form suitable for oral, intracavitary, intradermal, intramuscular, intrathecal, intravenous, subcutaneous or intracerebroventricular administration.

[0197] In certain embodiments, the liquid dosage form of the pharmaceutical composition as described in the specification further comprises a diluent. In some embodiments, the inactive diluent is physiological saline.

[0198] In a specific embodiment, the liquid dosage form of the pharmaceutical composition as described in the specification also includes a buffer. For example, buffers suitable for use in the present invention include, but are not limited to, organic acids, inorganic acids and salts thereof, such as citrate buffers (e.g., monosodium citrate-disodium citrate mixtures, citric acid-trisodium citrate mixtures, citric acid-monosodium citrate mixtures), succinate buffers (e.g., succinic acid-monosodium succinate mixtures, succinic acid-sodium hydroxide mixtures, succinic acid-disodium succinate mixtures), tartrate buffers (e.g., tartaric acid-sodium tartrate mixtures, tartaric acid-potassium tartrate mixtures, tartaric acid-sodium hydroxide mixtures), fumarate buffers (e.g., fumaric acid-monosodium fumarate mixtures, The present invention also can be used as a buffer of the present invention. The buffer of the present invention can be a mixture of fumaric acid and disodium fumarate, a mixture of monosodium fumarate and disodium fumarate, a gluconate buffer (e.g., a gluconate-sodium gluconate mixture, a gluconate-sodium hydroxide mixture, a gluconate-potassium gluconate mixture), an oxalate buffer (e.g., an oxalic acid-sodium oxalate mixture, an oxalic acid-sodium hydroxide mixture, an oxalic acid-potassium oxalate mixture, etc.), a lactate buffer (e.g., a lactic acid-sodium lactate mixture, a lactic acid-sodium hydroxide mixture, a lactic acid-potassium lactate mixture, etc.) and an acetate buffer (e.g., an acetic acid-sodium acetate mixture, an acetic acid-sodium hydroxide mixture, etc.). In addition, a phosphate buffer, a histidine buffer and a trimethylamine salt (e.g., Tris) can also be used.

[0199] In a particular embodiment, the liquid dosage form of the pharmaceutical composition as described in this specification also includes a preservative. For example, preservatives suitable for use in the present invention include, but are not limited to, phenol, benzyl alcohol, metacresol, methylparaben, propylparaben, octadecyldimethylbenzyl ammonium chloride, benzalkonium chloride halides (e.g., chloride, bromide and iodide), hexamethylammonium chloride and alkylparabens (e.g., methylparaben or propylparaben, catechol, resorcinol, cyclohexanol and 3-pentanol).

[0200] In a specific embodiment, the liquid dosage form of the pharmaceutical composition as described in this specification also includes a stabilizer. For example, suitable stabilizers include, but are not limited to, polyols, triols or higher, amino acids, organic sugars or sugar alcohols, polyvinyl pyrrolidone monosaccharides, trisaccharides, polysaccharides, proteins, sulfur-containing reducing agents, amino acid polymers, and polyethylene glycol.

[0201] In a particular embodiment, the liquid dosage form of the pharmaceutical composition as recorded in this specification also includes a solubilizing agent. In certain embodiments, the solubilizing agent is an ionic surfactant. The example of a nonionic surfactant includes but is not limited to polysorbate, poloxamer, pluronic polyol and polyoxyethylene sorbitol monoether.

[0202] In specific embodiments, the pharmaceutical composition disclosed in the present specification can be prepared into a lyophilized preparation or aqueous solution by mixing the composition with any pharmaceutically acceptable carrier, excipient or stabilizer (e.g., buffer, stabilizer, preservative, isotonic agent, non-ionic detergent, antioxidant and various other additives) commonly used in the art for storage.

[0203] If the compound is administered orally, it can be formulated with pharmaceutically acceptable excipients into pills, capsules, cachets, tablets, and the like.

[0204] Compressed tablets can be prepared by compressing the active ingredient in a free-flowing form (e.g., powder or granules) in a suitable machine, optionally mixed with a binder, lubricant, inactive diluent, preservative, surfactant or dispersant. Molded tablets can be prepared by molding a mixture of powdered active ingredients moistened with an inactive liquid diluent in a suitable machine. The tablets may be optionally coated or scored, and optionally formulated to provide slow or regulated release of the active ingredient. Tablets, lozenges, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules (e.g., gelatin capsules), syrups or elixirs can be prepared for oral administration. The preparation of the compound of the present invention for oral administration can be prepared according to manufacturing methods known in the art as a pharmaceutical composition, and such a composition may contain more than one preparation including agents, including sweeteners, fragrances, colorants and preservatives, to provide a palatable preparation. The purified active ingredient is suitably mixed with a non-toxic pharmaceutically acceptable excipient suitable for preparing tablets. These excipients may be, for example, inactive diluents such as sodium carbonate or calcium carbonate, lactose, calcium phosphate or sodium phosphate; granulating agents and disintegrants such as corn starch or alginic acid; binders such as starch, gelatin or gum arabic; and lubricants such as magnesium stearate, stearic acid or talc. Tablets may be uncoated or coated by known techniques including microencapsulation to delay disintegration and absorption in the gastrointestinal tract, thereby providing a sustained action over a longer period of time. For example, a time-delaying agent such as glyceryl monostearate or glyceryl distearate may be used alone or with a wax.

[0205] In certain embodiments, the pharmaceutical compositions of the present disclosure are administered to a subject, for example, orally, intracavitarily, intradermally, intramuscularly, intrathecally, intravenously, subcutaneously, or intraventricularly.

[0206] IV. Bioassay

[0207] This specification describes a method for selecting compounds useful for the present invention.

[0208] In one aspect, the compounds of the invention are selected based on their ability to interact with HDAC. In one embodiment, the HDAC is HDAC4. In another embodiment, the binding of the compound to HDAC is determined by surface plasmon resonance identification. In one embodiment, the compound is BnH12001 or an enantiomer thereof.

[0209] In one aspect, the compound is selected based on its ability to increase the expression of BDNF and / or GluN2B in the targeted neurons. In one aspect, the compound is selected based on its ability to increase the expression of BDNF in the targeted neurons. In another embodiment, the compound is selected based on its ability to increase the expression of GluN2B in the targeted neurons. In one embodiment, RT-PCR is used to determine the expression level. In one embodiment, the compound is selected from the group consisting of BnH12001 or its enantiomer, BnH12005, BnH12006, BnH12007, BnH12009, BnH12010, BnH12016, BnH12018, BnH12025, BnH12038, BnH12039, BnH12060, BnH12061, BnH12063, BnH12065, BnH12068, BnH12069, BnH12070, BnH12073, BnH12074, BnH12079 and BnH12096. Preferably, the compound is BnH12001 or its enantiomer.

[0210] In one aspect, the compounds of the present invention are selected based on their non-toxicity to human cells. In one embodiment, the compounds of the present invention are selected based on their lack of significant effect on the cell viability of the human cell line SH-SY5Y. In another embodiment, the compounds of the present invention are selected based on their lack of significant effect on the cell viability of the human cell line 293T. In one embodiment, the compound does not reduce the cell viability of SH-SY5Y or 293 at a concentration of about 0.1, 1, 10, 100 μM. In one embodiment, the compound can be one of the compounds shown in Table 5. Preferably, the compound is BnH12001 or an enantiomer thereof.

[0211] In one aspect, the compounds of the invention are selected based on their ability to increase potency when measured by TC EPSC potency in rodent barrel cortex (layer 4). In one embodiment, the compound increases potency measured at a concentration of about 0.1 to about 5 μM when delivered by intraventricular injection via an Os pump. In another embodiment, the concentration can be about 0.1 to about 3 μM. In another embodiment, the concentration can be about 3 μM. In another embodiment, the concentration is about 0.03, 0.1, 0.3, 1, 3 or 10 mg / kg. In one embodiment, the compound is BnH12001 or its enantiomer.

[0212] Detailed examples of useful methods for selecting compounds of the present invention are described throughout this specification.

[0213] V. Therapeutic Uses of Compounds

[0214] The compounds of the present invention can be useful when inhibiting at least one HDAC type. On the one hand, the compounds described in this specification can be useful in treatment, because it is known that specific HDACs are involved in biological pathways for controlling higher brain functions. Therefore, the compounds described in this application can be useful when brain lesions are related to HDAC or HDAC-mediated.

[0215] Recent reports have detailed the importance of histone acetylation in central nervous system (CNS) functions such as neuronal differentiation, memory formation, drug addiction, and depression (Citrome, Psychopharmacol. Bull. 2003, 37, Suppl. 2, 74-88; Johannessen, CNS Drug Rev. 2003, 9, 199-216; Tsankova et al., 2006, Nat. Neurosci. 9, 519-525).

[0216] A neurotic disorder is a condition characterized by dysfunction of the central or peripheral nervous system. Neurotic disorders may result from developmental abnormalities, disease, genetic defects, injury, or toxins that cause disturbances in the structure or function of the nervous system. These disorders may affect the central nervous system (e.g., the cerebrum, brainstem, and cerebellum), the peripheral nervous system (e.g., cranial nerves, spinal nerves, sympathetic nervous system, and parasympathetic nervous system), and / or the autonomic nervous system (e.g., the part of the nervous system that regulates involuntary behavior, divided into the sympathetic and parasympathetic nervous systems).

[0217] Therefore, the present specification provides a method for treating or preventing an HDAC-mediated neurotic disorder or neurodegenerative disorder in a subject in need of treatment or prevention, comprising administering to the subject a therapeutically effective amount of at least one compound described in the present specification. In some embodiments, the compound described in the present specification can be used to regulate the activity of Class IIa HDAC. In some embodiments, the compound is an inhibitor of HDAC4.

[0218] Most neurodegenerative disorders are caused by degeneration of brain neurons. Neurons containing HDAC4 are widely distributed in the brain (document [Mielcarek et al., 2013, PLoS Biol.11: e1001717]; document [Takase et al., 2013, PloS ONE 8: e58473]). Therefore, the therapeutic method of regulating HDAC4 activity in the brain of the present invention can be useful for any brain neurodegenerative disease, because the intervention mechanism envisioned in the present invention can target HDAC4 in neurons independently of the observed brain lesions. The compounds of the present invention are useful for any neurodegenerative disease. The compounds of the present invention are not subject to the current understanding of the molecular mechanism of HDAC4 in brain neurons. Thus, the compounds of the present invention can be useful for any chronic or acute neurodegenerative disease in which neurons express HDAC4 affected by the pathological manifestations of the disease.

[0219] Examples of chronic neurodegenerative disorders include: chronic neurodegenerative diseases such as familial and sporadic amyotrophic lateral sclerosis (FALS and ALS, respectively), familial and sporadic Parkinson's disease, Huntington's disease, familial and sporadic Alzheimer's disease, multiple sclerosis, muscular dystrophy, olivopontocerebellar atrophy, multiple system atrophy, Wilson's disease, progressive supranuclear palsy, diffuse Lewy body disease, corticodentatonigral degeneration, progressive familial myoclonic epilepsy, striatonigral degeneration, torsion springs, Transverse dystonia, familial tremor, Down syndrome, Tourette syndrome, Hallervorden-Spatz disease, diabetic peripheral neuropathy, dementia pugilistica, AIDS dementia, age-related dementia, age-related memory impairment, and amyloidosis-related neurodegenerative diseases, such as those caused by prion protein (PrP) associated with transmissible spongiform encephalopathies (CJD, Gerstmann syndrome, scrapie, and kuru) and those caused by excess cystatin C accumulation (hereditary cystatin C angiopathy). Examples of acute neurodegenerative disorders include: traumatic brain injury (e.g., surgery-related brain injury), cerebral edema, peripheral nerve injury, spinal cord injury, Leigh's disease, Guillain-Barré syndrome, lysosomal storage diseases, such as lipofuscin deposition, Alpers' disease, restless legs syndrome, vertigo caused by CNS degeneration; pathology caused by, for example, long-term alcohol or drug abuse, including degeneration of the locus coeruleus, cerebellar neurons, drug-induced movement disorders; pathology caused by aging, including degeneration of cerebellar neurons and cortical neurons leading to cognitive and movement disorders; and pathology caused by chronic amphetamine abuse, including degeneration of basal ganglia neurons leading to movement disorders; pathological changes caused by local trauma such as stroke, ischemic lesions, premature vascular aging, hypoxic-ischemic encephalopathy, hyperglycemia, hypoglycemia or direct trauma; pathology caused by negative side effects of therapeutic drugs and treatment methods (e.g., degeneration of target and entorhinal cortical neurons in response to anticonvulsant doses of NMD A antagonists of glutamate receptors) and Wernicke-Korsakoff syndrome.

[0220] In addition to acute or chronic degenerative disorders, the compounds of the present invention may also be useful for treating other types of brain diseases in which the affected neurons are partially regulated by HDAC4. Examples of these diseases include: neuropsychiatric diseases associated with cognition, dementia, social behavior, anxiety or other personality disorders, such as schizophrenia, delirium, attention deficit disorder (ADD), bipolar disorder, obsessive-compulsive disorder or eating disorders; fear and anxiety disorders, such as panic disorder, various phobias, post-traumatic stress disorder (PTSD), psychogenic erectile dysfunction or insomnia; various forms of addiction; and mood disorders such as depression.

[0221] The types of diseases that can benefit from the use of the compounds described in this specification are not limited to brain diseases. Any neurotic disorder in which the affected neurons are regulated by HDAC4 can benefit from the compounds of the present invention. As described in this specification, Alzheimer's disease and PTSD, although very different in pathology and known causes of the disease, both benefit from the treatment of the compounds described in this specification. With regard to Alzheimer's disease, the BnH12 series of compounds reduce the symptoms of the disease and improve memory. Examples of neurotic disorders that can benefit from the compounds of the present invention include: peripheral neurotic disorders due to degeneration or injury, such as ataxia or trauma; and acute or chronic degenerative diseases, such as glaucoma.

[0222] Memory loss or cognitive impairment may also benefit from treatment with the compounds of the invention, provided that the plasticity of the affected neurons is regulated in part by HDAC4. Examples of such disorders include conditions associated with cognitive function, such as memory loss / impairment, creative behavior, problem solving, and intuition.

[0223] Memory includes short-term memory (also called working memory or recent memory) and long-term memory. Short-term memory includes recent events, while long-term memory includes the recollection of events in the more distant past. Methods for assessing recall memory ability are known to those skilled in the art and may include routine cognitive experiments.

[0224] Age-related memory loss is characterized by objective memory loss in older subjects compared to when they were young, but cognitive test scores are within the normal range for the subject's age. As described in DSM-IV, the scores in the standardized diagnostic test for dementia in subjects with age-related memory loss are within the normal range. Moreover, DSM-IV provides separate diagnostic criteria for a condition named as age-related cognitive decline. Age-related memory loss can include decreased brain weight, gyral atrophy, ventricular dilatation, and selective loss of neurons in different brain regions. For some embodiments of the present invention, more progressive forms of memory loss are also included in the definition of age-related memory impairment. Therefore, people with memory loss and cognitive impairment exceeding normal age but scoring below the diagnostic threshold of Frank's dementia can be referred to as suffering from mild neurocognitive disorder, mild cognitive impairment, late-life amnesia, benign senescent amnesia, early dementia, temporary dementia, etc. These subjects may be more susceptible to Frank's dementia in their later years (also refer to U.S. Patent Application 2006 / 008517).

[0225] Symptoms associated with age-related memory loss include, but are not limited to, changes in brain-related biochemical markers such as IL-1β, IFN-γ, p-JNK, p-ERK, etc., which are manifested as a decline in long-term potentiation, decreased memory and learning ability, and decreased synaptic activity or function. In some implementations, the compounds of the present invention regulate the activity of IL-1β, IFN-γ, p-JNK or p-ERK.

[0226] Methods for enhancing memory may include reestablishing access to memory and memory recovery. The term "reestablishing access" as used in this specification refers to increasing the retrieval of memory. Although not limited by the mechanism of action, the compounds of the present invention can effectively increase the retrieval of memory by reestablishing the synaptic network. The process of reestablishing the synaptic network may include increasing the number of active brain synapses and / or reversing neuronal loss.

[0227] In some cases, learning is referred to as memory. Unlike memory enhancement, learning refers to the ability to form new memories that did not exist before. In some embodiments, in order for the experimental compound to affect the subject's ability to learn rather than recall old memories, at least one compound of the present invention is administered before or simultaneously with memory formation. In some embodiments, in order for the experimental compound to affect the ability to recall previously formed memories, at least one compound described in this specification is administered after memory formation, preferably after memory extinction.

[0228] In addition, a method for enhancing learning and memory formation in a subject suffering from memory loss is provided, comprising administering to the subject an effective amount of at least one compound described in the specification. The method is also useful for enhancing learning and memory formation in normal subjects.

[0229] Neurogenesis, or the birth of new nerve cells, is thought to occur only in developing organisms. However, recent studies have shown that neurogenesis has been confirmed to continue into adulthood and throughout adulthood. Ongoing neurogenesis is considered to be an important mechanism that enables organisms to adapt to environmental changes and affects learning and memory throughout the life process, becoming the basis of neural plasticity. In one aspect, the present invention includes a method for increasing the synaptic density of a subject, comprising administering a compound of the present invention or a pharmaceutically acceptable salt, hydrate, solvate or prodrug thereof to a subject in need of increasing synaptic density. In one aspect, the present invention includes a method for enhancing synaptic plasticity of a subject, comprising administering a compound of the present invention or a pharmaceutically acceptable salt, hydrate, solvate or prodrug thereof to a subject in need of enhancing synaptic plasticity. In one aspect, the present invention includes a method for increasing the density of dendrites of neurons in a subject, comprising administering a compound of the present invention or a pharmaceutically acceptable salt, hydrate, solvate or prodrug thereof to a subject in need of increasing the density of dendrites of neurons.

[0230] The present invention provides a method for enhancing the memory of a subject suffering from memory disorder. Examples of memory disorder types include Alzheimer's disease, absent-minded professor, amnesia, amnesia, anterograde amnesia, blackout (alcohol-related amnesia), bromine poisoning, childhood amnesia, false memory syndrome, fugue state, hyperthymesia, Korsakoff syndrome, intermittent amnesia, memory mistrust syndrome, amnesia, post-traumatic amnesia, prosopamnesia, psychogenic amnesia, repressed memory, retrograde amnesia, Ribot's Law, selective amnesia, source amnesia, source monitoring error, seven sins of memory, tip of the tongue, transient epileptic amnesia, transient global amnesia and twilight sleep.

[0231] In one embodiment, the memory disorder is Alzheimer's disease. The method optionally includes administering the inhibitor and monitoring the subject to confirm whether the previously lost memory is restored. The subject can be monitored by routine experiments known in the art.

[0232] In another embodiment, the Alzheimer's disease subject is a subject with late-stage Alzheimer's disease. Many compounds proposed for treating Alzheimer's disease are designed to treat the early stages of the disease by preventing plaque accumulation. The compounds of the present invention are useful for treating both the early and late stages of dementia because they improve memory and cognition, not just prevent plaque accumulation.

[0233] In one embodiment, the disease or disorder mediated by HDAC is cognitive dysfunction / injury. Therefore, a method for promoting cognitive function in a subject suffering from cognitive dysfunction / injury is also provided, comprising administering to the subject an effective amount of at least one compound described in this specification. The present invention also provides a method for promoting cognitive function in a normal subject.

[0234] In some cases, cognitive function is decreased by about 5%, about 10%, about 30% or more compared to cognitive function measured in age-matched normal subjects. Cognitive function can be improved to any detectable extent, and if it is a human, it is preferably sufficiently improved to enable the impaired subject to carry out daily activities of normal life.

[0235] Cognitive function can be assessed by one or more tests or examinations of cognitive function, which can be selectively defined as such. Non-limiting examples of tests or examinations of cognitive function include CANTAB (e.g., see [Fray et al., "CANTAB battery: proposed utility in neurotoxicology." Neurotoxicol Teratol 1996; 18(4): 499-504]), Stroop Test, Trail Making, Wechsler Digit Span, or CogState computerized cognitive test (see also [Dehaene et al., "Reward-dependent learning in neuronal networks for planning and decision making." Brain Res. 2000; 126: 217-29]; [Iverson et al., "Interpreting change on the WAIS-III / WMS-I11 in clinical samples." Arch Clin Neuropsychol. 2001; 16(2): 183-91]; and [Weaver et al., "Mild memory impairment in healthy older adults is distinct from normal aging." Cogn. 2006; 60(2): 146-55]). The method of the present invention can be used to promote cognitive function of normal subjects or treat, alleviate and / or prevent cognitive dysfunction in subjects. The normal subjects used in this specification refer to subjects who have not yet been diagnosed with diseases related to cognitive impairment.

[0236] In some embodiments, cognitive dysfunction or impairment is associated with, but not limited to, Alzheimer's disease, Huntington's disease, memory loss due to epilepsy, schizophrenia, Rubinstein-Taybi syndrome, Rett syndrome, Fragile X syndrome, dementia with Lewy bodies, vascular dementia, bipolar disorder, and social, cognitive and learning disabilities associated with autism spectrum disorder (ASD), attention deficit hyperactivity disorder (ADHD), dyslexia, learning disabilities, traumatic head injury, cognitive and motor impairment due to stroke, traumatic brain injury, cognitive impairment mediated by neurodegeneration and neuronal loss, and attention deficit disorder.

[0237] In some embodiments, cognitive dysfunction or impairment is associated with, but not limited to, anxiety disorders, conditioned fear responses, panic disorder, obsessive-compulsive disorder, post-traumatic stress disorder, phobias, social anxiety disorder, substance dependence recovery, or age-associated memory impairment (AAMI) and age-related cognitive decline (ARCD).

[0238] It has been confirmed that the administration of HDAC inhibitors sodium butyrate or trichostatin A can promote fear extinction in mice, which reflects the promotion caused by commonly used behavioral manipulations and is consistent with other studies demonstrating the role of the hippocampus in contextual fear extinction (literature [Lattal et al., 2007, Behav. Neurosci. 121, 5, 1125-1131]). In one embodiment, the HDAC-mediated disease or disorder is an extinction learning disorder, such as a fear extinction defect. Therefore, a method for treating or preventing extinction learning disorders in a subject suffering from extinction learning disorders is also provided, comprising administering to the subject an effective amount of at least one compound described in this specification.

[0239] The compounds of the present invention can be used to promote the psychological process of extinction learning, thereby being useful for treating, alleviating and / or preventing neuropsychiatric disorders and other related disorders. Unlike traditional antianxiety drugs that are administered chronically and target the physiological symptoms of anxiety, the compounds of the present invention can be used long-term or short-term with a second therapy (e.g., psychotherapy).

[0240] Although not thoroughly investigated in this specification, HDAC4 mediates gene expression in other cell types including immune cells. The compounds of the present invention are not constrained by the current understanding of the molecular mechanisms of HDAC4 in other types of cells found in immune cells or cancer. Thus, the compounds of the present invention may be useful for any disease, including: hyperproliferative diseases, such as malignant tumors of various origins; immune system diseases, such as autoimmune diseases, inflammation or allergies; infectious diseases; transplant rejection; and fibrotic diseases.

[0241] In some embodiments, the HDAC-mediated disease or disorder is an immune disorder that can be treated together with TNFα or other immunomodulators when a therapeutically effective amount of at least one compound described in this specification is administered to a subject. Therefore, a method for treating an HDAC-mediated immune disorder in a subject is also provided, comprising administering a therapeutically effective amount of at least one compound described in this specification to a subject who needs immune disorder treatment before / during treatment with TNFα or other immunomodulators or after treatment.

[0242] In some embodiments, HDAC-mediated disorders or disorders include the following disorders that can be treated by progenitor cell / stem cell-based therapies: disorders associated with diabetes (organ failure, cirrhosis, and hepatitis); central nervous system (CNS) disorders associated with brain progenitor cell dysregulation (e.g., PTSD); tumors (e.g., retinoblastoma); disorders affecting oligodendrocyte progenitor cells (e.g., astrocytomas and ependymal cell tumors); multiple sclerosis; demyelinating disorders such as leukodystrophy; neuropathy associated with white matter loss; cerebellar disorders such as ataxia; and olfactory precursor disorders (e.g., anosmia disorders). Therefore, a method for treating an HDAC-mediated disease in a subject is also provided, comprising administering to the subject a therapeutically effective amount of at least one compound described in this specification before, during, or after treatment with a progenitor cell / stem cell-based therapy.

[0243] In some embodiments, HDAC-mediated conditions or disorders include blood pressure disorders associated with nitric oxide (NO) regulation (e.g., hypertension, erectile dysfunction, asthma; and eye diseases such as glaucoma). Therefore, a method for treating HDAC-mediated blood pressure diseases associated with nitric oxide (NO) regulation in a subject is also provided, comprising administering a therapeutically effective amount of at least one compound described in this specification to a subject in need of treatment of a blood pressure disease associated with nitric oxide (NO) regulation.

[0244] In some embodiments, the condition or disorder is a cardiac hypertrophic disorder.Therefore, a method for treating HDAC-mediated cardiac hypertrophic disorder in a subject is also provided, comprising administering a therapeutically effective amount of at least one compound described in this specification to a subject in need of cardiac hypertrophic disorder treatment.

[0245] In some embodiments, HDAC-mediated diseases or disorders include blood disorders, such as thalassemia, anemia, and sickle cell anemia. Therefore, a method for treating HDAC-mediated blood disorders in a subject is also provided, comprising administering a therapeutically effective amount of at least one compound described in this specification to a subject in need of blood disorder treatment.

[0246] In some embodiments, HDAC-mediated diseases or disorders include metabolic diseases such as prediabetes or diabetes (type I or type II). Therefore, a method for treating a metabolic disease in a subject is also provided, comprising administering a therapeutically effective amount of at least one compound described in this specification to a subject who needs HDAC-mediated prediabetes or diabetes (type I or type II) and other metabolic diseases.

[0247] In one aspect, the present invention provides a pharmaceutical composition further comprising a second therapeutic agent for treating an HDAC-mediated disorder or condition in a subject suffering from an HDAC-mediated disorder or condition. In some embodiments, the second therapeutic agent is HDAC4, preferably, for treating an HDAC-mediated disease or condition.

[0248] Also provided is a method for treating an HDAC-mediated disease or disorder in a subject suffering from the HDAC-mediated disease or disorder, wherein at least one compound described in the present specification or a pharmaceutically acceptable salt thereof is administered to the subject in combination with one or more additional active agents.

[0249] In some embodiments, the second therapeutic agent is selected from the group consisting of donepezil, rivastigmine, galantamine, memantine, vilocitate, sulanizumab, bapizumab, aducanumab, lencanizumab, tigrelocibub, epothilone D, and ABBV-8E12.

[0250] In some embodiments, the second therapeutic agent is selected from the group consisting of a cholinesterase inhibitor, an NMDA receptor antagonist, a humanized antibody targeting tau protein, a humanized antibody targeting amyloid beta protein, and a BACE inhibitor.

[0251] Typical treatment methods included in the present invention include combination therapy. For example, the combination therapy can be drug therapy (i.e., the compound of the present invention) and behavioral therapy. Behavioral therapy includes, but is not limited to, electroconvulsive epilepsy therapy, exercise, group therapy, talk therapy, or conditioning. In another embodiment, behavioral therapy is cognitive behavioral therapy. The full content of examples of behavioral therapy that can be used for ongoing methods is, for example, recorded in the literature [Cognitive-Behavioral Therapies by K. Dobson, ed., Guilford Publications, Inc., 2002] and the literature [The new Handbook of Cognitive Therapy: Basics and Beyond by Judith SS Beck, Guilford Publications, Inc. 1995] as a reference to this specification. Any active pharmaceutical ingredient known to those skilled in the art to enhance learning or conditioned reflexes can be used in the method of the present invention. For example, a class of active pharmaceutical ingredients envisioned in this specification includes compounds that increase brain norepinephrine levels. Such compounds include compounds that act as norepinephrine reuptake inhibitors, such as atomoxetine, reboxetine, duloxetine, venlafaxine, and milnacipran, and compounds that cause norepinephrine release, such as amphetamine, dextroamphetamine, pemoline, and methylphenidate. Another class of active pharmaceutical ingredients are compounds that increase brain acetylcholine levels, such as compounds that prevent the breakdown of acetylcholine. Examples of such compounds include, but are not limited to, donepezil hydrochloride or Aricept, which inhibit cholinesterase activity. TM and tacrine.

[0252] The method for combined treatment may include subjecting the subject to one or more parts of a combined treatment regimen, wherein the combined treatment regimen includes acute administration of a therapeutically effective amount of a compound of the invention that enhances learning or regulation, combined with a psychotherapy component. In one aspect, treatment with the compound occurs within about 24 hours prior to the start of the psychotherapy component, preferably within about 12 hours prior to the start of the psychotherapy component, and more preferably within about 6 hours. The entire course of treatment of a neuropsychiatric disorder requires at least one part of this combined treatment regimen.

[0253] Hereinafter, a more detailed description will be given by the following examples. The following examples are provided to help understand the present invention, but are not intended to limit the scope of the present invention in any way and should not be interpreted as limiting.

[0254] For those skilled in the art, methods for obtaining the compounds described in the present specification or pharmaceutically acceptable salts thereof are obvious, and suitable steps are described in, for example, the following preparation examples and references cited in the present specification.

[0255] VI. Preparation of active compounds

[0256] The present invention provides methods for synthesizing the compounds of the present invention. The names and structures of the exemplified specific compounds are shown in Tables 2 to 4.

[0257] [Table 2]

[0258]

[0259]

[0260]

[0261]

[0262] [Table 3]

[0263]

[0264]

[0265]

[0266] [Table 4]

[0267]

[0268]

[0269]

[0270] For those skilled in the art, methods for obtaining the compounds described in this specification, their stereoisomers or pharmaceutically acceptable salts thereof are obvious, for example, suitable steps are described in the following preparation examples, examples and references cited in this specification.

[0271] Preparation Example

[0272] Preparation Example 1. Preparation of active compounds according to representative reaction formula 1

[0273] [Reaction 1]

[0274]

[0275]

[0276]

[0277] (1) Synthesis of compound BnH12001 enantiomer (3R, 6S, 98%<)

[0278] (3R,6S)-1-(2-(2-chloro-4-fluorophenyl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0279] Step 1: Synthesis of methyl (3R,6S)-1-(2-(2-chloro-4-fluorophenyl)acetyl)-6-methylpiperidine-3-carboxylate (Compound BnH12020)

[0280] To a solution of 2-chloro-4-fluorophenylacetic acid (2.22 g, 11.8 mmol) in (40.0 mL) DMF were added (3R, 6S)-rel-6-methyl-3-piperidinecarboxylic acid methyl ester (1.94 g, 12.4 mmol), DIPEA (3.08 mL, 17.7 mmol), HOBt (1.91 g, 14.1 mmol) and EDC·HCl (2.19 g, 14.1 mmol). The mixture was stirred at room temperature for 3.5 hours. The mixture was diluted with EtOAc (40.0 mL) and washed with saturated NH4Cl aqueous solution (40.0 mL) and brine (40.0 ml). The organic layer was dried over MgSO4, filtered and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 3:1 to 2:1) to give the desired compound (3.28 g, 85%) as a colorless oil.

[0281] 1 H NMR (400MHz, Chloroform-d) δ7.14 (dd, J=8.5, 2.6Hz, 1H), 6.96 (td, J=8.3, 2.6Hz, 1H ), 4.97 (s, 0.5H), 4.80 (d, J = 13.8Hz, 0.5H), 4.16 (s, 0.5H), 3.90 (d, J = 13.9Hz, 0.5H), 3.82–3.71(m, 2H), 3.24(t, J=13.1Hz, 0.5H), 2.81(t, J=12.9Hz, 0.5H), 2.38(d, J=35 .9Hz, 1H), 1.98 (d, J=13.2Hz, 1H), 1.90–1.75 (m, 1H), 1.64 (s, 2H), 1.28–1.16 (m, 3H).

[0282] Step 2: Synthesis of compound BnH12001 enantiomer (3S, 6R)

[0283] 1N NaOH (14.6 mL, 14.6 mmol) was added to a solution of (3R,6S)-1-(2-(2-chloro-4-fluorophenyl)acetyl)-6-methylpiperidine-3-carboxylic acid methyl ester (3.20 g, 9.76 mmol) in THF (33.7 mL). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with H2O (15.0 mL) and washed twice with DCM (30.0 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (30.0 mL). The organic layer was washed with brine (30.0 mL), dried over MgSO4, filtered, and concentrated under reduced pressure. Et2O (30.0 mL) was added to the residue and stirred at room temperature for 1 hour. The precipitate was filtered and washed with Et2O (10.0 mL) to give the enantiomer of compound BnH12001 (3S, 6R) (2.75 g, 89%) as a white solid.

[0284] 1 H NMR (400MHz, DMSO-d6) δ12.44 (s, 1H), 7.40 (dd, J=8.9, 2.6Hz, 1H), 7.34 (dt, J=15.2, 7.6Hz, 1H), 7. 16 (td, J=8.5, 2.7Hz, 1H), 4.70 (s, 0.5H), 4.49 (d, J=13.5Hz, 0.5H), 4.27 (s, 0.5H), 3.97-3.81 (m, 1H ), 3.81-3.68(m, 1.5H), 3.14(t, J=12.8Hz, 0.5H), 2.64(t, J=12.6Hz, 0.5H), 2.40-2.31(m, 0.5H), 2 .21 (s, 0.5H), 1.84 (d, J=12.2Hz, 1H), 1.76-1.60 (m, 2H), 1.55 (s, 1H), 1.14 (dd, J=56.8, 6.9Hz, 3H).

[0285] (2) Synthesis of compound BnH12006

[0286] (3R,6S)-1-(2-cyclohexylacetyl)-6-methylpiperidine-3-carboxylic acid

[0287] Step 1: Synthesis of methyl (3R,6S)-1-(2-cyclohexylacetyl)-6-methylpiperidine-3-carboxylate

[0288] To a solution of cyclohexyl acetic acid (100 mg, 0.703 mmol) in DMF (2.34 mL) were added (3R, 6S)-rel-6-methyl-3-piperidinecarboxylic acid methyl ester (116 mg, 0.738 mmol), DIPEA (0.184 mL, 1.06 mmol), HOBt (114 mg, 0.844 mmol) and EDC·HCl (131 mg, 0.844 mmol). The mixture was stirred at room temperature for 18 hours. The mixture was diluted with EtOAc (4.00 mL) and washed with saturated NH4Cl aqueous solution (4.00 mL) and brine (4.00 ml). The organic layer was dried over MgSO4, filtered and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 3:1 to 2:1) to obtain the desired compound (147 mg, 74%) as a colorless oil.

[0289] Step 2: Synthesis of compound BnH12006

[0290] 1N NaOH (0.784 mL, 0.784 mmol) was added to a solution of (3R, 6S)-1-(2-cyclohexylacetyl)-6-methylpiperidine-3-carboxylic acid methyl ester (147 mg, 0.522 mmol) in THF (1.80 mL). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with H2O (2.00 mL) and washed twice with DCM (30.0 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (30.0 mL). The organic layer was washed with brine (3.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (DCM: MeOH = 95: 5 to 90: 10) to give a white solid compound BnH12006 (102 mg, 73%).

[0291] 1 H NMR (400MHz, Chloroform-d) δ4.99 (s, 0.5H), 4.81 (s, 0.5H), 4.19 (s, 0.5H), 3.91 (s, 0.5H), 3.22 (s, 0.5H), 2.75 (s, 0.5H), 2.48-2.36(m, 1H), 2.22(s, 2H), 1.98(s, 1H), 1.90-1.58(m, 11H), 1.34-1.05(m, 8H), 0.96(d, J=12.0Hz, 2H).

[0292] ( 3) Synthesis of compound BnH12007

[0293] (3R,6S)-6-Methyl-1-(2-phenylacetyl)piperidine-3-carboxylic acid

[0294] Step 1: Synthesis of methyl (3R,6S)-6-methyl-1-(2-phenylacetyl)piperidine-3-carboxylate

[0295] To a solution of phenylacetic acid (100 mg, 0.734 mmol) in DMF (2.45 mL) were added (3R, 6S)-rel-6-methyl-3-piperidinecarboxylic acid methyl ester (121 mg, 0.771 mmol), DIPEA (0.192 mL, 1.10 mmol), HOBt (119 mg, 0.881 mmol) and EDC·HCl (137 mg, 0.881 mmol). The mixture was stirred at room temperature for 18 hours. The mixture was diluted with EtOAc (4.00 mL) and washed with saturated NH4Cl aqueous solution (4.00 mL) and brine (4.00 ml). The organic layer was dried over MgSO4, filtered and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 3:1 to 2:1) to obtain the desired compound (135 mg, 66%) as a colorless oil.

[0296] Step 2: Synthesis of compound BnH12007

[0297] 1N NaOH (0.735 mL, 0.735 mmol) was added to a solution of (3R, 6S)-6-methyl-1-(2-phenylacetyl)piperidine-3-carboxylic acid methyl ester (135 mg, 0.490 mmol) in THF (1.69 mL). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with H2O (2.00 mL) and washed twice with DCM (30.0 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (30.0 mL). The organic layer was washed with brine (3.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (DCM: MeOH = 95: 5 to 90: 10) to give a white solid compound BnH12007 (105 mg, 82%).

[0298] 1H NMR (400MHz, Chloroform-d) δ7.32 (t, J=7.5Hz, 2H), 7.28-7.20 (m, 3H), 4.97 (s, 0.5 H), 4.82 (d, J = 13.7Hz, 0.5H), 4.17 (s, 0.5H), 3.91 (d, J = 13.7Hz, 0.5H), 3.76 (s, 2H), 3.12 (t, J=12.9Hz, 0.5H), 2.77 (t, J=12.7Hz, 0.5H), 2.39 (s, 0.5H), 2.05 (s, 0.5H), 1 .90 (d, J=13.2Hz, 1H), 1.77 (d, J=14.3Hz, 1H), 1.66-1.36 (m, 2H), 1.17-1.06 (m, 3H).

[0299] (4) Synthesis of compound BnH12008

[0300] (3R,6S)-6-Methyl-1-propionylpiperidine-3-carboxylic acid

[0301] Step 1: Synthesis of methyl (3R,6S)-6-methyl-1-propionylpiperidine-3-carboxylate

[0302] To a solution of propionic acid (0.051 mL, 0.675 mmol) in DMF (2.25 mL) was added (3R, 6S)-rel-6-methyl-3-piperidinecarboxylic acid methyl ester (111 mg, 0.709 mmol), DIPEA (0.178 mL, 1.01 mmol), HOBt (109 mg, 0.810 mmol) and EDC·HCl (126 mg, 0.810 mmol). The mixture was stirred at room temperature for 18 hours. The mixture was diluted with EtOAc (4.00 mL) and washed with saturated NH4Cl aqueous solution (4.00 mL) and brine (4.00 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 3:1 to 2:1) to obtain the desired compound (83 mg, 57%) as a colorless oil.

[0303] Step 2: Synthesis of compound BnH12008

[0304] 1N NaOH (0.563 mL, 0.563 mmol) was added to a solution of (3R, 6S)-6-methyl-1-propionylpiperidine-3-carboxylic acid methyl ester (80.0 mg, 0.375 mmol) in THF (1.29 mL). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with H2O (2.00 mL) and washed twice with DCM (30.0 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (30.0 mL). The organic layer was washed with brine (3.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (DCM: MeOH = 95: 5 to 90: 10) to give a white solid compound BnH12008 (43.0 mg, 57%).

[0305] 1 H NMR (400MHz, Chloroform-d) δ4.96 (s, 0.5H), 4.81 (s, 0.5H), 4.17 (s, 0.5H), 3.89 (s, 0.5H), 3.22 (s, 0.5H), 2.77 ( s, 0.5H), 2.50-2.28 (m, 4H), 2.00 (d, J=13.6Hz, 1H), 1.84 (qd, J=12.1, 5.5Hz, 2H), 1.67 (s, 3H), 1.30-1.06 (m, 9H).

[0306] (5) Synthesis of compound BnH12011

[0307] (3R,6S)-1-(2-Chloro-4-fluorobenzoyl)-6-methylpiperidine-3-carboxylic acid

[0308] Step 1: Synthesis of methyl (3R,6S)-1-(2-chloro-4-fluorobenzoyl)-6-methylpiperidine-3-carboxylate

[0309] To a solution of 2-chloro-4-fluorobenzoic acid (100 mg, 0.573 mmol) in DMF (1.91 mL) were added (3R, 6S)-rel-6-methyl-3-piperidinecarboxylic acid methyl ester (94.6 mg, 0.602 mmol), DIPEA (0.150 mL, 0.859 mmol), HOBt (92.9 mg, 0.687 mmol) and EDC·HCl (107 mg, 0.687 mmol). The mixture was stirred at room temperature for 18 hours. The mixture was diluted with EtOAc (3.00 mL) and washed with saturated NH4Cl aqueous solution (3.00 mL) and brine (3.00 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 2:1) to obtain the desired compound (123 mg, 71%) as a colorless oil.

[0310] Step 2: Synthesis of compound BnH12011

[0311] 1N NaOH (0.588 mL, 0.588 mmol) was added to a solution of (3R, 6S)-1-(2-chloro-4-fluorobenzoyl)-6-methylpiperidine-3-carboxylic acid methyl ester (123.0 mg, 0.392 mmol) in THF (1.35 mL). The mixture was stirred for 2 hours at room temperature. The mixture was diluted with H2O (2.00 mL) and washed twice with DCM (30.0 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (30.0 mL). The organic layer was washed with brine (3.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to obtain a white solid compound BnH12011 (87.0 mg, 74%).

[0312] 1 H NMR (400MHz, Chloroform-d) δ7.22 (s, 1H), 7.20-7.11 (m, 1H), 7.04 (td, J=8.3, 2.5Hz, 1H), 5.10(s, 0.5H), 4.92(d, J=12.9Hz, 0.5H), 3.69(s, 0.5H), 3.44-3.28(m, 1H), 3.17( s, 0.5H), 2.99 (dt, J=26.2, 12.9Hz, 0.5H), 2.71-2.52 (m, 1H), 2.35 (d, J=6.7Hz, 0.5H) , 2.04 (d, J=11.9Hz, 1H), 1.93-1.69 (m, 2H), 1.60 (d, J=11.8Hz, 1H), 1.32-1.14 (m, 3H).

[0313] (6) Synthesis of compound BnH12023

[0314] (3R,6S)-1-(2-(4-chlorophenyl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0315] Step 1: Synthesis of methyl (3R,6S)-1-(2-(4-chlorophenyl)acetyl)-6-methylpiperidine-3-carboxylate

[0316] To a solution of 2-(4-chlorophenyl)acetic acid (100 mg, 0.586 mmol) in DMF (3.00 mL) were added (3R, 6S)-rel-6-methyl-3-piperidinecarboxylic acid methyl ester (96.8 mg, 0.616 mmol), DIPEA (0.153 mL, 0.879 mmol), HOBt (95.1 mg, 0.703 mmol) and EDC·HCl (109 mg, 0.703 mmol). The mixture was stirred at room temperature for 3.5 hours. The mixture was diluted with EtOAc (5.00 mL) and washed with saturated NH4Cl aqueous solution (5.00 mL) and brine (5.00 mL). The organic layer was dried over MgSO4, filtered and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 2:1) to obtain the desired compound (81.5 mg, 44%) as a light yellow oil.

[0317] Step 2: Synthesis of compound BnH12023

[0318] 1N NaOH (0.339 mL, 0.339 mmol) was added to a solution of (3R, 6S)-1-(2-(4-chlorophenyl)acetyl)-6-methylpiperidine-3-carboxylic acid methyl ester (70.0 mg, 0.226 mmol) in THF (1.00 mL). The mixture was stirred for 2 hours at room temperature. The mixture was diluted with H2O (5.00 mL) and washed twice with DCM (5.00 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (5.00 mL). The organic layer was washed with brine (5.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to give a white solid compound BnH12023 (57.0 mg, 85%).

[0319] 1H NMR (400MHz, DMSO-d6) δ12.38 (s, 1H), 7.36 (d, J=7.9Hz, 2H), 7.23 (dd, J=18.1, 8.1Hz, 2H), 4.7 2 (s, 0.5H), 4.51 (dd, J=13.3, 4.2Hz, 0.5H), 4.23 (s, 0.5H), 3.87 (d, J=13.6Hz, 0.5H), 3.74 (q, J=12.6, 9.6Hz, 2H), 3.02 (t, J=12.9Hz, 0.5H), 2.60 (t, J=12.8Hz, 0.5H), 2.17 (tt, J=11.9, 4.3 Hz, 1H), 1.81-1.77 (m, 1H), 1.70-1.60 (m, 3H), 1.51-1.48 (m, 2H), 1.05 (dd, J=12.5, 6.8Hz, 3H).

[0320] (7) Synthesis of compound BnH12024

[0321] (3R,6S)-6-Methyl-1-(2-(p-methylphenyl)acetyl)piperidine-3-carboxylic acid

[0322] Step 1: Synthesis of methyl (3R,6S)-6-methyl-1-(2-(p-tolyl)acetyl)piperidine-3-carboxylate

[0323] To a solution of p-tolueneacetic acid (100 mg, 0.666 mmol) in DMF (2.22 mL) was added (3R, 6S)-rel-6-methyl-3-piperidinecarboxylic acid methyl ester (110 mg, 0.699 mmol), DIPEA (0.174 mL, 0.999 mmol), HOBt (108 mg, 0.799 mmol) and EDC·HCl (124 mg, 0.799 mmol). The mixture was stirred at room temperature for 18 hours. The mixture was diluted with EtOAc (4.00 mL) and washed with saturated NH4Cl aqueous solution (4.00 mL) and brine (4.00 ml). The organic layer was dried over MgSO4, filtered and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 2:1 to 1:1) to obtain the desired compound (156 mg, 85%) as a colorless oil.

[0324] Step 2: Synthesis of compound BnH12024

[0325] 1N NaOH (0.809 mL, 0.809 mmol) was added to a solution of (3R, 6S)-6-methyl-1-(2-(p-tolyl)acetyl)piperidine-3-carboxylic acid methyl ester (156 mg, 0.539 mmol) in THF (1.86 mL). The mixture was stirred for 2 hours at room temperature. The mixture was diluted with H2O (1.50 mL) and washed twice with DCM (30.0 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (30.0 mL). The organic layer was washed with brine (3.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to give a white solid compound BnH12024 (135 mg, 90%).

[0326] 1 H NMR (400MHz, Chloroform-d) δ7.26 (s, 1H), 7.12 (s, 2H), 4.96 (s, 0.5H), 4.81 (d, J=13.7 Hz, 0.5H), 4.17 (s, 0.5H), 3.91 (d, J = 14.0Hz, 0.5H), 3.71 (s, 2H), 3.11 (t, J = 12.9Hz, 0.5 H), 2.76 (t, J=12.8Hz, 0.5H), 2.38 (s, 0.5H), 2.32 (s, 3H), 2.09 (d, J=9.0Hz, 0.5H), 1.9 0 (dd, J=13.2, 4.0Hz, 1H), 1.77 (d, J=13.5Hz, 1H), 1.67-1.34 (m, 2H), 1.14-1.03 (m, 3H).

[0327] (8) Synthesis of compound BnH12025

[0328] (3R,6S)-1-(2-(4-methoxyphenyl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0329] Step 1: Synthesis of methyl (3R,6S)-1-(2-(4-methoxyphenyl)acetyl)-6-methylpiperidine-3-carboxylate

[0330] To a solution of 4-methoxyphenylacetic acid (100 mg, 0.602 mmol) in DMF (2.01 mL) were added (3R, 6S)-rel-6-methyl-3-piperidinecarboxylic acid methyl ester (99.3 mg, 0.632 mmol), DIPEA (0.157 mL, 0.903 mmol), HOBt (97.6 mg, 0.722 mmol) and EDC·HCl (112 mg, 0.722 mmol). The mixture was stirred at room temperature for 18 hours. The mixture was diluted with EtOAc (4.00 mL) and washed with saturated NH4Cl aqueous solution (4.00 mL) and brine (4.00 ml). The organic layer was dried over MgSO4, filtered and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 2:1 to 1:1) to obtain the desired compound (147 mg, 80%) as a colorless oil.

[0331] Step 2: Synthesis of compound BnH12025

[0332] 1N NaOH (0.712 mL, 0.712 mmol) was added to a solution of (3R, 6S)-1-(2-(4-methoxyphenyl)acetyl)-6-methylpiperidine-3-carboxylic acid methyl ester (145 mg, 0.475 mmol) in THF (1.64 mL). The mixture was stirred for 2 hours at room temperature. The mixture was diluted with H2O (1.50 mL) and washed twice with DCM (30.0 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (30.0 mL). The organic layer was washed with brine (3.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to give a white solid compound BnH12025 (114 mg, 82%).

[0333] 1 H NMR (400MHz, Chloroform-d) δ7.19-7.12 (m, 2H), 6.85 (d, J=8.3Hz, 2H), 4.96 (s, 0.5H), 4.80 (d , J=13.7Hz, 0.5H), 4.17 (s, 0.5H), 3.92 (d, J=14.0Hz, 0.5H), 3.79 (s, 3H), 3.69 (s, 2H), 3.12 (t, J=12.9Hz, 0.5H), 2.77 (t, J=12.8Hz, 0.5H), 2.36 (d, J=13.1Hz, 0.5H), 2.09 (d, J=7.1Hz, 0.5H), 1.90 (dd, J=13.5, 3.9Hz, 1H), 1.77 (q, J=12.5Hz, 1H), 1.64-1.38 (m, 2H), 1.12 (t, J=8.2Hz, 3H).

[0334] (9) Synthesis of compound BnH12026

[0335] (3R,6S)-1-(2-(3-chlorophenyl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0336] Step 1: Synthesis of methyl (3R,6S)-1-(2-(3-chlorophenyl)acetyl)-6-methylpiperidine-3-carboxylate

[0337] To a solution of 2-(3-chlorophenyl)acetic acid (100 mg, 0.586 mmol) in DMF (3.00 mL) were added (3R, 6S)-rel-6-methyl-3-piperidinecarboxylic acid methyl ester (96.8 mg, 0.616 mmol), DIPEA (0.153 mL, 0.879 mmol), HOBt (95.1 mg, 0.703 mmol) and EDC·HCl (109 mg, 0.703 mmol). The mixture was stirred at room temperature for 3.5 hours. The mixture was diluted with EtOAc (5.00 mL) and washed with saturated NH4Cl aqueous solution (5.00 mL) and brine (5.00 mL). The organic layer was dried over MgSO4, filtered and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 2:1) to obtain the desired compound (123 mg, 67%) as a light yellow oil.

[0338] Step 2: Synthesis of compound BnH12026

[0339] 1N NaOH (0.484 mL, 0.484 mmol) was added to a solution of (3R, 6S)-1-(2-(3-chlorophenyl)acetyl)-6-methylpiperidine-3-carboxylic acid methyl ester (100 mg, 0.323 mmol) in THF (1.50 mL). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with H2O (5.00 mL) and washed twice with DCM (5.00 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (5.00 mL). The organic layer was washed with brine (5.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to obtain a white solid compound BnH12026 (73.8 mg, 77%).

[0340] 1H NMR (400MHz, DMSO-d6) δ12.42 (s, 1H), 7.32 (dt, J=17.1, 8.8Hz, 3H), 7.18 (dd, J=17.6, 7.3Hz, 1 H), 4.73 (s, 0.5H), 4.52 (d, J = 13.4Hz, 0.5H), 4.25 (s, 0.5H), 3.90 (d, J = 14.0Hz, 0.5H), 3.77 (q , J=13.0, 10.3Hz, 2H), 3.04 (t, J=13.1Hz, 0.5H), 2.62 (t, J=12.8Hz, 0.5H), 2.18 (t, J=13.1Hz, 1H), 1.81 (d, J=12.7Hz, 1H), 1.67 (d, J=12.8Hz, 1H), 1.53 (s, 2H), 1.07 (dd, J=15.6, 7.1Hz, 3H).

[0341] (10) Synthesis of compound BnH12027

[0342] (3R,6S)-1-(2-(2-chlorophenyl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0343] Step 1: Synthesis of methyl (3R,6S)-1-(2-(2-chlorophenyl)acetyl)-6-methylpiperidine-3-carboxylate

[0344] To a solution of 2-chlorophenylacetic acid (100 mg, 0.586 mmol) in DMF (1.95 mL) were added (3R, 6S)-rel-6-methyl-3-piperidinecarboxylic acid methyl ester (96.8 mg, 0.616 mmol), DIPEA (0.153 mL, 0.879 mmol), HOBt (95.1 mg, 0.703 mmol) and EDC·HCl (109 mg, 0.703 mmol). The mixture was stirred at room temperature for 18 hours. The mixture was diluted with EtOAc (3.00 mL) and washed with saturated NH4Cl aqueous solution (3.00 mL) and brine (3.00 ml). The organic layer was dried over MgSO4, filtered and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 2:1 to 1:1) to obtain the desired compound (148 mg, 85%) as a colorless oil.

[0345] Step 2: Synthesis of compound BnH12027

[0346] 1N NaOH (0.702 mL, 0.702 mmol) was added to a solution of (3R, 6S)-1-(2-(2-chlorophenyl)acetyl)-6-methylpiperidine-3-carboxylic acid methyl ester (145 mg, 0.468 mmol) in THF (1.61 mL). The mixture was stirred for 2 hours at room temperature. The mixture was diluted with H2O (1.50 mL) and washed twice with DCM (30.0 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (30.0 mL). The organic layer was washed with brine (3.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to give a white solid compound BnH12027 (122 mg, 88%).

[0347] 1 H NMR (400MHz, Chloroform-d) δ7.38 (dd, J=7.0, 2.3Hz, 1H), 7.29 (s, 1H), 7.21 (ddd, J=9.7, 6. 7, 2.4Hz, 2H), 4.98 (s, 0.5H), 4.82 (d, J=13.8Hz, 0.5H), 4.13 (s, 0.5H), 3.86 (dd, J=20.1, 13. 7Hz, 2.5H), 3.21 (t, J=12.9Hz, 0.5H), 2.81 (t, J=12.8Hz, 0.5H), 2.42 (s, 0.5H), 2.28 (s, 0.5H ), 1.99-1.91 (m, 1H), 1.82 (dd, J=13.1, 6.6Hz, 1H), 1.72-1.51 (m, 2H), 1.18 (t, J=6.7Hz, 3H).

[0348] (11) Synthesis of compound BnH12028

[0349] (3R,6S)-1-(2-(3,4-dichlorophenyl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0350] Step 1: Synthesis of methyl (3R,6S)-1-(2-(3,4-dichlorophenyl)acetyl)-6-methylpiperidine-3-carboxylate

[0351] To a solution of 2-(3,4-dichlorophenyl)acetic acid (100 mg, 0.488 mmol) in DMF (3.00 mL) were added (3R,6S)-rel-6-methyl-3-piperidinecarboxylic acid methyl ester (80.5 mg, 0.512 mmol), DIPEA (0.127 mL, 0.732 mmol), HOBt (79.1 mg, 0.585 mmol) and EDC·HCl (90.9 mg, 0.585 mmol). The mixture was stirred overnight at room temperature. The mixture was diluted with EtOAc (5.00 mL) and washed with saturated NH4Cl aqueous solution (5.00 mL) and brine (5.00 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 2:1) to obtain the desired compound (120 mg, 71%) as a gray oil.

[0352] Step 2: Synthesis of compound BnH12028

[0353] 1N NaOH (0.479 mL, 0.479 mmol) was added to a solution of (3R, 6S)-1-(2-(3,4-dichlorophenyl)acetyl)-6-methylpiperidine-3-carboxylic acid methyl ester (110 mg, 0.320 mmol) in THF (2.00 mL). The mixture was stirred for 2 hours at room temperature. The mixture was diluted with H2O (5.00 mL) and washed twice with DCM (5.00 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (5.00 mL). The organic layer was washed with brine (5.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to give a white solid compound BnH12028 (103 mg, 97%).

[0354] 1 H NMR (400MHz, DMSO-d6) δ12.41 (s, 1H), 7.56-7.46 (m, 2H), 7.23-7.19 (m, 1H), 4.71 (s, 0. 5H), 4.50 (dd, J=13.5, 4.3Hz, 0.5H), 4.25 (s, 0.5H), 3.89 (dd, J=14.4, 4.1Hz, 0.5H), 3. 84-3.69 (m, 2H), 3.06 (t, J=12.9Hz, 0.5H), 2.62 (t, J=12.8Hz, 0.5H), 2.28-2.16 (m, 1H) , 1.83-1.78 (m, 1H), 1.72-1.62 (m, 1H) 1.57-1.50 (m, 2H), 1.09 (dd, J=28.9, 6.9Hz, 3H).

[0355] (12) Synthesis of compound BnH12029

[0356] (3R,6S)-1-(2-(4-(tert-butyl)phenyl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0357] Step 1: Synthesis of methyl (3R,6S)-1-(2-(4-(tert-butyl)phenyl)acetyl)-6-methylpiperidine-3-carboxylate

[0358] To a solution of 2-(4-(tert-butyl)phenyl)acetic acid (100 mg, 0.520 mmol) in DMF (3.00 mL) were added (3R,6S)-rel-6-methyl-3-piperidinecarboxylic acid methyl ester (85.9 mg, 0.546 mmol), DIPEA (0.136 mL, 0.780 mmol), HOBt (84.3 mg, 0.624 mmol) and EDC·HCl (96.9 mg, 0.624 mmol). The mixture was stirred at room temperature for 3.5 hours. The mixture was diluted with EtOAc (5.00 mL) and washed with saturated NH4Cl aqueous solution (5.00 mL) and brine (5.00 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 2:1) to obtain the desired compound (114 mg, 66%) as a yellow oil.

[0359] Step 2: Synthesis of compound BnH12029

[0360] To a solution of (3R,6S)-1-(2-(4-(tert-butyl)phenyl)acetyl)-6-methylpiperidine-3-carboxylic acid methyl ester (95.0 mg, 0.287 mmol) in THF (2.00 mL) was added 1N NaOH (0.430 mL, 0.430 mmol). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with H2O (5.00 mL) and washed twice with DCM (5.00 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (5.00 mL). The organic layer was washed with brine (5.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to give a white solid compound BnH12029 (78.2 mg, 86%).

[0361] 1H NMR (400MHz, DMSO-d6) δ12.35 (s, 1H), 7.32 (d, J=7.8Hz, 2H), 7.12 (dd, J=17.8, 7.9Hz, 2 H), 4.73 (s, 0.5H), 4.55-4.50 (m, 0.5H), 4.24 (s, 1H), 3.89-3.85 (m, 0.5H), 3.67 (q, J=15 .4Hz, 2H), 3.00 (t, J=12.8Hz, 0.5H), 2.59 (t, J=12.7Hz, 0.5H), 2.18-2.13 (m, 1H), 1.80 -1.76 (m, 1H), 1.69-1.60 (m, 1H), 1.51-1.49 (m, 2H), 1.26 (s, 9H), 1.04 (d, J=6.9Hz, 3H).

[0362] (13) Synthesis of compound BnH12030

[0363] (3R,6S)-6-Methyl-1-(2-(m-tolyl)acetyl)piperidine-3-carboxylic acid

[0364] Step 1: Synthesis of methyl (3R,6S)-6-methyl-1-(2-(m-tolyl)acetyl)piperidine-3-carboxylate

[0365] To a solution of 2-(m-tolyl)acetic acid (100 mg, 0.666 mmol) in DMF (3.00 mL) were added (3R, 6S)-rel-6-methyl-3-piperidinecarboxylic acid methyl ester (110 mg, 0.699 mmol), DIPEA (0.174 mL, 0.999 mmol), HOBt (108 mg, 0.799 mmol) and EDC·HCl (124 mg, 0.799 mmol). The mixture was stirred at room temperature for 3.5 hours. The mixture was diluted with EtOAc (5.00 mL) and washed with saturated NH4Cl aqueous solution (5.00 mL) and brine (5.00 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 2:1) to obtain the desired compound (88.0 mg, 45%) as a colorless oil.

[0366] Step 2: Synthesis of compound BnH12030

[0367] 1N NaOH (0.363 mL, 0.363 mmol) was added to a solution of (3R, 6S)-6-methyl-1-(2-(m-tolyl)acetyl)piperidine-3-carboxylic acid methyl ester (70.0 mg, 0.242 mmol) in THF (1.00 mL). The mixture was stirred for 2 hours at room temperature. The mixture was diluted with H2O (5.00 mL) and washed twice with DCM (5.00 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (5.00 mL). The organic layer was washed with brine (5.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to obtain a white solid compound BnH12030 (26.7 mg, 40%).

[0368] 1 H NMR (400MHz, DMSO-d6) δ12.37 (s, 1H), 7.18 (t, J=7.6Hz, 1H), 7.04-6.96 (m,, 3H), 4.73 (s, 0.5H), 4.53 (dd, J=13.1, 4.1Hz, 0.5H), 4.22 (s, 0.5H), 3.88 (dd, J=9.0, 3.9Hz, 0.5H), 3.73-3.62 (m, 2H) , 2.98 (t, J=12.8Hz, 0.5H), 2.59 (t, J=12.7Hz, 0.5H), 2.27 (s, 3H), 2.19-2.13 (m, 0.5H), 2.09-1. 99 (m, 0.5H), 1.77 (d, J = 12.6Hz, 1H), 1.69-1.58 (m, 1H), 1.49-1.44 (m, 2H), 1.04 (d, J = 6.9Hz, 3H).

[0369] (14) Synthesis of compound BnH12031

[0370] (3R,6S)-1-(2-(4-Fluorophenyl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0371] Step 1: Synthesis of methyl (3R,6S)-1-(2-(4-fluorophenyl)acetyl)-6-methylpiperidine-3-carboxylate

[0372] To a solution of 2-(4-fluorophenyl)acetic acid (100 mg, 0.649 mmol) in DMF (3.00 mL) was added (3R, 6S)-rel-6-methyl-3-piperidinecarboxylic acid methyl ester (107 mg, 0.681 mmol), DIPEA (0.170 mL, 0.973 mmol), HOBt (105 mg, 0.779 mmol) and EDC·HCl (121 mg, 0.779 mmol). The mixture was stirred at room temperature for 3.5 hours. The mixture was diluted with EtOAc (5.00 mL) and washed with saturated NH4Cl aqueous solution (5.00 mL) and brine (5.00 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 2:1) to obtain the desired compound (112 mg, 59%) as a yellow oil.

[0373] Step 2: Synthesis of compound BnH12031

[0374] 1N NaOH (0.511 mL, 0.511 mmol) was added to a solution of (3R, 6S)-1-(2-(4-fluorophenyl)acetyl)-6-methylpiperidine-3-carboxylic acid methyl ester (100 mg, 0.341 mmol) in THF (2.00 mL). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with H2O (5.00 mL) and washed twice with DCM (5.00 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (5.00 mL). The organic layer was washed with brine (5.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to obtain a white solid compound BnH12031 (33.1 mg, 34%).

[0375] 1 H NMR (400MHz, DMSO-d6) δ12.38 (s, 1H), 7.24 (dt, J=18.2, 6.8Hz, 2H), 7.12 (t, J=8.7Hz, 2H), 4 .72 (s, 0.5H), 4.52 (dd, J=15.1, 3.7Hz, 0.5H), 4.24 (s, 0.5H), 3.88 (dd, J=14.8, 3.9Hz, 0.5H) ), 3.77-3.66 (m, 2H), 3.01 (t, J = 12.8Hz, 0.5H), 2.60 (t, J = 12.7Hz, 0.5H), 2.16 (tt, J = 12.8, 5.0Hz, 1H), 1.81-1.76 (m, 1H), 1.70-1.60 (m, 1H), 1.51-1.47 (s, 2H), 1.05 (t, J=7.6Hz, 3H).

[0376] (15) Synthesis of compound BnH12032

[0377] (3R,6S)-1-(2-(4-bromophenyl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0378] Step 1: Synthesis of methyl (3R,6S)-1-(2-(4-bromophenyl)acetyl)-6-methylpiperidine-3-carboxylate

[0379] To a solution of 2-(4-bromophenyl)acetic acid (100 mg, 0.465 mmol) in DMF (2.50 mL) was added (3R, 6S)-rel-6-methyl-3-piperidinecarboxylic acid methyl ester (76.8 mg, 0.488 mmol), DIPEA (0.122 mL, 0.698 mmol), HOBt (75.4 mg, 0.558 mmol) and EDC·HCl (86.6 mg, 0.558 mmol). The mixture was stirred overnight at room temperature. The mixture was diluted with EtOAc (5.00 mL) and washed with saturated NH4Cl aqueous solution (5.00 mL) and brine (5.00 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 2:1) to obtain the desired compound (110 mg, 66%) as a gray oil.

[0380] Step 2: Synthesis of compound BnH12032

[0381] To a solution of (3R,6S)-1-(2-(4-bromophenyl)acetyl)-6-methylpiperidine-3-carboxylic acid methyl ester (105 mg, 0.296 mmol) in THF (2.00 mL) was added 1N NaOH (0.445 mL, 0.445 mmol). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with H2O (5.00 mL) and washed twice with DCM (5.00 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (5.00 mL). The organic layer was washed with brine (5.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to give a white solid compound BnH12032 (36.0 mg, 35%).

[0382] 1H NMR (400MHz, DMSO-d6) δ12.38 (s, 1H), 7.49 (d, J=8.1Hz, 2H), 7.17 (dd, J=17.8, 8.0Hz, 2H), 4. 72 (s, 0.5H), 4.51 (dd, J=13.3, 4.3Hz, 0.5H), 4.23 (s, 0.5H), 3.87 (dd, J=14.5, 4.2Hz, 0.5H), 3 .89-3.64(m, 2H), 3.02(t, J=12.8Hz, 0.5H), 2.60(t, J=12.7Hz, 0.5H), 2.21-2.14(m, 1H), 1.8 2-1.76 (m, 1H), 1.66 (qd, J=11.9, 4.5Hz, 1H), 1.52-1.48 (m, 2H), 1.06 (dd, J=13.8, 6.9Hz, 3H).

[0383] (16) Synthesis of compound BnH12033

[0384] Sodium (3R,6S)-6-methyl-1-(2-(pyridin-4-yl)acetyl)piperidine-3-carboxylate

[0385] Step 1: Synthesis of methyl (3R,6S)-6-methyl-1-(2-(pyridin-4-yl)acetyl)piperidine-3-carboxylate

[0386] To a solution of 2-(pyridin-4-yl)acetic acid hydrochloride (100 mg, 0.576 mmol) in DMF (3.00 mL) was added (3R, 6S)-rel-6-methyl-3-piperidinecarboxylic acid methyl ester (95.1 mg, 0.605 mmol), DIPEA (0.301 mL, 1.73 mmol), HOBt (93.4 mg, 0.691 mmol) and EDC·HCl (107 mg, 0.691 mmol). The mixture was stirred overnight at room temperature. The mixture was diluted with EtOAc (5.00 mL) and washed with saturated NH4Cl aqueous solution (5.00 mL) and brine (5.00 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 1:1) to obtain the desired compound (145 mg, 84%) as a yellow oil.

[0387] Step 2: Synthesis of compound BnH12033

[0388] To a solution of (3R,6S)-1-(2-(furan-2-yl)acetyl)-6-methylpiperidine-3-carboxylic acid methyl ester (140 mg, 0.528 mmol) in THF (2.50 mL) was added 1N NaOH (0.792 mL, 0.792 mmol). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with H2O (5.00 mL) and washed twice with DCM (5.00 mL×2). The aqueous layer was concentrated under reduced pressure, and the residue was purified by C18 silica gel column chromatography (H2O: MeOH = 0 to 50%) to obtain a white solid compound BnH12033 (16.0 mg, 28%).

[0389] 1 H NMR (400MHz, DMSO-d6) δ8.47 (d, J=5.7Hz, 2H), 7.23 (dd, J=18.2, 5.0Hz, 2H), 4.69 (s, 0.5H), 4.43 (d, J=13.6Hz, 0.5H), 4.14 (s, 0.5H), 3.82-3.66 (m, 3H), 2.95 (t, J=13.0Hz, 0.5H), 1.83-1.72 (m, 2H), 1.56-1.47 (m, 3H), 1.06 (dd, J=19.3, 6.8Hz, 3H).

[0390] (17) Synthesis of compound BnH12034

[0391] (3R,6S)-6-Methyl-1-(2-(thiophen-2-yl)acetyl)piperidine-3-carboxylic acid

[0392] Step 1: Synthesis of methyl (3R,6S)-6-methyl-1-(2-(thiophen-2-yl)acetyl)piperidine-3-carboxylate

[0393] To a solution of 2-(thiophen-2-yl)acetic acid (100 mg, 0.703 mmol) in DMF (3.50 mL) were added (3R, 6S)-rel-6-methyl-3-piperidinecarboxylic acid methyl ester (116 mg, 0.739 mmol), DIPEA (0.184 mL, 1.06 mmol), HOBt (114 mg, 0.844 mmol) and EDC·HCl (131 mg, 0.84 mmol). The mixture was stirred overnight at room temperature. The mixture was diluted with EtOAc (5.00 mL) and washed with saturated NH4Cl aqueous solution (5.00 mL) and brine (5.00 mL). The organic layer was dried over MgSO4, filtered and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 2:1) to give the desired compound (152 mg, 76%) as a yellow oil.

[0394] Step 2: Synthesis of compound BnH12034

[0395] 1N NaOH (0.789 mL, 0.789 mmol) was added to a solution of (3R, 6S)-6-methyl-1-(2-(thiophene-2-yl)acetyl)piperidine-3-carboxylic acid methyl ester (148 mg, 0.526 mmol) in THF (3.00 mL). The mixture was stirred for 2 hours at room temperature. The mixture was diluted with H2O (5.00 mL) and washed twice with DCM (5.00 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (5.00 mL). The organic layer was washed with brine (5.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to give a white solid compound BnH12034 (90.3 mg, 64%).

[0396] 1 H NMR (400MHz, DMSO-d6) δ12.40 (s, 1H), 7.37 (dd, J=5.0, 1.4Hz, 1H), 6.96-6.88 (m, 2 H), 4.72 (s, 0.5H), 4.50 (dd, J=14.3, 4.1Hz, 0.5H), 4.28 (s, 0.5H), 4.01-3.89 (m, 2 .5H), 3.05 (t, J=12.9Hz, 0.5H), 2.62 (t, J=12.7Hz, 0.5H), 2.25-2.13 (m, 1H), 1.82 -1.77 (m, 1H), 1.71-1.61 (m, 1H), 1.55-1.50 (m, 2H), 1.07 (dd, J=20.3, 6.9Hz, 3H).

[0397] (18) Synthesis of compound BnH12035

[0398] (3R,6S)-1-(2-(Furan-2-yl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0399] Step 1: Synthesis of methyl (3R,6S)-1-(2-(furan-2-yl)acetyl)-6-methylpiperidine-3-carboxylate

[0400] To a solution of 2-(furan-2-yl)acetic acid (100 mg, 0.793 mmol) in (4.00 mL) was added (3R, 6S)-rel-6-methyl-3-piperidinecarboxylic acid methyl ester (131 mg, 0.833 mmol), DIPEA (0.207 mL, 1.19 mmol), HOBt (129 mg, 0.952 mmol) and EDC·HCl (148 mg, 0.95 mmol). The mixture was stirred overnight at room temperature. The mixture was diluted with EtOAc (5.00 mL) and washed with saturated NH4Cl aqueous solution (5.00 mL) and brine (5.00 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 2:1) to give the desired compound (153 mg, 72%) as a yellow oil.

[0401] Step 2: Synthesis of compound BnH12035

[0402] 1N NaOH (0.792 mL, 0.792 mmol) was added to a solution of (3R, 6S)-1-(2-(furan-2-yl)acetyl)-6-methylpiperidine-3-carboxylic acid methyl ester (140 mg, 0.528 mmol) in THF (2.50 mL). The mixture was stirred for 2 hours at room temperature. The mixture was diluted with H2O (5.00 mL) and washed twice with DCM (5.00 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (5.00 mL). The organic layer was washed with brine (5.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to give a white solid compound BnH12035 (100 mg, 75%).

[0403] 1 H NMR (400MHz, DMSO-d6) δ12.41 (s, 1H), 7.54 (d, J=1.8Hz, 1H), 6.38 (t, J=2.5Hz, 1H), 6.18 (dd, J=2 4.1, 3.2Hz, 1H), 4.70 (t, J=5.6Hz, 0.5H), 4.49 (dd, J=13.4, 4.3Hz, 0.5H), 4.25 (dd, J=8.4, 4.5Hz , 0.5H), 3.89 (dd, J=13.9, 4.2Hz, 0.5H), 3.83-3.73 (m, 2H), 3.10-3.04 (m, 0.5H), 2.61 (t, J=12.7 Hz, 0.5H), 2.28-2.14 (m, 1H), 1.84-1.78 (m, 1H), 1.72-1.49 (m, 2H), 1.07 (dd, J=19.2, 6.9Hz, 3H).

[0404] (19) Synthesis of compound BnH12038

[0405] Sodium (3R,6S)-6-methyl-1-(2-(pyridin-3-yl)acetyl)piperidine-3-carboxylate

[0406] Step 1: Synthesis of methyl (3R,6S)-6-methyl-1-(2-(pyridin-3-yl)acetyl)piperidine-3-carboxylate

[0407] To a solution of 2-(pyridin-3-yl)acetic acid hydrochloride (100 mg, 0.576 mmol) in DMF (3.00 mL) was added (3R, 6S)-rel-6-methyl-3-piperidinecarboxylic acid methyl ester (95.1 mg, 0.605 mmol), DIPEA (0.301 mL, 1.73 mmol), HOBt (93.4 mg, 0.691 mmol) and EDC·HCl (107 mg, 0.691 mmol). The mixture was stirred overnight at room temperature. The mixture was diluted with EtOAc (5.00 mL) and washed with saturated NH4Cl aqueous solution (5.00 mL) and brine (5.00 mL). The organic layer was dried over MgSO4, filtered and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (DCM: MeOH = 0 to 5%) to give the desired compound (76.2 mg, 47%) as a yellow oil.

[0408] Step 2: Synthesis of compound BnH12038

[0409] To a solution of (3R,6S)-6-methyl-1-(2-(pyridin-3-yl)acetyl)piperidine-3-carboxylic acid methyl ester (75.0 mg, 0.271 mmol) in THF (2.00 mL) was added 1N NaOH (0.407 mL, 0.407 mmol). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with H2O (5.00 mL) and washed twice with DCM (5.00 mL×2). The aqueous layer was concentrated under reduced pressure, and the residue was purified by C18 silica gel column chromatography (H2O: MeOH = 0 to 50%) to obtain a light yellow solid compound BnH12038 (26.7 mg, 34%).

[0410] 1H NMR (400MHz, DMSO-d6) δ8.43-8.38 (m, 2H), 7.60 (ddt, J=14.5, 7.8, 2.0Hz, 1H), 7.31 (dt, J=8.1, 4.4Hz, 1H), 4.68 (t, J=5.8Hz, 0.5H), 4.42 (dd, J=14.2, 3.9Hz, 0.5H), 4. 21 (t, J=6.3Hz, 0.5H), 3.85-3.64 (m, 2.5H), 2.97 (dd, J=13.9, 11.9Hz, 0.5H), 2.54- 2.48 (m, 0.5H), 1.86-1.69 (m, 2H), 1.61-1.42 (m, 3H), 1.06 (dd, J=30.0, 6.9Hz, 3H).

[0411] (20) Synthesis of compound BnH12039

[0412] Sodium (3R,6S)-6-methyl-1-(2-(pyridin-2-yl)acetyl)piperidine-3-carboxylate

[0413] Step 1: Synthesis of methyl (3R,6S)-6-methyl-1-(2-(pyridin-2-yl)acetyl)piperidine-3-carboxylate

[0414] To a solution of 2-(pyridin-2-yl)acetic acid hydrochloride (100 mg, 0.576 mmol) in DMF (3.00 mL) was added (3R, 6S)-rel-6-methyl-3-piperidinecarboxylic acid methyl ester (95.1 mg, 0.605 mmol), DIPEA (0.301 mL, 1.73 mmol), HOBt (93.4 mg, 0.691 mmol) and EDC·HCl (107 mg, 0.691 mmol). The mixture was stirred overnight at room temperature. The mixture was diluted with EtOAc (5.00 mL) and washed with saturated NH4Cl aqueous solution (5.00 mL) and brine (5.00 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (DCM: MeOH = 0 to 5%) to give the desired compound (71.2 mg, 44%) as a yellow oil.

[0415] Step 2: Synthesis of compound BnH12039

[0416] To a solution of (3R,6S)-6-methyl-1-(2-(pyridin-3-yl)acetyl)piperidine-3-carboxylic acid methyl ester (75.0 mg, 0.271 mmol) in THF (2.00 mL) was added 1N NaOH (0.407 mL, 0.407 mmol). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with H2O (5.00 mL) and washed twice with DCM (5.00 mL×2). The aqueous layer was concentrated under reduced pressure, and the residue was purified by C18 silica gel column chromatography (H2O: MeOH = 0 to 50%) to obtain a white solid compound BnH12039 (66.1 mg, 98%).

[0417] 1 H NMR (400MHz, DMSO-d6) δ8.43-8.38 (m, 2H), 7.60 (ddt, J=14.5, 7.8, 2.0Hz, 1H), 7.31 (dt, J=8.1, 4.4Hz, 1H), 4.68 (t, J=5.8Hz, 0.5H), 4.42 (dd, J=14.2, 3.9Hz, 0.5H), 4. 21 (t, J=6.3Hz, 0.5H), 3.85-3.64 (m, 2.5H), 2.97 (dd, J=13.9, 12.0Hz, 0.5H), 2.54- 2.48 (m, 0.5H), 1.86-1.69 (m, 2H), 1.61-1.42 (m, 3H), 1.06 (dd, J=30.0, 6.9Hz, 3H).

[0418] (21) Synthesis of compound BnH12040

[0419] (3R,6S)-6-Methyl-1-(2-(pyrimidin-5-yl)acetyl)piperidine-3-carboxylic acid

[0420] Step 1: Synthesis of methyl (3R,6S)-6-methyl-1-(2-(pyrimidin-5-yl)acetyl)piperidine-3-carboxylate

[0421] To a solution of 2-(pyrimidin-5-yl)acetic acid (100 mg, 0.724 mmol) in DMF (3.50 mL) was added (3R, 6S)-rel-6-methyl-3-piperidinecarboxylic acid methyl ester (120 mg, 0.760 ml), DIPEA (0.378 mL, 2.17 mmol), HOBt (117 mg, 0.869 mmol) and EDC·HCl (135 mg, 0.869 mmol). The mixture was stirred overnight at room temperature. The mixture was diluted with EtOAc (5.00 mL) and washed with saturated NH4Cl aqueous solution (5.00 mL) and brine (5.00 mL). The organic layer was dried over MgSO4, filtered and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (DCM: MeOH = 0 to 5%) to give the desired compound (72.8 mg, 36%) as a yellow oil.

[0422] Step 2: Synthesis of compound BnH12040

[0423] To a solution of (3R,6S)-6-methyl-1-(2-(pyrimidin-5-yl)acetyl)piperidine-3-carboxylic acid methyl ester (65.0 mg, 0.234 mmol) in THF (1.00 mL) was added 1N NaOH (0.352 mL, 0.352 mmol). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with H2O (5.00 mL) and washed twice with DCM (5.00 mL×2). The aqueous layer was acidified to pH 4 with 1N HCl at 0°C and extracted with EtOAc (5.00 mL). The organic layer was washed with brine (5.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to obtain a white solid compound BnH12040 (35.1 mg, 56%).

[0424] 1 H NMR (400MHz, DMSO-d6) δ12.45 (s, 1H), 9.04 (s, 1H), 8.62 (d, J=12.7Hz, 2H), 4. 70(s, 0.5H), 4.52-4.47(m, 0.5H), 4.32(s, 0.5H), 3.99-3.69(m, 2.5H), 3.15(t , J=12.9Hz, 0.5H), 2.65(t, J=12.8Hz, 0.5H), 2.45-2.38(m, 0.5H), 2.26-2.18 (m, 0.5H), 1.86-1.83 (m, 1H), 1.73-1.54 (m, 3H), 1.14 (dd, J=58.2, 6.9Hz, 3H).

[0425] (22) Synthesis of compound BnH12041

[0426] (3R,6S)-6-Methyl-1-(2-(pyrimidin-2-yl)acetyl)piperidine-3-carboxylic acid

[0427] Step 1: Synthesis of methyl (3R,6S)-6-methyl-1-(2-(pyrimidin-2-yl)acetyl)piperidine-3-carboxylate

[0428] To a solution of 2-(pyrimidin-2-yl)acetic acid (100 mg, 0.724 mmol) in DMF (3.50 mL) was added (3R, 6S)-rel-6-methyl-3-piperidinecarboxylic acid methyl ester (120 mg, 0.760 ml), DIPEA (0.378 mL, 2.17 mmol), HOBt (117 mg, 0.869 mmol) and EDC·HCl (135 mg, 0.869 mmol). The mixture was stirred overnight at room temperature. The mixture was diluted with EtOAc (5.00 mL) and washed with saturated NH4Cl aqueous solution (5.00 mL) and brine (5.00 mL). The organic layer was dried over MgSO4, filtered and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (DCM: MeOH = 0 to 5%) to give the desired compound (50.0 mg, 24%) as a light yellow oil.

[0429] Step 2: Synthesis of compound BnH12041

[0430] 1N NaOH (0.243 mL, 0.243 mmol) was added to a solution of (3R, 6S)-6-methyl-1-(2-(pyrimidin-2-yl)acetyl)piperidine-3-carboxylic acid methyl ester (45.0 mg, 0.162 mmol) in THF (1.00 mL). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with H2O (5.00 mL) and washed twice with DCM (5.00 mL×2). The aqueous layer was acidified to pH 4 with 1N HCl at 0°C and extracted with EtOAc (5.00 mL). The organic layer was washed with brine (5.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to obtain a yellow sticky solid compound BnH12041 (22.1 mg, 51%).

[0431] 1H NMR (400MHz, DMSO-d6) δ12.38 (s, 1H), 8.75 (t, J=4.7Hz, 2H), 7.39 (q, J=4. 6Hz, 1H), 4.71 (s, 0.5H), 4.52-4.48 (m, 0.5H), 4.26 (s, 0.5H), 4.10-3.86 ( m, 2H), 3.88 (d, J=14.8Hz, 0.5H), 3.07 (t, J=12.8Hz, 0.5H), 2.68-2.60 (m, 0.5H), 1.84-1.80 (m, 1H), 1.73-1.61 (m, 4H), 1.09 (dd, J=11.9, 6.9Hz, 3H).

[0432] (23) Synthesis of compound BnH12065

[0433] (3R,6S)-1-Benzoyl-6-methylpiperidine-3-carboxylic acid

[0434] Step 1: Synthesis of methyl (3R,6S)-1-benzoyl-6-methylpiperidine-3-carboxylate

[0435] To a solution of benzoic acid (100 mg, 0.819 mmol) in DMF (2.73 mL) was added (3R, 6S)-6-methylpiperidine-3-carboxylic acid methyl ester (135 mg, 0.860 mmol), DIPEA (0.215 mL, 1.23 mmol), HOBt (133 mg, 0.983 mmol) and EDC·HCl (153 mg, 0.983 mmol). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with EtOAc (5.00 mL) and washed with saturated NH4Cl aqueous solution (5.00 mL) and brine (5.00 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 3:1 to 2:1) to obtain the desired compound (150 mg, 70.1%) as a colorless oil.

[0436] Step 2: Synthesis of compound BnH12065

[0437] 1N NaOH (0.861 mL, 0.861 mmol) was added to a solution of (3R, 6S)-1-benzoyl-6-methylpiperidine-3-carboxylic acid methyl ester (150 mg, 0.574 mmol) in THF (1.98 mL). The mixture was stirred for 2 hours at room temperature. The mixture was diluted with H2O (2.00 mL) and washed twice with DCM (30.0 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (30.0 mL). The organic layer was washed with brine (3.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to obtain a white solid compound BnH12065 (121 mg, 80.7%).

[0438] 1 H NMR (400MHz, DMSO-d6) δ12.46 (s, 1H), 7.45-7.43 (q, J=3.2Hz, 3H), 7.37-7.34 (q, J=3.2H z, 2H), 2.95 (s, 1H), 2.44-2.36 (q, J=11.2Hz, 2H), 1.89-1.54 (m, 5H), 1.17-1.11 (m, 3H).

[0439] (24) Synthesis of compound BnH12069

[0440] (3R,6S)-6-Methyl-1-(2-(4-nitrophenyl)acetyl)piperidine-3-carboxylic acid

[0441] Step 1: Synthesis of (3R,6S)-6-methyl-1-(2-(4-nitrophenyl)acetyl)piperidine-3-carboxylic acid methyl ester To a solution of 2-(4-nitrophenyl)acetic acid (200 mg, 1.10 mmol) in DMF (3.68 mL) were added (3R,6S)-6-methylpiperidine-3-carboxylic acid methyl ester (182 mg, 1.16 mmol), DIPEA (0.289 mL, 1.66 mmol), HOBt (179 mg, 1.33 mmol) and EDC·HCl (206 mg, 1.33 mmol). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with EtOAc (8.00 mL) and washed with saturated NH4Cl aqueous solution (8.00 mL) and brine (8.00 mL). The organic layer was dried over MgSO4, filtered and concentrated under reduced pressure. The residue was purified by SiO 2 column chromatography (n-hexane:EtOAc=2:1 to 1:1) to give the desired compound (180 mg, 50.9%) as a pale yellow oil.

[0442] Step 2: Synthesis of compound BnH12069

[0443] 1N NaOH (0.843 mL, 0.843 mmol) was added to a solution of (3R, 6S)-6-methyl-1-(2-(4-nitrophenyl)acetyl)piperidine-3-carboxylic acid methyl ester (180 mg, 0.562 mmol) in THF (1.94 mL). The mixture was stirred for 2 hours at room temperature. The mixture was diluted with H2O (5.00 mL) and washed twice with DCM (6.00 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (30.0 mL). The organic layer was washed with brine (5.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to give a white solid compound BnH12069 (166 mg, 96.4%).

[0444] 1 H NMR (400MHz, DMSO-d6) δ12.44 (s, 1H), 8.19-8.17 (d, J=8.5Hz, 2H), 7.53-7.47 (dd, J=17.2, 8.3 Hz, 2H), 4.72 (s, 0.5H), 4.54-4.50 (d, 0.5H), 4.26 (s, 0.5H), 4.00-3.84 (q, J=15.9, 15.4Hz, 2.5 H), 3.10-3.04 (t, J=12.9Hz, 0.5H), 2.67-2.60 (t, J=12.8Hz, 0.5H), 2.30-2.19 (m, 1H), 1.84-1. 78 (td, J=13.9, 3.6Hz, 1H), 1.71-1.62 (m, 1H), 1.55 (s, 2H), 1.14-1.05 (dd, J=26.7, 6.9Hz, 3H).

[0445] (25) Synthesis of compound BnH12070

[0446] (3R,6S)-1-(2-(4-aminophenyl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0447] Step 1: Synthesis of compound BnH12070

[0448] Under N2 gas at 0°C, 10wt% palladium on carbon (9.20mg) was added to a MeOH (2.00mL) solution of BnH12068 (92.0mg, 0.300mmol) in an ice-water bath. The mixture was degassed and purged with H2 gas. After removing the cooling bath, the mixture was vigorously stirred for 1.5 hours under H2 gas at room temperature. The reaction mixture was filtered through a diatomaceous earth pad and washed with MeOH (5.00mL). The filtrate was concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (DCM: MeOH = 0 to 10%) to obtain a light yellow solid compound BnH12070 (46.0mg, 55.4%).

[0449] 1 H NMR (400MHz, DMSO-d6) δ12.26 (s, 1H), 6.88-6.81 (dd, J=17.1, 7.9Hz, 2H), 6.50-6.47 (m, 2H), 4.91 (s, 2 H), 4.71 (s, 0.5H), 4.52-4.48 (m, 0.5H), 4.19 (s, 0.5H), 3.86-3.83 (d, J=13.9Hz, 0.5H), 3.54-3.46 (m, J=5.4Hz, 2H), 2.97-2.90 (t, J=12.9Hz, 0.5H), 2.58-2.55 (d, J=12.7Hz, 0.5H), 2.14-2.00 (m, 1H), 1.76 -1.72 (m, 1H), 1.63-1.60 (d, J=13.2Hz, 1H), 1.48-1.41 (d, J=16.0Hz, 2H), 1.02-0.99 (t, J=6.1Hz, 3H).

[0450] (26) Synthesis of compound BnH12073

[0451] (3R,6S)-6-Methyl-1-(2-(3-nitrophenyl)acetyl)piperidine-3-carboxylic acid

[0452] Step 1: Synthesis of methyl (3R,6S)-6-methyl-1-(2-(3-nitrophenyl)acetyl)piperidine-3-carboxylate

[0453] To a solution of 2-(3-nitrophenyl)acetic acid (200 mg, 1.10 mmol) in DMF (3.68 mL) were added (3R, 6S)-6-methylpiperidine-3-carboxylic acid methyl ester (182 mg, 1.16 mmol), DIPEA (0.289 mL, 1.66 mmol), HOBt (179 mg, 1.33 mmol) and EDC·HCl (206 mg, 1.33 mmol). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with EtOAc (8.00 mL) and washed with saturated NH4Cl aqueous solution (8.00 mL) and brine (8.00 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 2:1 to 1:1) to give the desired compound (210 mg, 59.4%) as a light yellow oil.

[0454] Step 2: Synthesis of compound BnH12073

[0455] 1N NaOH (0.983 mL, 0.983 mmol) was added to a solution of (3R, 6S)-6-methyl-1-(2-(3-nitrophenyl)acetyl)piperidine-3-carboxylic acid methyl ester (210 mg, 0.656 mmol) in THF (2.26 mL). The mixture was stirred for 2 hours at room temperature. The mixture was diluted with H2O (5.00 mL) and washed twice with DCM (6.00 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (5.00 mL). The organic layer was washed with brine (5.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to give a white solid compound BnH12073 (173 mg, 86.2%).

[0456] 1 H NMR (400MHz, DMSO-d6) δ12.45 (s, 1H), 8.13-8.09 (m, 2H), 7.70-7.58 (m, 2H), 4.72 (s, 0. 5H), 4.53-4.49(m, 0.5H), 4.30(s, 0.5H), 4.01-3.84(m, 2.5H), 3.12-3.05(t, J=12.8Hz , 0.5H), 2.67-2.60 (m, 0.5H), 2.33-2.20 (m, 1H), 1.83-1.80 (d, J=11.9Hz, 1H), 1.69-1. 63 (d, J=11.2Hz, 1H), 1.57-1.53 ​​(d, J=16.0Hz, 2H), 1.16-1.05 (dd, J=34.1, 6.9Hz, 3H).

[0457] (27) Synthesis of compound BnH12074

[0458] (3R,6S)-1-(2-(4-aminophenyl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0459] Step 1: Synthesis of compound BnH12074

[0460] Under N2 gas at 0°C, 10wt% palladium on carbon (9.80mg) was added to a solution of BnH12073 (98.0mg, 0.320mmol) in MeOH:THF (1:1, 2.14mL) in an ice-water bath. The mixture was degassed and purged with H2 gas. After removing the cooling bath, the mixture was vigorously stirred under H2 gas at room temperature for 22 hours. The reaction mixture was filtered through a diatomaceous earth pad and washed with MeOH (5.00mL). The filtrate was concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (DCM:MeOH=0 to 10%) to give a light yellow solid compound BnH12074 (52.0mg, 58.8%).

[0461] 1 H NMR (400MHz, DMSO-d6) δ12.37 (s, 1H), 6.95-6.90 (td, J=7.8, 4.1Hz, 1H), 6.43-6.35 (m, 3H), 5.02 (s, 2H), 4.74-4.72 (s, 0.5H), 4.55-4.51 (d, 0.5H), 4.15 (s, 0.5H), 3.83-3.79 (d, J=14.4Hz, 0.5H), 3.58-3.48 (m, 2 H), 2.98-2.92 (t, J=12.9Hz, 0.5H), 2.60-2.54 (t, J=12.7Hz, 0.5H), 2.18-2.09 (m, 1H), 1.78-1.74 (d, J=13 .0Hz, 1H), 1.67-1.62 (m, J=13.6Hz, 1H), 1.50-1.44 (d, J=27.9Hz, 2H), 1.04-1.00 (dd, J=10.0, 6.8Hz, 3H).

[0462] (28) Synthesis of compound BnH12075

[0463] (3R,6S)-1-(2-(6-methoxypyridin-3-yl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0464] Step 1: Synthesis of (3R,6S)-1-(2-(6-methoxypyridin-3-yl)acetyl)-6-methylpiperidin-3-carboxymethyl ester

[0465] To a solution of 2-(6-methoxypyridin-3-yl)acetic acid (100 mg, 0.598 mmol) in DMF (1.99 mL) were added (3R, 6S)-6-methylpiperidine-3-carboxylic acid methyl ester (98.8 mg, 0.628 mmol), DIPEA (0.157 mL, 0.897 mmol), HOBt (97.0 mg, 0.718 mmol) and EDC·HCl (111 mg, 0.718 mmol). The mixture was stirred at room temperature for 3 hours. The mixture was diluted with EtOAc (5.00 mL) and washed with saturated NH4Cl aqueous solution (5.00 mL) and brine (5.00 mL). The organic layer was dried over MgSO4, filtered and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 1:1) to obtain the desired compound (87.0 mg, 47.5%) as a colorless oil.

[0466] Step 2: Synthesis of compound BnH12075

[0467] 1N NaOH (0.426 mL, 0.426 mmol) was added to a solution of (3R, 6S)-1-(2-(6-methoxypyridin-3-yl)acetyl)-6-methylpiperidine-3-carboxylic acid methyl ester (87.0 mg, 0.284 mmol) in THF (0.979 mL). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with H2O (5.00 mL) and washed twice with DCM (5.00 mL×2). The aqueous layer was acidified to pH 3 to 4 with 1N HCl at 0°C and extracted with EtOAc (5.00 mL). The organic layer was washed with brine (5.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to give a white solid compound BnH12075 (51.4 mg, 61.9%).

[0468] 1H NMR (400MHz, DMSO-d6) δ12.43 (s, 1H), 7.99-7.95 (d, J=16.8Hz, 1H), 7.55-7.49 (dt, J=9.9, 5.5Hz, 1H), 6.76-6.74 (d, J=8.5Hz, 1H), 4.71 (s, 0.5H), 4.52-4.49 (d, J=13.6Hz, 0.5H), 4.28 (s, 0.5H), 3.94-3.91 (d, J=13.9Hz, 0.5H), 3.74-3.59 (m, 2H), 3.09-3.02 (t, J=12.9Hz, 0.5H), 2.64-2.57 (t, J=12.8Hz, 0.5H), 2.26-2.17 (d, J=33.1Hz, 1H), 1.82-1.79 (d, J=13.2Hz, 1H), 1.67-1.61 (d, J=12.6Hz, 1H), 1.56-1.53 ​​(m, 2H), 1.13-1.03 (dd, J=32.5, 6.9Hz, 3H).

[0469] (29) Synthesis of compound BnH12076

[0470] (3R,6S)-1-(2-(4-(dimethylamino)phenyl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0471] Step 1: Synthesis of methyl (3R,6S)-1-(2-(4-(dimethylamino)phenyl)acetyl)-6-methylpiperidine-3-carboxylate

[0472] To a solution of 2-(4-(dimethylamino)phenyl)acetic acid (100 mg, 0.558 mmol) in DMF (1.86 mL) were added (3R,6S)-6-methylpiperidine-3-carboxylic acid methyl ester (92.1 mg, 0.586 mmol), DIPEA (0.146 mL, 0.837 mmol), HOBt (90.5 mg, 0.670 mmol) and EDC·HCl (104 mg, 0.670 mmol). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with EtOAc (5.00 mL) and washed with saturated NH4Cl aqueous solution (5.00 mL) and brine (5.00 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 2:1 to 1:1) to give the desired compound (142 mg, 79.9%) as a light yellow oil.

[0473] Step 2: Synthesis of compound BnH12076

[0474] To a solution of (3R,6S)-1-(2-(4-(dimethylamino)phenyl)acetyl)-6-methylpiperidine-3-carboxylic acid methyl ester (142 mg, 0.446 mmol) in THF (1.54 mL) was added 1N NaOH (0.669 mL, 0.669 mmol). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with H2O (5.00 mL) and washed twice with DCM (5.00 mL×2). The aqueous layer was acidified to pH 3 to 4 with 1N HCl at 0°C and extracted with EtOAc (5.00 mL). The organic layer was washed with brine (5.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to give a white solid compound BnH12076 (69.0 mg, 50.8%).

[0475] 1 H NMR (400MHz, DMSO-d6) δ12.42 (s, 1H), 7.05-6.99 (dd, J=18.3, 8.1Hz, 2H), 6.68-6.66 (d, J=8.2Hz, 2H), 4.72 (s , 0.5H), 4.54-4.50 (m, 0.5H), 4.23-4.20 (d, J=9.0Hz, 0.5H), 3.88-3.85 (d, J=13.9Hz, 0.5H), 3.62-3.52 (m, 2H) , 2.98-2.91 (t, J=12.7Hz, 0.5H), 2.85 (S, 6H), 2.60-2.53 (t, J=12.6Hz, 0.5H), 2.13-2.09 (m, 1H), 1.78-1.74 (d , J=12.7Hz, 1H), 1.68-1.58 (q, J=13.0Hz, 1H), 1.50-1.40 (d, J=16.3Hz, 2H), 1.03-1.00 (dd, J=7.2, 2.9Hz, 3H).

[0476] (30) Synthesis of compound BnH12079

[0477] (3R,6S)-1-(2-(4-Hydroxyphenyl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0478] Step 1: Synthesis of 2-(4-hydroxyphenyl)acetic acid

[0479] Under N2 gas at -78°C, 1M BBr3 solution (6.02mL, 6.02mmol) was added to a suspension of 2-(4-hydroxyphenyl)acetic acid (500mg, 3.01mmol) in DCM (5.02mL), and the mixture was heated from -78°C to -15°C with stirring for 5 hours. The reaction mixture was quenched with H2O (7.50mL), the resulting solid was filtered, and washed with DCM (5.00mL) to give the desired compound (128mg, 28.0%) as a pale pink solid.

[0480] Step 2: Synthesis of methyl (3R,6S)-1-(2-(4-hydroxyphenyl)acetyl)-6-methylpiperidine-3-carboxylate

[0481] To a solution of 2-(4-hydroxyphenyl)acetic acid (72.0 mg, 0.473 mmol) in DMF (1.58 mL) was added (3R, 6S)-6-methylpiperidine-3-carboxylic acid methyl ester (78.1 mg, 0.497 mmol), DIPEA (0.124 mL, 0.710 mmol), HOBt (76.7 mg, 0.568 mmol) and EDC·HCl (88.2 mg, 0.568 mmol). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with EtOAc (4.00 mL) and washed with saturated NH4Cl aqueous solution (4.00 mL) and brine (4.00 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (DCM: MeOH = 0 to 2%) to give the desired compound (78.0 mg, 56.6%) as a light yellow sticky solid.

[0482] Step 3: Synthesis of compound BnH12079

[0483] 1N NaOH (0.402 mL, 0.402 mmol) was added to a solution of (3R, 6S)-1-(2-(4-hydroxyphenyl)acetyl)-6-methylpiperidine-3-carboxylic acid methyl ester (78.0 mg, 0.268 mmol) in THF (0.923 mL). The mixture was stirred for 2 hours at room temperature. The mixture was diluted with H2O (4.00 mL) and washed 3 times with DCM (4.00 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (4.00 mL). The organic layer was washed with brine (4.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to give a white solid compound BnH12079 (69.0 mg, 50.8%).

[0484] 1H NMR (400MHz, DMSO-d6) δ12.37 (s, 1H), 9.25 (s, 1H), 7.05-6.97 (dd, J=17.6, 7.9Hz, 2H), 6.70-6.68 (d, J=7.9 Hz, 2H), 4.73 (s, 0.5H), 4.55-4.50 (m, 0.5H), 4.21 (s, 0.5H), 3.88-3.84 (d, J=13.8Hz, 0.5H), 3.64-3.54 (d, J=6.2Hz, 2H), 3.00-2.94 (t, J=12.9Hz, 0.5H), 2.61-2.55 (d, J=12.5Hz, 0.5H), 2.16-2.07 (m, 1H), 1.79-1.7 5 (d, J=12.9Hz, 1H), 1.65-1.62 (d, J=13.2Hz, 1H), 1.50-1.47 (d, J=15.1Hz, 2H), 1.04-1.01 (t, J=5.5Hz, 3H).

[0485] Preparation Example 2. Preparation of active compounds according to representative reaction formula 2

[0486] [Reaction 2]

[0487]

[0488]

[0489] (1) Synthesis of compound BnH12001 (12-004)

[0490] 1-(2-(2-chloro-4-fluorophenyl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0491]

[0492] Step 1: Synthesis of 6-methylpiperidine-3-carboxylic acid (c)

[0493] To a solution of 6-methylnicotinic acid (500 mg, 3.65 mmol) in EtOH (6.63 mL) was added acetic acid (0.663 mL, 3.65 mmol) and Pd / C (272 mg, 2.55 mmol). The reaction mixture was degassed and purged with H2 gas 3 times. Then, the mixture was stirred at room temperature for 3 days and at 50 ° C for 16 hours. After cooling to room temperature, the mixture was filtered through diatomaceous earth and washed with MeOH (10.0 mL). The filtrate was concentrated under reduced pressure and used without further purification.

[0494] Step 2: 6-Methylpiperidine-3-carboxylic acid methyl ester (2-1-12-004)

[0495] To a solution of 6-methylpiperidine-3-carboxylic acid (crude) in MeOH (8.10 mL), SOCl2 (0.798 mL, 10.9 mmol) was added dropwise at 0°C and refluxed at 70°C for 2 hours. The mixture was concentrated, the residue was dissolved in EtOAc (10.0 mL), and washed with saturated NaHCO3 (10.0 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure to give methyl 6-methylpiperidine-3-carboxylate (180 mg, 31%, 2 steps) as a brown oil. The desired compound was used without further purification.

[0496] Step 3: Synthesis of methyl 1-(2-(2-chloro-4-fluorophenyl)acetyl)-6-methylpiperidine-3-carboxylate

[0497] To a solution of 2-chloro-4-fluorophenylacetic acid (200 mg, 1.06 mmol) in DMF (3.53 mL) were added methyl 6-methylpiperidine-3-carboxylate (175 mg, 1.11 mmol), DIPEA (0.277 mL, 1.59 mmol), HOBt (172 mg, 1.27 mmol) and EDC·HCl (198 mg, 1.27 mmol). The mixture was stirred at room temperature for 3.5 hours. The mixture was diluted with EtOAc (4.00 mL) and washed with saturated NH4Cl aqueous solution (4.00 mL) and brine (4.00 mL). The organic layer was dried over MgSO4, filtered and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 3:1 to 2:1) to obtain the desired compound (227 mg, 65%) as a colorless oil.

[0498] Step 4: Synthesis of Compound 12-004

[0499] 1-(2-(2-chloro-4-fluorophenyl)acetyl)-6-methylpiperidine-3-carboxylic acid methyl ester (220 mg, 0.702 mmol) in THF (2.42 mL) was added 1N NaOH (1.05 mL, 1.05 mmol). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with H2O (3.00 mL) and washed twice with DCM (5.00 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (5.00 mL). The organic layer was washed with brine (5.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure. Et2O (5.00 mL) was added to the residue and stirred at room temperature for 1 hour. The precipitate was filtered and washed with Et2O (2.00 mL) to give compound 12-004 (150 mg, 71%) as a white solid.

[0500] 1H NMR (400MHz, DMSO-d6) δ12.48 (s, 1H) 7.43-7.22 (m, 2H), 7.21-7.10 (m, 1H), 4.66 (d, J=29.7 Hz, 0.7H), 4.49 (d, J=12.5Hz, 0.3H), 4.27 (s, 0.3H), 4.03 (d, J=7.2Hz, 0.5H), 3.97-3.68 (m , 2.5H), 3.14 (t, J=12.9Hz, 0.5H), 2.71-2.57 (m, 1H), 2.34 (d, J=8.9Hz, 0.25H), 2.21 (s, 0. 25H), 1.87 (t, J=16.7Hz, 2H), 1.77-1.50 (m, 2H), 1.41-1.34 (m, 0.5H), 1.27-1.00 (m, 3.5H).

[0501] (2) Synthesis of compound BnH12004

[0502] (R)-1-(2-(2-chloro-4-fluorophenyl)acetyl)piperidine-3-carboxylic acid

[0503] Step 1: Synthesis of (R)-1-(2-(2-chloro-4-fluorophenyl)acetyl)piperidine-3-carboxylic acid methyl ester

[0504] To a solution of 2-chloro-4-fluorophenylacetic acid (100 mg, 0.530 mmol) in DMF (1.77 mL) were added (R)-piperidine-3-carboxylic acid methyl ester (79.7 mg, 0.557 mmol), DIPEA (0.139 mL, 0.795 mmol), HOBt (86.0 mg, 0.636 mmol) and EDC·HCl (98.8 mg, 0.636 mmol). The mixture was stirred at room temperature for 3.5 hours. The mixture was diluted with EtOAc (3.00 mL) and washed with saturated NH4Cl aqueous solution (3.00 mL) and brine (3.00 mL). The organic layer was dried over MgSO4, filtered and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 3:1 to 2:1) to obtain the desired compound (128 mg, 76%) as a colorless oil.

[0505] Step 2: Synthesis of compound BnH12004

[0506] To a solution of (R)-1-(2-(2-chloro-4-fluorophenyl)acetyl)piperidine-3-carboxylic acid methyl ester (128 mg, 0.408 mmol) in THF (1.41 mL) was added 1N NaOH (0.612 mL, 0.612 mmol). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with H2O (1.50 mL) and washed twice with DCM (30.0 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (30.0 mL). The organic layer was washed with brine (3.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (DCM:MeOH=95:5 to 90:10) to give a white solid compound BnH12004 (83.0 mg, 67%).

[0507] 1 H NMR (400MHz, DMSO-d6) δ7.39 (dt, J=9.0, 3.1Hz, 1H), 7.32 (ddd, J=11.3, 8.6, 6.3Hz, 1H ), 7.16(td, J=8.5, 2.7Hz, 1H), 4.42-4.31(m, 0.5H), 3.87-3.76(m, 4H), 3.53-3.41(m, 2H), 3.12-3.02 (m, 1.5H), 2.78 (dd, J=12.9, 10.6Hz, 0.5H), 2.31-2.21 (m, 0.5H), 2.02 -1.87 (m, 1H), 1.70 (d, J=11.9Hz, 1H), 1.57 (dt, J=11.6, 6.0Hz, 1H), 1.49-1.30 (m, 1H).

[0508] (3) Synthesis of compound BnH12005

[0509] (S)-2-(2-Chloro-4-fluorophenyl)-1-(2-methylpiperidin-1-yl)ethan-1-one

[0510] Step 1: Synthesis of compound BnH12005

[0511] To a solution of 2-chloro-4-fluorophenylacetic acid (100 mg, 0.530 mmol) in DMF (1.77 mL) was added (S)-2-methylpiperidine (55.2 mg, 0.557 mmol), DIPEA (0.139 mL, 0.795 mmol), HOBt (86.0 mg, 0.636 mmol) and EDC·HCl (98.8 mg, 0.636 mmol). The mixture was stirred at room temperature for 3.5 hours. The mixture was diluted with EtOAc (3.00 mL) and washed with saturated NH4Cl aqueous solution (3.00 mL) and brine (3.00 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 3:1 to 2:1) to obtain a colorless oily compound BnH12005 (112 mg, 78%).

[0512] 1 H NMR (400MHz, DMSO-d6) δ7.39 (dd, J=8.9, 2.7Hz, 1H), 7.33 (s, 1H), 7.16 (td, J=8.5, 2.7Hz, 1H), 4.70 (s, 0.5H), 4.25 (s, 0.5H), 3.77 (d, J=39.4Hz, 2.5H), 3.14 (d, J=14.1Hz, 0.5H), 2.71-2.60 (m, 0.5H), 1.68-1.45 (m, 5H), 1.38-1.04 (m, 4H).

[0513] (4) Synthesis of compound BnH12012

[0514] (2-(2-Chloro-4-fluorophenyl)acetyl)-D-proline

[0515] Step 1: Synthesis of (2-(2-chloro-4-fluorophenyl)acetyl)-D-proline methyl ester

[0516] To a solution of 2-chloro-4-fluorophenylacetic acid (100 mg, 0.530 mmol) in DMF (1.77 mL) were added D-proline methyl ester (82.2 mg, 0.636 mmol), DIPEA (0.140 mL, 0.795 mmol), HOBt (86.0 mg, 0.636 mmol) and EDC·HCl (99.0 mg, 0.636 mmol). The mixture was stirred at room temperature for 3.5 hours. The mixture was diluted with EtOAc (3.00 mL) and washed with saturated NH4Cl aqueous solution (3.00 mL) and brine (3.00 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 2:1) to give the desired compound (112 mg, 70%) as a colorless oil.

[0517] Step 2: Synthesis of compound BnH12012

[0518] To a solution of (2-(2-chloro-4-fluorophenyl)acetyl)-D-proline methyl ester (112 mg, 0.357 mmol) in THF (1.23 mL) was added 1N NaOH (0.535 mL, 0.535 mmol). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with H2O (2.00 mL) and washed twice with DCM (30.0 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (30.0 mL). The organic layer was washed with brine (3.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to give a white solid compound BnH12012 (24.0 mg, 22%).

[0519] 1 H NMR (400MHz, Chloroform-d) δ7.31 (dd, J=8.6, 5.9Hz, 1H), 7.16 (dd, J=8.4, 2.6Hz, 1H), 6.99 (td, J=8.3, 2.7Hz, 1H), 4.68-4.6 2 (m, 1H), 3.80 (d, J=2.8Hz, 2H), 3.68 (ddd, J=10.7, 7.4, 3.6Hz, 1H), 3.63-3.55 (m, 1H), 2.55-2.47 (m, 1H), 2.20-1.96 (m, 3H).

[0520] (5) Synthesis of compound BnH12013

[0521] (2-(2-Chloro-4-fluorophenyl)acetyl)-L-proline

[0522] Step 1: Synthesis of (2-(2-chloro-4-fluorophenyl)acetyl)-L-proline methyl ester

[0523] To a solution of 2-chloro-4-fluorophenylacetic acid (100 mg, 0.530 mmol) in DMF (1.77 mL) were added L-proline methyl ester (71.9 mg, 0.557 mmol), DIPEA (0.140 mL, 0.795 mmol), HOBt (86.0 mg, 0.636 mmol) and EDC·HCl (99.0 mg, 0.636 mmol). The mixture was stirred at room temperature for 3.5 hours. The mixture was diluted with EtOAc (3.00 mL) and washed with saturated NH4Cl aqueous solution (3.00 mL) and brine (3.00 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 2:1) to give the desired compound (126 mg, 79%) as a colorless oil.

[0524] Step 2: Synthesis of compound BnH12013

[0525] To a solution of (2-(2-chloro-4-fluorophenyl)acetyl)-L-proline methyl ester (126 mg, 0.420 mmol) in THF (1.45 mL) was added 1N NaOH (0.631 mL, 0.631 mmol). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with H2O (2.00 mL) and washed twice with DCM (30.0 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (30.0 mL). The organic layer was washed with brine (3.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to give a white solid compound BnH12013 (26.0 mg, 21%).

[0526] 1 H NMR (400MHz, Chloroform-d) δ7.30 (dd, J=8.6, 5.9Hz, 1H), 7.16 (dd, J=8.4, 2.6Hz, 1H), 7.00 (td, J=8.3, 2.7Hz, 1H), 4.68-4. 62 (m, 1H), 3.80 (d, J=2.7Hz, 2H), 3.68 (td, J=8.9, 7.6, 3.5Hz, 1H), 3.63-3.55 (m, 1H), 2.57-2.46 (m, 1H), 2.20-1.90 (m, 3H).

[0527] Preparation Example 3. Preparation of active compounds according to representative reaction formula 4

[0528] [Reaction 4]

[0529]

[0530]

[0531] (1) Synthesis of compound BnH12014

[0532] (R)-1-(2-(2-chloro-4-fluorophenyl)acetyl)-N-hydroxypyrrolidine-2-carboxamide

[0533] Step 1: Synthesis of (2-(2-chloro-4-fluorophenyl)acetyl)-D-proline methyl ester

[0534] To a solution of 2-chloro-4-fluoroacetic acid (100 mg, 0.530 mmol) in DMF (1.77 mL) were added D-proline methyl ester (105 mg, 0.636 mmol), DIPEA (0.139 mL, 0.795 mmol), HOBt (86.0 mg, 0.636 mmol) and EDC·HCl (98.8 mg, 0.636 mmol). The mixture was stirred at room temperature for 3.5 hours. The mixture was diluted with EtOAc (4.00 mL) and washed with saturated NH4Cl aqueous solution (4.00 mL) and brine (4.00 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 2:1) to give the desired compound (113 mg, 71%) as a colorless oil.

[0535] Step 2: Synthesis of compound BnH12014

[0536] To a solution of (2-(2-chloro-4-fluorophenyl)acetyl)-D-proline methyl ester (100 mg, 0.334 mmol) in MeOH (1.50 mL) and THF (1.50 mL) were added hydroxylamine hydrochloride (0.197 mL, 3.34 mmol) and KOH (37.4 mg, 0.667 mmol). The mixture was stirred at room temperature for 2 hours. The pH value was adjusted to pH 1 to 2 by adding 1N HCl to the mixture, and the mixture was extracted with DCM (4.00 mL×5). The combined organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by NH-SiO2 column chromatography (DCM:MeOH=9:1) to obtain white solid compound BnH12014 (25.0 mg, 24%).

[0537] 1H NMR (400MHz, Chloroform-d) δ9.92 (s, 1H), 7.34 (dd, J=8.5, 6.0Hz, 1H), 7.14 (dd, J=8.5, 2.6Hz, 1H), 6.99 (td, J=8.3, 2.7Hz , 1H), 4.52 (d, J=7.8Hz, 1H), 3.72 (s, 2H), 3.56 (dd, J=17.2, 8.7Hz, 2H), 2.42 (s, 1H), 2.22-2.09 (m, 1H), 2.08-1.90 (m, 2H).

[0538] (2) Synthesis of compound BnH12016

[0539] (S)-1-(2-(2-chloro-4-fluorophenyl)acetyl)-N-hydroxypyrrolidine-2-carboxamide

[0540] Step 1: Synthesis of (2-(2-chloro-4-fluorophenyl)acetyl)-L-proline methyl ester

[0541] To a solution of 2-chloro-4-fluoroacetic acid (100 mg, 0.530 mmol) in DMF (1.77 mL) were added L-proline methyl ester (105 mg, 0.636 mmol), DIPEA (0.139 mL, 0.795 mmol), HOBt (86.0 mg, 0.636 mmol) and EDC·HCl (98.8 mg, 0.636 mmol). The mixture was stirred at room temperature for 3.5 hours. The mixture was diluted with EtOAc (4.00 mL) and washed with saturated NH4Cl aqueous solution (4.00 mL) and brine (4.00 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 2:1) to give the desired compound (128 mg, 80%) as a colorless oil.

[0542] Step 2: Synthesis of compound BnH12016

[0543] To a solution of (2-(2-chloro-4-fluorophenyl)acetyl)-L-proline methyl ester (128 mg, 0.427 mmol) in MeOH (1.50 mL) and THF (1.50 mL) were added hydroxylamine hydrochloride (59.4 mg, 0.854 mmol) and KOH (95.85 mg, 1.71 mmol). The mixture was stirred at room temperature for 17 hours. The pH value was adjusted to pH 1 to 2 by adding 1N HCl to the mixture, and the mixture was extracted with DCM (4.00 mL×5). The combined organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by NH-SiO2 column chromatography (DCM:MeOH=9:1) to give a white solid compound BnH12016 (19.0 mg, 14%).

[0544] 1 H NMR (400MHz, Chloroform-d) δ9.87 (s, 1H), 7.35-7.27 (m, 1H), 7.15 (dd, J=8.4, 2.6Hz, 1H), 6.99 (td, J=8.3, 2.7Hz, 1H), 4.5 4 (d, J=8.1Hz, 1H), 3.73 (d, J=2.6Hz, 2H), 3.66-3.49 (m, 2H), 2.46 (s, 1H), 2.17 (dd, J=17.6, 8.5Hz, 1H), 2.09-1.89 (m, 2H).

[0545] (3) Synthesis of compound BnH12009

[0546] (3R,6S)-1-(2-(2-chloro-4-fluorophenyl)acetyl)-N-hydroxy-6-methylpiperidine-3-carboxamide

[0547] Step 1: Synthesis of compound BnH12009

[0548] To a solution of compound BnH12001 enantiomer (3S, 6R) (60.0 mg, 0.191 mmol) in THF (0.956 mL) was added CDI (46.5 mg, 0.287 mmol) and stirred at room temperature for 1 hour. Hydroxylamine hydrochloride (39.9 mg, 0.574 mol) was added to the mixture and the mixture was stirred at room temperature for 17 hours. The mixture was diluted with DCM (2.00 mL) and washed with 5% aqueous KHSO4 solution (2.00 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by NH-SiO2 column chromatography (DCM: MeOH = 10: 1) to obtain white solid compound BnH12009 (32.0 mg, 50%).

[0549] 1H NMR (400MHz, Chloroform-d) δ9.58 (s, 1H), 7.24 (dd, J=8.7, 6.1Hz, 2H), 7.13 (dd, J=8.4, 2.6Hz, 1H), 6.96 (td, J=8.2, 2.6Hz, 1H), 4.54 (d, J=13.4Hz, 0.5 H), 4.18 (s, 0.5H), 3.89-3.61 (m, 2H), 3.49 (s, 2H), 2.87 (t, J=12.4Hz, 0.5H ), 2.07 (dd, J=29.7, 12.3Hz, 2H), 1.68 (d, J=23.3Hz, 3H), 1.36-1.18 (m, 4H).

[0550] (4) Synthesis of compound BnH12018

[0551] (R)-1-Benzoyl-N-hydroxypyrrolidine-2-carboxamide

[0552] Step 1: Synthesis of benzoyl-D-proline methyl ester

[0553] To a solution of benzoic acid (100 mg, 0.819 mmol) in DMF (2.73 mL) were added D-proline methyl ester (163 mg, 0.983 mmol), DIPEA (0.215 mL, 1.23 mmol), HOBt (133 mg, 0.983 mmol) and EDC·HCl (153 mg, 0.983 mmol). The mixture was stirred at room temperature for 3.5 hours. The mixture was diluted with EtOAc (4.00 mL) and washed with saturated NH4Cl aqueous solution (4.00 mL) and brine (4.00 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 2:1) to give the desired compound (126 mg, 66%) as a colorless oil.

[0554] Step 2: Synthesis of compound BnH12018

[0555] To a solution of benzoyl-D-proline methyl ester (124 mg, 0.414 mmol) in MeOH (3.00 mL) and THF (3.00 mL) were added hydroxylamine hydrochloride (0.244 mL, 4.14 mmol) and KOH (46.4 mg, 0.827 mmol). The mixture was stirred at room temperature for 2 hours. The pH value was adjusted to pH 1 to 2 by adding 1N HCl to the mixture, and the mixture was extracted with DCM (4.00 mL×5). The combined organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by NH-SiO2 column chromatography (DCM: MeOH = 9: 1) to obtain a white solid compound BnH12018 (28.0 mg, 28%).

[0556] 1 H NMR (400MHz, Chloroform-d) δ10.04 (s, 1H), 7.52 (d, J=7.3Hz, 2H), 7.44 (dq, J=14.3, 7.3Hz, 3H), 4.71 (s, 1H), 3.60-3.48 (m, 2H), 2.54 (d, J=6.4Hz, 1H), 2.12 (d, J=13.3Hz, 2H), 1.93-1.81 (m, 1H).

[0557] (5) Synthesis of compound BnH12019

[0558] (S)-1-Benzoyl-N-hydroxypyrrolidine-2-carboxamide

[0559] Step 1: Synthesis of benzoyl-L-proline methyl ester

[0560] To a solution of benzoic acid (100 mg, 0.819 mmol) in DMF (2.73 mL) were added L-proline methyl ester (163 mg, 0.983 mmol), DIPEA (0.215 mL, 1.23 mmol), HOBt (133 mg, 0.983 mmol) and EDC·HCl (153 mg, 0.983 mmol). The mixture was stirred at room temperature for 3.5 hours. The mixture was diluted with EtOAc (4.00 mL) and washed with saturated NH4Cl aqueous solution (4.00 mL) and brine (4.00 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 2:1) to give the desired compound (145 mg, 75%) as a colorless oil.

[0561] Step 2: Synthesis of compound BnH12019

[0562] To a solution of benzoyl-L-proline methyl ester (140 mg, 0.600 mmol) in MeOH (3.00 mL) and THF (3.00 mL) were added hydroxylamine hydrochloride (0.354 mL, 6.00 mmol) and KOH (67.4 mg, 1.20 mmol). The mixture was stirred at room temperature for 2 hours. The pH value was adjusted to pH 1 to 2 by adding 1N HCl to the mixture, and the mixture was extracted with DCM (4.00 mL×5). The combined organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by NH-SiO2 column chromatography (DCM: MeOH = 9: 1) to obtain a white solid compound BnH12019 (38.0 mg, 27%).

[0563] 1 H NMR (400MHz, Chloroform-d) δ10.01 (s, 1H), 7.52 (d, J=7.2Hz, 2H), 7.44 (dq, J=14.5, 7.2Hz, 3H), 4.71 (t, J=6. 4Hz, 1H), 3.55 (dt, J=11.5, 6.2Hz, 2H), 2.54 (d, J=6.4Hz, 1H), 2.10 (dp, J=13.9, 7.1Hz, 2H), 1.93-1.82 (m, 1H).

[0564] Preparation Example 4. Preparation of active compounds according to representative reaction formula 5z

[0565] [Reaction 5]

[0566]

[0567]

[0568] (1) Synthesis of compound BnH12022

[0569] (3R,6S)-1-(2-(2-chloro-4-fluorophenyl)acetyl)-6-methylpiperidine-3-carboxamide

[0570] Step 1: Synthesis of compound BnH12022

[0571] CDI (77.5 mg, 0.478 mmol) was added to a suspension of compound BnH12001 enantiomer (3S, 6R) (100 mg, 0.319 mmol) in MeCN (3.43 mL) and stirred at room temperature for 20 minutes. NH4OH (0.186 mL, 4.78 mmol) was added to the mixture and the mixture was stirred at room temperature for 17 hours. The mixture was diluted with EtOAc (5.00 mL) and washed with saturated NH4Cl (4.00 mL), 10% citric acid (4.00 mL) and brine (4.00 mL). The organic layer was dried, filtered and concentrated with MgSO4. The residue was purified by column chromatography (5% MeOH in DCM) to give compound BnH12022 (84 mg, 84%) as a white solid.

[0572] 1 H NMR (400MHz, DMSO-d6) δ7.43-7.26 (m, 3H), 7.16 (tt, J=8.6, 2.3Hz, 1H), 6.89 (d, J=25.2H z, 1H), 4.69 (s, 0.5H), 4.32 (dd, J=20.4, 8.7Hz, 1H), 3.80 (ddd, J=36.3, 31.6, 16.2Hz, 2. 5H), 3.19-3.08(m, 0.5H), 2.65(t, J=12.6Hz, 0.5H), 2.33-2.21(m, 0.5H), 2.19-2.03(m, 0.5H), 1.76-1.67(m, 2H), 1.63-1.58(m, 1H), 1.54(s, 1H), 1.14(dd, J=61.2, 6.9Hz, 3H).

[0573] Preparation Example 5. Preparation of active compounds according to representative reaction formula 6

[0574] [Reaction 6]

[0575]

[0576]

[0577] (1) Synthesis of compound BnH12060

[0578] (S)-1-(2-Methylpiperidin-1-yl)-2-(pyridin-3-yl)ethan-1-one

[0579] Step 1: Synthesis of compound BnH12060

[0580] To a solution of 3-pyridylacetic acid (100 mg, 0.729 mmol) in DMF (2.43 mL) was added (S)-2-methylpiperidine (75.9 mg, 0.766 mmol), DIPEA (0.191 mL, 1.09 mmol), HOBt (118 mg, 0.875 mmol) and EDC·HCl (136 mg, 0.875 mmol). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with EtOAc (5.00 mL) and washed with saturated NH4Cl aqueous solution (5.00 mL) and brine (5.00 mL). The organic layer was dried over MgSO4, filtered and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (0 to 5% MeOH in DCM) to give BnH12060 (54.2 mg, 34%) as an orange oil.

[0581] 1 H NMR (400MHz, Chloroform-d) δ8.54-8.51 (dt, J=6.3, 3.1Hz, 2H), 7.69 (s, 1H), 7.33-7.30 (dd, J =7.9, 4.8Hz, 1H), 4.96 (s, 0.5H), 4.56-4.52 (d, J = 13.6Hz, 0.5H), 4.19 (s, 0.5H), 3.80-3.73 (m, 2H), 3.67-3.63 (d, J=14.1Hz, 0.5H), 3.17-3.10 (t, J=13.5Hz, 0.5H), 2.75-2.68 (t, J=13.4Hz, 0.5H), 1.63-1.56 (d, J=29.3Hz, 5H), 1.36-1.28 (d, J=34.4Hz, 1H), 1.21-1.16 (d, J=8.2Hz, 3H).

[0582] (2) Synthesis of compound BnH12061

[0583] (S)-1-(2-Methylpiperidin-1-yl)-2-phenylethan-1-one

[0584] Step 1: Synthesis of compound BnH12061

[0585] To a solution of 2-phenylacetic acid (100 mg, 0.734 mmol) in DMF (2.45 mL) were added (S)-2-methylpiperidine (76.5 mg, 0.771 mmol), DIPEA (0.192 mL, 1.10 mmol), HOBt (119 mg, 0.881 mmol) and EDC·HCl (137 mg, 0.881 mmol). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with EtOAc (5.00 mL) and washed with saturated NH4Cl aqueous solution (5.00 mL) and brine (5.00 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 2:1) to obtain a colorless oily compound BnH12061 (58.7 mg, 37%).

[0586] 1 H NMR (400MHz, Chloroform-d) δ7.35-7.23 (m, 5H), 5.01-4.97 (d, J=8.0Hz, 0.5H), 4.58-4.55 (d, J=13.6Hz, 0.5H), 4.17-4.13 (d, J=9.5Hz, 0.5H), 3. 74(s, 2H), 3.65-3.61(d, J=13.7Hz, 0.5H), 3.06-2.99(t, J=13.5Hz, 0.5H ), 2.71-2.65 (t, J=13.5Hz, 0.5H), 1.61-1.44 (m, 6H), 1.16-1.09 (m, 3H).

[0587] Preparation Example 6. Preparation of active compound according to representative reaction formula 7 (anhydrous form)

[0588] [Reaction 7]

[0589]

[0590]

[0591] (1) Synthesis of compound BnH12062 (3S,6R)-6-methyl-1-(2-phenylacetyl)piperidine-3-carboxylic acid

[0592] Step 1: Synthesis of (3S,6R)-6-methyl-1-(2-phenylacetyl)piperidine-3-carboxylic acid methyl ester To a solution of 2-phenylacetic acid (100 mg, 0.734 mmol) in DMF (2.45 mL) was added (3S,6R)-methyl-6-methylpiperidine-3-carboxylic acid methyl ester (anhydrous form) (121 mg, 0.771 mmol), DIPEA (0.192 mL, 1.10 mmol), HOBt (119 mg, 0.881 mmol) and EDC·HCl (137 mg, 0.881 mmol). The mixture was stirred at room temperature for 3 hours. The mixture was diluted with EtOAc (5.00 mL) and washed with saturated NH4Cl aqueous solution (5.00 mL) and brine (5.00 mL). The organic layer was dried over MgSO4, filtered and concentrated under reduced pressure. The residue was purified by SiO 2 column chromatography (n-hexane:EtOAc=3:1 to 2:1) to give the desired compound (110 mg, 54%) as a colorless oil.

[0593] Step 2: Synthesis of compound BnH12062

[0594] 1N NaOH (0.572 mL, 0.572 mmol) was added to a solution of (3S, 6R)-6-methyl-1-(2-phenylacetyl)piperidine-3-carboxylic acid methyl ester (105 mg, 0.381 mmol) in THF (1.32 mL). The mixture was stirred for 2 hours at room temperature. The mixture was diluted with H2O (2.00 mL) and washed twice with DCM (30.0 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (30.0 mL). The organic layer was washed with brine (3.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to obtain a white solid compound BnH12062 (50.5 mg, 51%).

[0595] 1H NMR (400MHz, DMSO-d6) δ12.42 (s, 1H), 7.33-7.30 (t, J=7.4Hz, 2H), 7.25-7.19 (dd, J=16.7, 7.8Hz, 3H), 4.74 (s, 0.5H), 4.55-4.52 (d, J = 13.4Hz, 0.5H), 4.24 (s, 0.5H), 3.90-3.86 (d, J = 13.8Hz, 0.5H), 3.78-3 .68 (t, J=5.8Hz, 2H), 2.99 (t, J=12.8Hz, 0.5H), 2.63-2.57 (d, J=12.5Hz, 0.5H), 2.17-2.08 (m, 1H), 1.7 9-1.76 (d, J=12.9Hz, 1H), 1.69-1.59 (m, 1H), 1.52-1.48 (d, J=13.9Hz, 2H), 1.05-1.03 (d, J=6.8Hz, 3H).

[0596] (2) Synthesis of compound BnH12063

[0597] (3S,6R)-1-(2-(4-methoxyphenyl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0598] Step 1: Synthesis of methyl (3S,6R)-1-(2-(4-methoxyphenyl)acetyl)-6-methylpiperidine-3-carboxylate

[0599] To a solution of 2-(4-methoxyphenyl)acetic acid (100 mg, 0.602 mmol) in DMF (2.01 mL) were added (3S, 6R)-6-methylpiperidine-3-carboxylic acid methyl ester (anhydrous form) (99.3 mg, 0.632 mmol), DIPEA (0.158 mL, 0.903 mmol), HOBt (97.6 mg, 0.722 mmol) and EDC·HCl (112 mg, 0.722 mmol). The mixture was stirred at room temperature for 1.5 hours. The mixture was diluted with EtOAc (5.00 mL) and washed with saturated NH4Cl aqueous solution (5.00 mL) and brine (5.00 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 2:1) to obtain the desired compound (85.2 mg, 46%) as a colorless oil.

[0600] Step 2: Synthesis of compound BnH12063

[0601] To a solution of (3S,6R)-1-(2-(4-methoxyphenyl)acetyl)-6-methylpiperidine-3-carboxylic acid methyl ester (85.2 mg, 0.279 mmol) in THF (1.44 mL) was added 1N NaOH (0.419 mL, 0.419 mmol). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with H2O (2.00 mL) and washed twice with DCM (30.0 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (30.0 mL). The organic layer was washed with brine (3.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to give a white solid compound BnH12063 (65.1 mg, 80%).

[0602] 1 H NMR (400MHz, DMSO-d6) δ12.42 (s, 1H), 7.16-7.10 (dd, J=18.6, 8.1Hz, 2H), 6.88-6.86 (d, J=8.5Hz, 2H), 4 .73 (s, 0.5H), 4.54-4.50 (m, 0.5H), 4.23 (s, 0.5H), 3.89-3.86 (d, J=14.4Hz, 0.5H), 3.73 (s, 3H), 3.66-3 .60 (m, 2H), 3.01-2.95 (t, J=12.8Hz, 0.5H), 2.62-2.59 (d, J=12.4Hz, 0.5H), 2.15-2.09 (m, 1H), 1.80-1. 76 (d, J=11.8Hz, 1H), 1.69-1.63 (m, J=13.4Hz, 1H), 1.51-1.43 (m, J=13.5Hz, 2H), 1.03 (d, J=6.9Hz, 3H).

[0603] (3) Synthesis of compound BnH12068

[0604] Sodium (3S,6R)-6-methyl-1-(2-(pyridin-3-yl)acetyl)piperidine-3-carboxylate

[0605] Step 1: Synthesis of methyl (3S,6R)-6-methyl-1-(2-(pyridin-3-yl)acetyl)piperidine-3-carboxylate

[0606] To a solution of 2-(pyridin-3-yl)acetic acid (100 mg, 0.729 mmol) in DMF (2.43 mL) was added (3S, 6R)-6-methylpiperidine-3-carboxylic acid methyl ester (anhydrous form) (120 mg, 0.766 mmol), DIPEA (0.191 mL, 1.09 mmol), HOBt (118 mg, 0.875 mmol) and EDC·HCl (136 mg, 0.875 mmol). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with EtOAc (5.00 mL) and washed with saturated NH4Cl aqueous solution (5.00 mL) and brine (5.00 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (DCM: MeOH = 0 to 5%) to give the desired compound (112 mg, 56%) as a light yellow oil.

[0607] Step 2: Synthesis of compound BnH12068

[0608] To a solution of (3S,6R)-6-methyl-1-(2-(pyridin-3-yl)acetyl)piperidine-3-carboxylic acid methyl ester (112 mg, 0.405 mmol) in THF (2.10 mL) was added 1N NaOH (0.608 mL, 0.608 mmol). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with H2O (5.00 mL) and washed twice with DCM (5.00 mL×2). The aqueous layer was concentrated under reduced pressure. The residue was purified by C18-SiO2 column chromatography (H2O:MeOH=1:0 to 4:1) to obtain a light blue solid compound BnH12068 (91.0 mg, 79%).

[0609] 1 H NMR (400MHz, DMSO-d6) δ8.43-8.39 (m, 2H), 7.63-7.57 (dd, J=15.5, 7.8Hz, 1H), 7.34 -7.30 (dt, J=8.2, 4.4Hz, 1H), 4.68 (s, 0.5H), 4.42-4.38 (d, J=14.4Hz, 0.5H), 4.20 (s , 0.5H), 3.81-3.68 (m, 2.5H), 2.99-2.92 (t, J=12.8Hz, 0.5H), 2.68 (s, 0.5H), 1.78- 1.66 (dd, J=18.2, 8.2Hz, 2H), 1.56-1.43 (m, 3H), 1.11-1.02 (dd, J=30.2, 6.9Hz, 3H).

[0610] Preparation Example 7. Preparation of active compounds according to methods other than the representative reaction formula

[0611] (1) Synthesis of BnH12001

[0612] 1-(2-(2-chloro-4-fluorophenyl)acetyl)-6-methylpiperidine-3-carboxylic acid

[0613]

[0614] Step 1: Compound 1 (200 mg, 1.06 mmol) was dissolved in 5 mL of dichloromethane (DCM), and oxalyl chloride (136 μL, 1.59 mmol) was added dropwise at 0°C for 5 minutes, followed by the addition of a catalyst and dimethylformamide (DMF) (1 drop). After stirring at room temperature for 6 hours, the mixture was concentrated under reduced pressure to obtain 219 mg of compound 2. The reaction was carried out to the next step without further purification.

[0615] Step 2: Compound 3 (166 mg, 1.06 mmol) was dissolved in 10 mL of DCM, and triethylamine (295 μL, 2.12 mmol) was added at 0°C. Compound 2 (219 mg, 1.06 mmol) was dissolved in 5 mL of DCM, and added dropwise at 0°C, and stirred at room temperature for 2 hours. After the reaction mixture was post-treated with DCM and water, a column filled with silica gel 60 (0.040 to 0.063 mm) (1.09385.9025, Merck) was used to obtain 131 mg of compound 4 (yield: 38%).

[0616] Step 3: Dissolve compound 4 (131 mg, 400 μmol) in 5 mL of tetrahydrofuran (THF) / methanol (1:1). Add 1N-NaOH (800 μL, 800 μmol) and stir at room temperature for 12 hours. After the reaction is completed, adjust the pH to 3 using 1N-HCl, extract with ethyl acetate and concentrate under reduced pressure. 34 mg of the target compound 5 (yield: 27%) was obtained from the obtained reaction mixture using prep TLC. The identity was confirmed by NMR spectroscopy: 1 H NMR (CDCl3, 400MHz): δ7.22 (1H, m), 7.08 (1H, m), 6.91 (1H, bs), 4.75 (1H, m), 3.86 (1H, m), 3. 71(2H,m), 3.01(1H,m), 2.28(1H,m), 1.91(1H,bs), 1.74(1H,m), 1.58(1H,bs), 1.13(3H,m).

[0617] (2) Synthesis of BnH12001 enantiomer (3S, 6R, 98%<)

[0618]

[0619] Step 1: Preparation of methyl (3S,6R)-1-(2-(2-chloro-4-fluorophenyl)acetyl)-6-methylpiperidine-3-carboxylate

[0620] 2-(2-chloro-4-fluorophenyl)acetic acid (1.7 kg), (3S,6R)-methyl 6-methylpiperidine-3-carboxylate (1.05 eq.), DIPEA (1.5 eq.), HOBt (0.3 eq.) and EDC HCl (1.2 eq.) were added to a 2-MeTHF (10 V) solution. The mixture was heated at 25° C. to 35° C. for 1.3 hours. The mixture was washed twice with H2O (5 V) to obtain (3S,6R)-1-(2-(2-chloro-4-fluorophenyl)acetyl)-6-methylpiperidine-3-carboxylic acid methyl ester with a purity of 99.6%.

[0621] Step 2: Preparation of BnH12001 enantiomer (3S, 6R, 98% <)

[0622] Methyl (3S,6R)-1-(2-(2-chloro-4-fluorophenyl)acetyl)-6-methylpiperidine-3-carboxylate was scaled up to 2.953 kg. Methyl (3S,6R)-1-(2-(2-chloro-4-fluorophenyl)acetyl)-6-methylpiperidine-3-carboxylate was added to 2-MeTHF (10 V) along with 1 N NaOH (1.3 eq.). The mixture was heated at 25° C. for 3 hours. Crystallization in 2-MeTHF / n-heptane produced 2.754 kg of (3S,6R)-1-(2-(2-chloro-4-fluorophenyl)acetyl)-6-methylpiperidine-3-carboxylic acid with an impurity content of less than 0.1%.

[0623] Step 3: Purification of BnH12001 enantiomer (3S, 6R, 98%<)

[0624] (3S,6R)-1-(2-(2-chloro-4-fluorophenyl)acetyl)-6-methylpiperidine-3-carboxylic acid (2.57 kg) was added to EA (5 V) and n-heptane (15 V). The mixture was heated from 0°C to 45°C to produce a white solid, i.e., 2.404 kg of a dry cake.

[0625] (3) Synthesis of compound BnH12010

[0626] (3R,6S)-1-(2-Chloro-4-fluorophenethyl)-6-methylpiperidine-3-carboxylic acid

[0627]

[0628] Step 1: 2-Chloro-4-fluorophenethyl 4-benzenesulfonic acid methyl ester (e)

[0629] To a solution of p-toluenesulfonyl chloride (240 mg, 2.21 mmol), DMAP (24.5 mg, 0.200 mmol) and TEA (0.503 mL, 3.61 mmol) in DCM (3.00 mL) at 0°C was added 2-(2-chloro-4-fluorophenyl)ethanol (350 mg, 2.001 mmol) and stirred at room temperature for 17 hours. The mixture was diluted with EtOAc (5.00 mL) and washed with H2O (5.00 mL×3). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by column chromatography (n-hexane: EtOAc=10:1) to give the desired compound (523 mg, 79%) as a colorless oil.

[0630] Step 2: (3R,6S)-1-(2-chloro-4-fluorophenethyl)-6-methylpiperidine-3-carboxylic acid methyl ester (f)

[0631] To a solution of 2-chloro-4-fluorophenethyl 4-benzenesulfonic acid methyl ester (200 mg, 0.608 mmol) in DMF (3.00 mL) were added K2CO3 (252 mg, 1.83 mmol) and (3R, 6S)-rel-6-methyl-3-piperidinecarboxylic acid methyl ester (76.5 mg, 0.487 mmol). The mixture was stirred at 110°C for 17 hours. The mixture was diluted with EtOAc (4.00 mL) and washed with H2O (4.00 mL×3). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by column chromatography (n-hexane: EtOAc = 10: 1) to obtain the desired compound (63.0 mg, 33%) as a colorless oil.

[0632] Step 3: Synthesis of compound BnH12010

[0633] 1N NaOH (0.287 mL, 0.287 mmol) was added to a solution of (3R, 6S)-1-(2-chloro-4-fluorophenethyl)-6-methylpiperidine-3-carboxylic acid methyl ester (60.0 mg, 0.191 mmol) in THF (0.659 mL). The mixture was stirred at room temperature for 2 hours. The mixture was diluted with H2O (1.50 mL) and washed twice with DCM (2.00 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (2.00 mL). The organic layer was washed with brine (2.00 mL), dried over MgSO4, filtered, and concentrated under reduced pressure. Et2O (1.00 mL) was added to the residue and stirred at room temperature for 30 minutes. The filtered precipitate was washed with Et2O (2.00 mL) to obtain compound BnH12010 (42.0 mg, 73%) as a white solid.

[0634] 1H NMR (400MHz, Chloroform-d) δ7.21 (dd, J=8.5, 6.1Hz, 1H), 7.12 (dd, J=8.5, 2.7Hz, 1H), 6.92 (td, J=8.3, 2.7Hz, 1H), 4.41 (s, 1H), 4.30 (t, J=6.7Hz, 2H), 4 .21 (s, 1H), 3.06 (t, J=6.7Hz, 2H), 2.94 (dd, J=13.7, 12.0Hz, 1H), 2.39 (d, J= 13.1Hz, 1H), 1.95 (t, J=7.9Hz, 1H), 1.84-1.52 (m, 3H), 1.12 (d, J=6.9Hz, 3H).

[0635] (4) Synthesis of compound BnH12021

[0636] (3R,6S)-1-(2-(2-chloro-4-fluorophenyl)acetyl)-6-methylpiperidine-3-carboxylic acid ethyl ester

[0637]

[0638] Step 1: Synthesis of ethyl (3R,6S)-1-(2-(2-chloro-4-fluorophenyl)acetyl)-6-methylpiperidine-3-carboxylate

[0639] To a solution of compound BnH12001 enantiomer (3S, 6R) (70.0 mg, 0.223 mmol) in DCM (1.01 mL) was added a catalytic amount of DMF and oxalyl chloride (0.057 mL, 0.669 mmol). The mixture was stirred at room temperature for 2 hours and concentrated under reduced pressure. The residue was dissolved in DCM (1.01 mL) and EtOH (0.065 mL, 1.12 mmol) was added. The mixture was stirred at room temperature for 1 hour and washed with saturated NaHCO3 aqueous solution (2.00 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 3:1) to obtain compound BnH12021 (37.0 mg, 48%) as a colorless oil.

[0640] 1H NMR (400MHz, Chloroform-d) δ7.14 (dd, J=8.9, 2.6Hz, 1H), 6.96 (td, J=8.4, 2.7Hz, 1H), 4.9 6(s, 0.5H), 4.78(d, J=13.4Hz, 0.5H), 4.15(q, J=7.2Hz, 2.5H), 3.88-3.69(m, 2.5H), 3.21(t , J=13.0Hz, 0.5H), 2.79 (t, J=12.9Hz, 0.5H), 2.36 (d, J=12.6Hz, 0.5H), 2.23 (d, J=11.2Hz, 0 .5H), 1.93 (d, J=13.0Hz, 1H), 1.78 (d, J=14.8Hz, 1H), 1.71-1.61 (m, 2H), 1.34-1.09 (m, 6H).

[0641] (5) Synthesis of compound BnH12094

[0642] 1-(2-(2-chloro-4-fluorophenyl)acetyl)-6-ethylpiperidine-3-carboxylic acid

[0643]

[0644] Step 1: Synthesis of 6-ethylnicotinate (o)

[0645] To a solution of ethyl 6-chloronicotinate (2.20 g, 11.9 mmol) in anhydrous THF (60.0 mL) was added Fe(acac)3 (460 mg, 1.30 mmol) and NMP (1.60 mL, 16.6 mmol). The mixture was cooled to -78°C and ethylmagnesium bromide was added dropwise. After stirring at -78°C for 1 hour, the reaction mixture was quenched with H2O (50.0 mL) at 0°C and extracted with EtOAc (50.0 mL). The organic layer was dried over Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 1:0 to 9:1) to obtain the desired compound (2.04 g, 96%) as a light yellow oil.

[0646] Step 2: Ethyl 6-ethylpiperidine-3-carboxylate (p)

[0647] To a solution of ethyl 6-ethylnicotinate (2.04 g, 11.4 mmol) in EtOH (20.0 mL) was added acetic acid (2.07 mL, 11.4 mol) and Pd / C (848 mg, 7.97 mmol). Purge with H2 gas 3 times and stir under H2 gas at 65 °C for 24 hours. After cooling to room temperature, the reaction mixture was filtered through celite and washed with MeOH (30.0 mL). The filtrate was concentrated under reduced pressure and used without further purification.

[0648] Step 3: Ethyl 1-(2-(2-chloro-4-fluorophenyl)acetyl)-6-ethylpiperidine-3-carboxylate (BnH12094-1)

[0649] To a solution of 2-(2-chloro-4-fluorophenyl)acetic acid (450 mg, 2.39 mmol) in DMF (8.00 mL) was added ethyl 6-ethylpiperidine-3-carboxylate (464 mg, 2.51 mmol), DIPEA (0.623 mL, 3.58 mmol), HOBt (387 mg, 2.86 mmol) and EDC·HCl (549 mg, 2.86 mmol). The mixture was stirred at room temperature for 3 hours. The reaction mixture was diluted with EtOAc (20.0 mL) and washed with saturated aqueous NH4Cl solution (20.0 mL) and brine (20.0 mL). The organic layer was dried over Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 1:0 to 2:1 and DCM Purification by 0 to 3% MeOH (2% HCl) gave the desired compound (121 mg, 24%, 2 steps) as a colorless oil.

[0650] Step 4: Synthesis of compound BnH12094

[0651] 1N NaOH (0.970 mL, 0.970 mmol) was added to a solution of 1-(2-(2-chloro-4-fluorophenyl)acetyl)-6-ethylpiperidine-3-carboxylic acid ethyl ester (115 mg, 0.323 mmol) in THF (3.00 mL). The mixture was stirred at 50°C for 17 hours. The reaction mixture was diluted with H2O (5.00 mL) and washed twice with DCM (5.00 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (5.00 mL). The organic layer was dried with Na2SO4, filtered, and concentrated under reduced pressure. The residue was dissolved in EtOAc (2.00 mL), and n-hexane (10.0 mL) was added. The generated solid was filtered and washed with n-hexane (5.00 mL) to obtain white solid compound BnH12094 (82.0 mg, 77%).

[0652] 1 H NMR (400MHz, DMSO-d6) δ12.43 (s, 1H), 7.42-7.23 (m, 2H), 7.17 (td, J=8.5, 2.8Hz, 1H), 4.54-4.47 (m, 1H), 3.96-3.70 (m, 2.5H), 3.25-3.21 (m, 0. 5H), 3.07(t, J=12.9Hz, 0.5H), 2.66-2.53(m, 1H), 2.39-2.33(m, 0.5H), 2.24-2.18(m, 0.5H), 1.84-1.40(m, 5.5H), 0.82(dt, J=42.2, 7.3Hz, 3H).

[0653] (6) Synthesis of compound BnH12096

[0654] 1-(2-(2-chloro-4-fluorophenyl)acetyl)-6-isopropylpiperidine-3-carboxylic acid

[0655]

[0656] Step 1: 6-isopropylnicotinate (r)

[0657] To a solution of ethyl 6-chloronicotinate (300 mg, 1.62 mmol) in anhydrous THF (8.00 mL) was added Fe(acac)3 (62.8 mg, 0.178 mmol) and NMP (0.218 mL, 2.26 mmol). The mixture was cooled to -78 °C and isopropylmagnesium bromide was added dropwise. After stirring at -78 °C for 1 hour, the reaction mixture was quenched with H2O (10.0 mL) at 0 °C and extracted with EtOAc (10.0 mL). The organic layer was dried over Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (DCM: n-hexane = 1:1 and n-hexane: EtOAc = 9:1) to obtain the desired compound (170 mg, 54%) as a bright yellow oil.

[0658] Step 2: Ethyl 6-isopropylpiperidine-3-carboxylate(s)

[0659] To a solution of ethyl 6-isopropylnicotinate (165 mg, 0.854 mmol) in EtOH (2.00 mL) was added acetic acid (0.155 mL, 0.854 mol) and Pd / C (63.6 mg, 0.598 mmol). The mixture was purged with H2 gas 3 times and stirred under H2 gas at 65 °C for 17 hours. After cooling to room temperature, the reaction mixture was filtered through celite and washed with MeOH (5.00 mL). The filtrate was concentrated under reduced pressure and used without further purification.

[0660] Step 3: 1-(2-(2-chloro-4-fluorophenyl)acetyl)-6-isopropylpiperidine-3-carboxylic acid ethyl ester (BnH12096-1)

[0661] To a solution of 2-(2-chloro-4-fluorophenyl)acetic acid (270 mg, 1.43 mmol) in DMF (5.00 mL) were added ethyl 6-isopropylpiperidine-3-carboxylate (300 mg, 1.51 mmol), DIPEA (0.375 mL, 2.15 mmol), HOBt (233 mg, 1.72 mmol) and EDC·HCl (330 mg, 1.72 mmol). The mixture was stirred at room temperature for 16 hours. The reaction mixture was diluted with EtOAc (15.0 mL) and washed with saturated NH4Cl aqueous solution (15.0 mL) and brine (15.0 mL). The organic layer was dried over Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by SiO2 column chromatography (n-hexane: EtOAc = 4:1 to 2:1) to give the desired compound (176 mg, 54%, 2 steps) as a light yellow oil.

[0662] Step 4: Synthesis of compound BnH12096

[0663] 1-(2-(2-chloro-4-fluorophenyl)acetyl)-6-isopropylpiperidine-3-carboxylic acid ethyl ester (176 mg, 0.476 mmol) in THF (1.64 mL) was added 1N NaOH (0.714 mL, 0.714 mmol). The mixture was stirred at 50°C for 4 hours. The reaction mixture was diluted with H2O (3.00 mL) and washed twice with DCM (3.00 mL×2). The aqueous layer was acidified to pH 1 to 2 with 1N HCl at 0°C and extracted with EtOAc (30.0 mL). The organic layer was dried over MgSO4, filtered, and concentrated under reduced pressure. Et2O (4.00 mL) was added to the residue and stirred at room temperature for 30 minutes. The filtered precipitate was washed with Et2O (3.0 mL) to obtain a white solid compound BnH12096 (102 mg, 63%).

[0664] 1H NMR (400MHz, DMSO-d6) δ12.44 (s, 1H), 7.42-7.23 (m, 2H), 7.17 (td, J=8.5, 2.8Hz, 1H), 4.5 4 (dd, J=13.2, 4.3Hz, 0.5H), 4.23-4.13 (m, 0.5H), 4.01-3.67 (m, 2.5H), 3.57 (dd, J=10.7, 4.5Hz, 0.5H), 3.05 (dd, J=14.1, 11.9Hz, 0.5H), 2.45-2.31 (m, 0.5H), 2.30-1.96 (m, 1.5H) , 1.87 (dd, J=28.7, 12.7Hz, 2H), 1.74-1.58 (m, 1H), 1.55-1.32 (m, 1H), 1.06-0.66 (m, 6H).

[0665] Example

[0666] The following biological assays were performed using the compounds obtained in the above preparation examples.

[0667] Example 1. Cell culture and maintenance

[0668] Human undifferentiated neuroblastoma cell line SH-SY5Y and human embryonic kidney cell line (HEK)-293T were purchased from the Korean Cell Line Bank (Korea) and Takara (Japan), respectively. The cells were cultured in HyClone Minimal Essential Medium (MEM) and Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% (v / v) fetal bovine serum (FBS), penicillin (100U / mL) and streptomycin (100mg / mL), respectively. The cells were maintained at 37°C, a humidified atmosphere of 95% air and 5% CO2. The cells were passaged up to 10 times. The cells were dissociated using 0.05% trypsin-EDTA solution and seeded into new culture dishes for maintenance.

[0669] On the one hand, primary cortical neuron cells were dissociated from the cerebral cortex of 18-day-old mouse fetuses, incubated in a prep media (composition (mM): NaCl 107.5, NaH2PO4 1, NaHCO3 33.5, glucose 11, HEPS 1%, penicillin-streptomycin 1%) containing 0.25% trypsin and DNase1dl for 30 minutes, dissociated into single cells and plated. Primary cortical neuron cells were grown in Neurobasal medium supplemented with 1% (v / v) B27, 1% penicillin (100U / mL), streptomycin (100mg / mL) and 1% glutamine (Glutamax). Cells were maintained at 37°C in a humidified atmosphere of 95% air and 5% CO2. The efficacy of the drug was evaluated after 14 days of culture of primary cortical neuron cells.

[0670] Example 2. Cytotoxicity Experiment

[0671] In order to investigate the cytotoxicity of the compounds described in this specification in human cell lines, SH-SY5Y and 293T cells were used. Approximately 8,000 cells (293T cells) and 15,000 cells (SH-SY5Y cells) were plated in each well of a 96-well plate (SPL Life Sciences Co., Ltd., Pocheon, South Korea). After incubation at 37 ° C for 24 hours in a humidified atmosphere containing 5% CO2, the culture medium was replaced with a series of experimental compounds diluted in the corresponding culture medium. The total incubation time was 24 hours, and each assay was repeated six times. Finally, 10 μL of CCK-8 reagent (Dojindo Laboratories, Rockville, Maryland, USA) was added to each well, and after incubation at 37 ° C for 3 minutes, a multifunctional microplate reader (Tecan Infinite M200 Pro) was used to measure the OD at 450nm. These measured values ​​were compared with those of the control group, and expressed as a percentage of the control group to calculate cell viability. IC was calculated using SPSS software 50 To do this, the absorbance of the blank wells containing only growth medium was subtracted from the value of the wells containing cells. The background (vehicle) reading was set as 100% viability, and the percent viability of each experimental solution was then calculated.

[0672] Cell survival rate (%) = [(As-Ab) / (Ac-Ab)] × 100

[0673] Data are presented as mean and standard error of the mean (SEM). Statistical analysis was performed using one-way analysis of variance (ANOVA) and Tukey post hoc test (GraphPad Prism 5 software package, version 5.02, GraphPad Software Inc. USA). P < 0.05 was considered significant.

[0674] Example 3. Determination of expression level of BDNF and / or GluN2B

[0675] Example 3.1. RT-PCR

[0676] RT-PCR was used to determine the amount of BDNF and GluN2B in response to the compounds of the invention. 293T cells were dissociated using 0.05% trypsin-EDTA solution and seeded in 24-well or 6-well plates for RNA work. After incubation for 24 hours at 37°C in a humidified atmosphere with 5% CO2, the culture medium was replaced with a culture medium containing a series of concentrations of the experimental compound diluted in DMEM without FBS. Time lapse experiments were performed. The same amount of DMSO was used as a negative control group.

[0677] After compound treatment, RNA was isolated from cells. After removing the growth medium, 1 × 10 5 Up to 10 7 For each cell, add 0.3 to 0.4 mL of TRIzol TM Add directly to the culture dish to lyse the cells. After incubation at 4°C for 10 minutes, centrifuge the sample at 12,000 × g for 10 minutes at 4°C. The total RNA precipitates to form a white gel-like pellet at the bottom of the tube. After discarding the supernatant, place the pellet in 1 mL of TRIzol for each 1 mL of lysis solution. TM Resuspend in 1 mL of 75% ethanol. After briefly vortexing the sample, centrifuge the sample at 7500 × g for 5 min at 4 °C. Discard the supernatant with a micropipette and vacuum or air dry for 5 to 10 min. Resuspend the pellet in 20 to 50 μL of RNase-free water. TM μDrop TM The RNA concentration was determined by measuring the A230 / 260 and A260 ratios.

[0678] On ice, combine the experimental RNA (up to 1 μg in 4 μl) and 1 μl (100 pmol) of oligo dT primer in nuclease-free water for a final volume of 5 μl for each RT reaction. After sealing each RNA tube, place the tube at 70°C (in a PCR machine) for 5 minutes. After removing the tube, immediately cool the tube in ice water for at least 5 minutes. Centrifuge each tube in a microcentrifuge for 10 seconds to collect the condensate and maintain the original volume. Keep the tubes sealed and on ice until the reverse transcription reaction mixture is added. The reverse transcription reaction mixture is prepared as follows.

[0679] DW 4.9ul 5x RT buffer 4ul <![CDATA[25mM MgCl2]]> 1.6ul (final 2.6mM) 10mM dNTP (2.5mM each) 3ul (final 0.5mM per dNTP) RNasin (40u / ul) 0.5ul (final 20u) RT 1ul total 15ul / tube

[0680] Reverse transcription was performed using Improm-II reverse transcriptase (A3803) (Promega) and recombinant RNasin Ribonuclease Inhibitor (N2515) (Promega) according to the manufacturer's instructions. A 15 μl aliquot of the reverse transcription reaction mixture was added to each reaction tube on ice and the reaction tube was returned to the PCR instrument. The PCR conditions were as follows:

[0681] 25°C, 5 minutes (annealing) → 42°C, 60 minutes (extension) → 70°C, 15 minutes (inactivation at RT) → maintain at 4°C

[0682] PCR products were analyzed by agarose gel electrophoresis. A housekeeping gene (ACTIN) was used as a PCR control. Repeat experiments were performed with samples to confirm the validity of the observed changes in RNA levels. The primer sequences used were as follows:

[0683] h-GluN2B-positive CTTCCATTTACCCTGCCTCA h-GluN2B-reverse CATTGCCTCTAGCTCCCTTG h-BDNF-positive CATCCGAGGACAAGGTGGCTTG h-BDNF-reverse GCCGAACTTTCTGGTCCTCATC h-ActinB-Forward CACCAACTGGGACGACAT h-ActinB-Reverse ACAGCCTGGATAGCAACG

[0684] Example 3.2. Western blotting

[0685] The amount of GluN2B reacting with the compound of the present invention was determined by Western blotting. Fetal cerebral cortex was removed from mice at 17 days of gestation, dissociated into single cells, cultured for 13 days, and treated with BnH drug for 24 hours. Protein lysate was prepared from drug-treated cells using RIPA protein lysis buffer containing protease and phosphatase inhibitors. Protein concentration was determined using BCA protein detection kit (Pierce Biotechnology) with bovine serum albumin as standard. Equal amounts of protein (20 μg per lane) were dissociated from 90V SDS-polyacrylamide gel by 2 hours of electrophoresis, and then transferred from SDS-polyacrylamide gel to PVDF membrane at a voltage of 100V for 1 hour, and primary reaction was performed with GluN2B antibody (ab65783, Abcam) for 1 day at 4°C, washed 3 times with 1×PBT every 10 minutes, and secondary reaction was performed with anti-mouse antibody (sc-2357, SantaCruz) for 1 hour, and washed three times with 1×PBT every 10 minutes. Western blotting was performed by the method described above to confirm GluN2B protein expression. Each blot was subsequently re-probed with an anti-β-actin antibody (sc-47778, Santa Cruz). The housekeeping protein β-actin was detected as a normalization control.

[0686] As a result, as shown in Table 6, changes in the protein expression of GluN2B were confirmed in various BnH12 series compounds.

[0687] Data analysis

[0688] The solvent control was set to 1, and the increase or decrease of the BnH12 series was confirmed (N for each group should be 3 or more).

[0689] Example 4. Synaptic function experiment

[0690] Example 4.1. Os pump implantation

[0691] 8-week-old male C57BL / 6J mice were anesthetized with isoflurane during surgery. Then, mice were placed in a stereotaxic frame (RWD Life Science, China). A sagittal incision was made to the scalp at the midline from the eye level to the occipital protuberance to expose the parietal and frontal bones. A small hole (burr hole) was drilled after exposing the skull. The injection cannula was placed at the following coordinates: (mice: bregma -3.30, lateral -1.50y and ventral 0.7mm). A sterile saline solution (+ / - compound of the present invention) was infused at a constant flow rate of 0.5 μL / h through the injection cannula using a mini-Os pump (DURECT Corporation ALZETOsmotic Pumps, California, USA). Implantation was performed in the 4th layer of the ipsilateral barrel cortex. In order to estimate the diffusion degree of the injected compound in the 4th layer of the barrel cortex during the pump injection process, methylene blue was first injected to dye the diffusion area. On average, methylene blue diffused to 2000.0 μm from the injection site (the total area of ​​the barrel cortex region is approximately 1500 μm).Based on this analysis, the barrel cortex area was recorded.

[0692] Example 4.2. Oral administration of compounds

[0693] 2 mg of BnH12001 was dissolved in 800 ul of DMSO to prepare a stock solution. For oral administration, BnH12001 DMSO stock: PEG400: saline = 5:55:40 was mixed and administered to each animal. As a control group, a solvent control was prepared by mixing DMSO:PEG400:saline = 5:55:40, and 200ul was administered to each animal. In the single drug administration experiment, the compound was administered once a day at a dose of 1 mg / kg for about 11 to 12 days. A dose response experiment was performed by administering once a day at a dose of 0.03, 0.1, 0.3, 1, 3 and 10 mg / kg for about 11 to 12 days. Five mice were taken from each compound administration group and control group.

[0694] Example 4.3. Intraperitoneal injection of compounds

[0695] The compound was diluted to 25 mg / kg using DMSO:PEG400:saline (5:55:40). The compound was injected intraperitoneally at 10 am every day (the intraperitoneal injection volume was ), for about 11 to 12 days. The control group was also administered with a solvent control (DMSO:PEG400:saline (5:55:40)) by intraperitoneal injection in the same manner. Five mice were used for each of the compound administration group and the control group.

[0696] Example 4.4. Intravenous injection of compounds

[0697] 1 mg / ml of aducanumab or control antibody was used as a stock solution. Tail vein injection was used for intravenous injection. The dosage of aducanumab was 5 mg / kg. The control antibody used an antibody inactivated by aducanumab, and the dosage was 5 mg / kg. In the drug injection experiment, the compound was administered once a day for about 11 to 13 days. Five mice were used in the compound administration group and the control group, respectively.

[0698] Example 4.5. Preparation of thalamocortical (TC) or hippocampal slices

[0699] To prepare TC or hippocampal slices, 9- to 10-week-old male C57BL / 6J mice were anesthetized with isoflurane. Then, the brain was rapidly cooled by cardiac perfusion with ice-cold artificial cerebrospinal fluid (sucrose aCSF). The brain was removed and placed in ice-cold sucrose aCSF. A coronal section (paracoronal) was prepared at a 10° angle on a ramp at a 50° angle to the midline. Then, the slices were incubated in aCSF at 35°C for 30 minutes for recovery. Then, before being placed in the experimental recording chamber, the slices were incubated in aCSF at room temperature (23 to 25°C) for 1 to 4 hours. Standard aCSF contains saturated 95% O2 / 5% CO2. The mouse brain was removed and cut into 400um at a 50° angle (mice at a 55° angle) and attached to the vibrating microtome plate in a way that the cut portion was at the bottom. Incubate the brain slices in aCSF solution at 35 °C for 30 min or in aCSF solution at room temperature for 1 h.

[0700] Composition of sucrose-based aCSF

[0701]

[0702] Recording the composition of aCSF (room temperature: RT)

[0703]

[0704] Example 4.6. Electrophysiological experiments in barrel cortex

[0705] All electrophysiological experiments were performed at 27 to 29 °C. For electrophysiological experiments, electrodes with a resistance of 3.5 to 4.2 mΩ were used, and stimulation was applied to the ventral posteromedial nucleus (VPM) using concentric bipolar electrodes (FHC, Bowdoin, ME, USA). The somatosensory cortex was confirmed by the presence of barrels under 4× magnification and differential interference contrast (DIC) optics and the ability to evoke short and constant latency field excitatory postsynaptic potentials (fEPSPs) by VPM stimulation. Whole-cell voltage-clamp recordings were performed from stellate cells (SC) in layer IV of the somatosensory barrel cortex using infrared illumination and differential interference contrast (DIC) optics. The composition of the whole-cell recording solution is shown below:

[0706] Whole-cell recording internal solution

[0707]

[0708] Whole-cell recordings were performed using a Multiclamp 700A (Molecular devices, Sunnyvale, CA, USA) with a digitization frequency of 10 kHz and a filter frequency of 2 kHz. Input resistance and series resistance were monitored during recordings as previously described (Isaac, Crair, Nicoll, & Malenka, 1997, Silent synapses during development of thalamocortical inputs, DOI: 10.1016 / s0896-6273(00)80267-6). TC EPS were evoked by VB stimulation at 0.1 Hz and were considered monosynapses if they showed a short and constant latency that did not change with increasing stimulus intensity, as described previously (refer to [Feldman, Nicoll, Malenka, & Isaac, 1998, Synaptic plasticity at thalamocortical synapses in developing rat somatosensorycortex: LTP, LTD, and silent synapses, https: / / doi.org / 10.1002 / (SICI)1097-4695(199910)41:1<92:AID-NEU12>3.0.CO;2U; Isaac et al., 1997, Silent Synapses during Development of Thalamocortical Inputs, https: / / doi.org / 10.1016 / S0896-6273(00)80267-6]).

[0709] For the minimum stimulation protocol (efficacy), the VB thalamus stimulation intensity was adjusted to find the lowest intensity that triggered a mixture of synaptic responses and failures. The failure rate was calculated by the number of failures / total number of attempts. The efficacy was calculated by the average EPSC peak amplitude excluding failures (reference [Chittajallu and Isaac, 2010, Emergence of cortical inhibition by coordinated sensory-driven plasticity at distinct synaptic loci, DOI: 10.1038 / nn.2639]; reference [Isaac et al., 1997, Silent Sy napses during Development of Thalamocortical Inputs, https: / / doi.org / 10.1016 / S08966273(00)80267-6]; reference [Stevens & Wang, 1995, Facilitation and depression at single central synapses, DOI: 10.1016 / 08966273(95)90223-6]).

[0710] As previously reported, the criteria for single axon stimulation were all or no synaptic events and no change in the mean EPSC amplitude induced by a small increase in stimulation intensity (referents [Chittajallu and Isaac, 2010, Emergence of cortical inhibition by coordinated sensory-driven plasticity at distinct synaptic loci, DOI: 10.1038 / nn.2639]; [Gil et al., 1999, Effect of Thalamocortical and Intracortical Synaptic Connections: Quantum, Innervation, and Reliability, https: / / doi.org / 10.1016 / S0896-6273(00)80788-6]). The assay parameters were as follows:

[0711] Measurement parameters

[0712]

[0713] Excitatory postsynaptic potentials (EPSCs) were recorded by the whole-cell patch clamp method using a patch clamp amplifier (Molecular Devices, USA). The measuring electrode was a borosilicate glass capillary with a resistance of 3.5MΩ to 4.2MΩ when the electrode was filled with solution. The intracavitary brain slice was placed on an upright microscope and fixed with an anchor to record the flow of aCSF solution at a rate of 5 to 10mL / min under gravity. The electrodes of the stimulator were placed at the connection between the thalamic fibers and the S1 barrel cortex (layer 4) area, and the cells in this area were found and recorded. After the whole-cell patch, the membrane voltage was fixed at -70mV (to measure the AMPA current), stimulation was applied to determine the EPSC, and the stimulator was operated to find the minimum stimulation intensity at which the current on / off became 50%. The amplitude was measured by recording and current trajectories for 3 minutes and 20 seconds or 8 minutes and 20 seconds (a total of 20 or 50 trajectories). For efficacy, EPSC magnitude was set to 50 to 100 pA at -70 mV, and 5 traces were measured at 0 mV.

[0714] Example 4.7. Electrophysiological Experiments of Hippocampus

[0715] Using an extracellular glass pipette (3.5MΩ) filled with aCSF, field recording was performed with concentric bipolar electrodes located in the stratiform layer of the CA1 region. Specifically, fEPSP was induced by Schaffer collateral (SC) / commissural fibers using concentric bipolar electrodes placed 200 to 300 μm from the recording pipette. Stimulation was performed by bipolar electrodes (FHC, Bowden, Maine, USA) configured in Schaffer collateral-CA1 (SC). The SC circuit was visualized using a 4× magnification and differential interference contrast (DIC) microscope, and the ability to induce short and constant latency field excitatory postsynaptic potentials (fEPSP) at CA1 synapses was confirmed by SC input stimulation. In all fEPSP experiments, the experimental stimulus (30 μA) was determined before starting all experiments, and an experimental pulse stimulus intensity of 50% of the maximum fEPSP was used. Baseline synaptic responses were recorded for 30 minutes, and then long-term potentiation (LTP) was induced by high-frequency stimulation (HFS, 100 Hz, 4 trains, 1 s duration, 20 s interval between trains). Recordings were made every 10 seconds for 1 hour using a multiclamp 700A amplifier (Molecular Devices, San Jose, CA, USA) and pClamp10.0 software (Molecular Devise, San Jose, CA, USA), with a digitization frequency of 10 kHz and a filter frequency of 2 kHz using a Digidata 1440. The assay parameters were as follows:

[0716] Measurement parameters

[0717]

[0718] Excitatory postsynaptic potentials (EPSCs) were recorded by whole-cell patch clamp using a patch clamp amplifier (Molecular Devices, USA). The electrodes used for measurement were borosilicate glass capillaries with a resistance of 3.5 MΩ to 4.2 MΩ when the electrode was filled with solution. The intracavitary brain slices were placed on an upright microscope and fixed with anchors to record the flow of aCSF solution at a rate of 5 to 10 mL / min under gravity. The electrodes of the stimulator were placed in the SC region, and the connection sites in the CA1 region were found and recorded. As the intensity of stimulation increased, the point was recorded until the fEPSP no longer increased or a pop spike appeared (I / O curve). The baseline synaptic response was recorded for 20 minutes, and then long-term potentiation (LTP) was induced by high-frequency stimulation (HFS, 100 Hz, 4 times of culture, duration 1 s, culture interval 20 s / TBS; 100 Hz, 10 times of culture, duration 50 ms, culture interval 200 ms). Next, the recording was performed for 60 minutes (LTP).

[0719] Example 4.8. Data Analysis

[0720] For efficacy analysis, the Clampfit program (Axon Instruments) was used. The baseline was set by specifying intervals between 0 and 100 ms. Traces were averaged by selecting "On" currents occurring between 110 and 200 ms. Averaged traces were examined for negative current amplitudes (pA).

[0721] Analyze GABA / AMPA ratios using Clampfit. For AMPA currents, set the baseline by specifying intervals between 0 and 100 ms. Average the data traces from 110 to 200 ms. Confirm the negative current amplitude (pA) of the average trace. For GABA currents, set the baseline by specifying intervals between 0 and 100 ms. Average the data traces from 110 to 300 ms. Confirm the positive current amplitude (pA) of the average trace.

[0722] I / O curves were calculated using Clampfit. The baseline was set by specifying an interval between 0 and 6 ms. The average of the recorded traces (5 each) from the same stimulus was calculated. The amplitude of the fiber volley and the 20%z to 80% rise slope of the fEPSP were analyzed. For LTP, the baseline was set by specifying an interval between 0 and 6 ms. The 20%z to 80% rise slope of the fEPSP before and after HFS (or TBS) induced LTP was analyzed.

[0723] Example 4.9. Statistical analysis

[0724] All data are presented as mean ± SEM, and n represents the number of cells used in each experiment. Typically, one slice was used per animal; one recording was performed per slice. The means of two groups were compared using unpaired t-test, and one-way ANOVA was used for more than three groups. A p value < 0.05 was considered statistically significant. These statistical analyses were performed using Prism 9.0 (GraphPad Prism 9.1.2, GraphPad Software Inc. USA).

[0725] Dose response curves were plotted using Graphpad, Prism 9 according to the manufacturer's instructions.

[0726] Example 4.10. Western Blot

[0727] To prepare thalamocortical (TC) slices, 9- to 10-week-old male C57BL / 6J mice were anesthetized with isoflurane. The brain was then rapidly cooled by cardiac perfusion with ice-cold artificial cerebrospinal fluid (sucrose aCSF). The brain was removed and placed in ice-cold sucrose aCSF. Paracoronal sections were prepared at a 10° angle on a slope at a 50° angle to the midline. The slices were then incubated in aCSF at 35°C for 30 minutes for recovery.

[0728] The slices were then incubated in aCSF at room temperature (23 to 25° C.) for 1 to 4 hours before being placed in the recording chamber for the experiment. Standard aCSF contains saturated 95% O2 / 5% CO2.

[0729] Composition of sucrose-based aCSF

[0730]

[0731] Record the composition of aCSF (room temperature: RT)

[0732]

[0733] All electrophysiological experiments were performed at 27 to 29°C. Flowing blood from a sucrose-based aCSF solution (4°C) was perfused into rodents (mice) by gravity. The brain of the rodent (mice) was removed and cut into 400um at a 50° angle (55° for mice), and attached to the vibrating slicer disk with the cut section at the bottom. The brain slices were incubated in aCSF solution at 35°C for 30 minutes, or incubated in aCSF solution at room temperature for 1 hour. Mouse cortical tissue was prepared according to the above protocol, then homogenized and lysed to extract protein. Protein lysates were prepared from tissues using NP40 (FNN0021, Invitrogen) protein lysis buffer containing protease and phosphatase inhibitors according to the manufacturer's instructions. Protein concentration was determined using a BCA protein assay kit (Pierce Biotechnology) with bovine serum albumin as the standard. Equal amounts of protein (20 μg per lane) were electrophoretically dissociated from 8% or 12% SDS-polyacrylamide gels and then blotted onto PVDF membranes (GE Healthcare). In order to block nonspecific binding, the membrane was incubated in 5% skim milk powder in PBST (150 mM NaCl, 50 mM Tris, pH 7.4, 0.05% Tween 20) for 1 hour at room temperature. Anti-HDAC4 (SAB4300413, Sigma-Aldrich), anti-BDNF (ANT-010, Alomone Las), anti-NMDAR2B (ab65783, abcam plc) antibodies were incubated overnight in 2% blocking solution at 4 ° C. After incubation with the antibody and rinsing several times in PBST, the membrane was incubated with a secondary antibody (sc-2357, Santa Cruz) coupled to mouse anti-rabbit IgG-HRP for 1 hour. Each blot was subsequently re-probed with an anti-β-actin antibody (sc-47778, Santa Cruz). The housekeeping protein β-actin was detected as a normalization control. The antibodies used in the methods described in this specification are as follows:

[0734]

[0735] Example 5. Therapeutic efficacy in PTSD

[0736] Example 5.1. Animal Acquisition and Management

[0737] Animals were obtained from DBL. Animals were obtained 7 days before the start of the experiment. Twenty male S rats of approximately 7 weeks of age were used. Animals were kept under conventional environmental conditions in a colony room with a 12 / 12 h light-dark cycle, with free access to food and water. Rats were acclimated to the new cages over 7 days. All experiments were performed on animals. All experiments were performed in accordance with the Guide for the Care and Use of Laboratory Animals, and efforts were made to minimize the suffering of the animals. Body weight was measured every 3 days starting from day 7.

[0738] Example 5.2. Rat Modeling of PTSD

[0739] The protocol consisted of exposure to two foot shocks with no chance of escape.

[0740] Context A (Day -1)

[0741] Body weight was measured 3 hours before the experiment. The experimental room temperature was maintained at 22°C. To acclimate the animals, they were placed in a dark experimental room for 10 minutes. The animals were placed individually in the first room. After 2 minutes, the door separating the two compartments was opened, and the animals were allowed to move freely on both sides. After 5 minutes, 15 foot shocks of 1 mA / 2 seconds were applied at random time intervals (90 to 270 seconds). After the experiment, the animals were placed in the box for 1 minute and then moved to the group room.

[0742] Scenario B (Day 0)

[0743] Body weight was measured 3 hours before the experiment. The laboratory temperature was maintained at 22°C. To acclimate the animals, they were placed in a dark laboratory space for 10 minutes. The animals were placed in the first compartment with sandpaper attached. At this time, the door was kept closed so that the animals could not reach the second compartment. After 10 minutes, the animals were given 3 foot shocks of 2 mA / sec. After the experiment, the animals were placed in the box for 1 minute and then moved to the group room.

[0744] Compound injection

[0745] The compound was diluted to 25 mg / kg using DMSO:PEG400:saline (5:55:40). Starting from the 7th day, the compound was injected intraperitoneally at 10 am every day (the intraperitoneal injection volume was 200 μl) for 24 consecutive days. The control group was also administered by intraperitoneal injection using a solvent control (DMSO:PEG400:saline (5:55:40)) in the same manner.

[0746] Rigidity test

[0747] For the freezing check, 7 days after the initial foot shock protocol, the rats were placed in the first compartment of the apparatus with sandpaper for 5 minutes (without foot shock), and freezing behavior was recorded using the shuta void_v1803 program (Panlab, Spain) according to the manufacturer's instructions. At this time, the door remained closed, as in situation B. Freezing is defined as a state in which the rat has no skeletal muscle movement. Animals B with a freezing time of less than 240 seconds were excluded. Excluded animals were killed using CO2.

[0748] Data analysis

[0749] To confirm the activity of all animals, a camera was placed in front of the transparent acrylic plate of the electronic box. Starting from day 7, the freezing status of all groups was confirmed every three days. Each animal was filmed for 5 minutes. The freezing time of each animal was confirmed based on the video. The freezing time on day 7 was set as 100%, and then the freezing time of each day was converted into a percentage.

[0750] Example 6. Therapeutic efficacy in AD

[0751] Example 6.1. Animal Acquisition and Management

[0752] APP / PS1 mice are an animal model of Alzheimer's disease and were obtained from Taconic Bioscience. Animals were obtained 7 days before the start of the experiment. Twenty male mice of approximately 15 months of age were used. The animals were kept under regular environmental conditions in a colony room with a 12 / 12 hour light and dark cycle, with free access to food and water. The mice adapted to the new cages within 7 days. All experiments were performed on animals. All experiments were performed in accordance with the Guide for the Care and Use of Laboratory Animals, and efforts were made to minimize the suffering of the animals. Body weight was measured every 3 days starting from the 7th day.

[0753] Example 7. Selection of BnH12001

[0754] Example 7.1. In vitro cytotoxicity

[0755] The cytotoxicity of the compounds was assessed by treating cells with BnH12001 (racemate) and determining cell survival.

[0756] The cell viability was measured in human cell lines 293T and SH-SY5Y after treatment with BnH12001 (0, 0.1, 1, 10, 100 μM). No significant changes in cell viability were observed in any concentration range, confirming the cytotoxic safety of BnH12001 ( Figure 1a and 1b ).

[0757] Example 7.2. Analysis of the effect of HDAC4 reduction on gene expression in vitro

[0758] The BnH12 series of drugs of the present invention are synthesized from compounds targeting HDAC4, which inhibit the expression of BDNF. Therefore, it was confirmed whether the expression of BDNF increased due to the degradation of HDAC4 based on BnH12001 treatment. In addition, it is known that the increase in BDNF expression increases the expression of GluN2B. In order to determine the HDAC4 degradation effect of BnH12001, the mRNA level of GluN2B was also measured together with BDNF.

[0759] After 293T cells were treated with BnH12001 (racemic form) for 6 hours, the mRNA levels of BDNF and GluN2B were measured. The results showed that the expression of BDNF and GluN2B increased significantly compared with the group not treated with the compound. BnH12001 effectively degraded HDAC4, and the results confirmed that BnH12001 exerted its expected effect in vitro by inducing the increase in the expression of BDNF and GluN2B ( Figure 2 ).

[0760] When BnH12001 (racemic form) was applied to primary cultured cortical neurons using the same experimental procedures as above, the expression of HDAC4 protein was significantly inhibited, while the expression of BDNF and GluN2B was significantly increased ( Figure 3 ).

[0761] Example 7.3. Efficacy analysis of enhancing synaptic plasticity in vitro

[0762] Compound efficacy was confirmed by measuring potency and GABA / AMPA ratios in barrel cortex following administration of BnH12001 (racemate), in an attempt to identify effective concentrations through dose response curves of BnH12001.

[0763] To this end, 8-week-old C57BL / 6J mice were divided into a control group (solvent control administration group) and an experimental group (BnH12001 administration group), with 5 mice in each group. After Os pump injection surgery, BnH12001 was directly injected into the barrel cortex layer 4 at a total dose of 3 μM using an Os pump for 2 weeks ( Figure 4a and Figure 4b ).

[0764] When compound BnH12001 was administered, the excitation / inhibition balance of the mouse barrel cortex was maintained as confirmed by measuring the GABA / AMPAb ratio in the mouse barrel cortex (layer 4) ( Figure 4c ), and the excitatory TC synaptic efficacy (TC efficacy) increased significantly ( Figure 4d ). Since an increase in TC potency indicates enhanced synaptic plasticity, the results indicate that administration of BnH12001 has the effect of increasing the potency of TC synapses in the sensory cortex while maintaining excitation / inhibition balance, suggesting that BnH12001 is effective in improving cognitive abilities.

[0765] The drug was orally administered to 8-week-old C57BL / 6J mice at a dose of 1 mg / kg. Five mice were tested in the control group and the compound administration group, respectively. The results confirmed that the administration of BnH12001 maintained the balance of excitation / inhibition and increased the TC synaptic efficacy in the sensory cortex ( Figure 5a and 5b On the one hand, changes in TC EPSC potency in the barrel cortex (layer) of mice were observed in response to administration of BnH12001 at various doses (0.03, 0.1, 0.3, 1, 3, and 10 mg / kg). The control group and the compound administration group were tested with 5 mice at each concentration. As a result, it was confirmed that the EC50 of BnH12001 was 0.3023 ( Figure 5c ).

[0766] Example 7.4. Analysis of the efficacy of enhancing synaptic plasticity in vitro in an Alzheimer's animal model

[0767] Using APP / PS1 mice (Taconic Bioscience) (15 months old) as an animal model of Alzheimer's disease, we attempted to confirm the efficacy of BnH12001 enantiomers (3S, 6R, 98%<) alone or with aducanumab (Creative Biolabs). At this time, the isotype antibody was used as a control antibody. The administration schedule was as follows Figure 6a As shown (for intravenous administration, refer to Example 4.4). Five mice were administered to each administration group.

[0768] By observing the changes in the slope of the field excitatory postsynaptic potential (fEPSP) in the CA1 region of the Chevron collateral circuit of the hippocampus, it was confirmed that the administration of BnH12001 enantiomer (3S, 6R, 98% <) alone, aducanumab alone, and the combined administration of BnH12001 enantiomer (3S, 6R, 98% <) and aducanumab all increased synaptic efficacy ( Figure 6b). In addition, by measuring the LTP of fEPSP in the CA1 region of the hippocampus's Schiffer collateral circuit, it was confirmed that the synaptic long-term potentiation (LTP) of the excitatory SC pathway was also significantly increased ( Figure 6b ). Since the increase in fEPSP slope and LTP indicates enhanced synaptic plasticity, these results indicate that BnH12001 enantiomer (3S, 6R, 98%<) alone and in combination with aducanumab increased SC pathway synaptic efficacy in the hippocampus, suggesting that BnH12001 enantiomer (3S, 6R, 98%<) alone and in combination with aducanumab are effective for the treatment of Alzheimer's disease.

[0769] In addition, after administering BnH12001 enantiomer (3S, 6R, 98% <) alone or in combination with aducanumab to APP / PS1 mice, an attempt was made to confirm the efficacy of the compound against Alzheimer's disease by measuring the potency and GABA / AMPA ratio in the sensory cortex, especially comparing the effects of BnH12001 enantiomer (3S, 6R, 98% <) and aducanumab administered alone and in combination.

[0770] When BnH12001 enantiomers (3S, 6R, 98%<) were administered alone or in combination with aducanumab to APP / PS1 mice, the excitatory / inhibitory balance was maintained as confirmed by measuring the GABA / AMPA ratio ( Figure 6c ), while increasing the excitatory TC synaptic potency (T potency) ( Figure 6c ). Since the increase in TC potency indicates enhanced synaptic plasticity, these results indicate that the administration of BnH12001 enantiomer (3S, 6R, 98%<) alone or in combination with aducanumab maintains the balance of excitation / inhibition while increasing TC synaptic potency in the sensory cortex, indicating that the administration of BnH12001 enantiomer (3S, 6R, 98%<) alone or in combination with aducanumab is effective for the treatment of Alzheimer's disease. In this case, the combined administration of BnH12001 enantiomer (3S, 6R, 98%<) and aducanumab showed significantly superior effects compared with the administration of BnH12001 enantiomer (3S, 6R, 98%<) or aducanumab alone.

[0771] Example 8. Surface plasmon resonance identification

[0772] The compounds of the present invention were selected for their ability to interact with HDAC4. To perform the experiments, surface plasmon resonance identification was used. The samples were prepared as follows and loaded onto a Biacore T200.

[0773]

[0774] Samples were fixed under the following conditions: Protein stock was diluted with 10 mM sodium acetate. 1 M ethanolamine (pH 8.5) was used as blocking agent.

[0775] Chip number Ligand concentration Fixation buffer Fixed level #1 HDAC4 50ug / mL Sodium acetate, pH 5.0 5815.5RU

[0776] Figure 7 The binding kinetics of BnH12001 to HDAC4 are shown.

[0777] Example 9. Effect of compounds on HDAC catalytic activity

[0778] Compounds (racemates) were resuspended in 100 mM DMSO and serially diluted 3-fold starting from 100 μM for HDACs 1-9 and 11 to a 10-dose IC 50 As reference compounds, trichostatin A (TSA) and TMP269 were serially diluted 3-fold starting from 10 μM or 1 μM to obtain a 10-dose IC 50 Conduct experiments.

[0779] A 10 μM fluorescent peptide of p53 residues 379-382 (RHKK(Ac)AMC) was used as a substrate for HDACs 1, 2, 3, and 6. A 50 μM fluorescent HDAC class 2a substrate (trifluoroacetyl lysine) was used as a substrate for HDACs 4, 5, 7, 9, and 11. A 100 μM fluorescent peptide of p53 residues 379-382 (RHK(Ac)K(Ac)AMC) was used as a substrate for HDAC8.

[0780] IC was calculated using the GraphPad Prism 4 program based on the sigmoidal dose-response equation. 50 The curve was fitted by inputting the blank (DMSO) concentration as 1.00E-12 M. The curve was fitted for the compound data set with enzyme activity less than 65% at the highest concentration of the experimental compound.

[0781] The experiments were performed in duplicate. BnH12001 did not show any inhibitory effect on the catalytic activity of HDACs 1 to 9 and 11.

[0782] Example 10. Effects on BDNF and GluN2B expression and thalamocortical EPSC potency

[0783] When HDAC4 protein expression was inhibited by transfection with lentiviral HDAC4 shRNA, the expression of BDNF and GluN2B in SH-SY5Y cells was significantly increased ( Figure 8a and 8bSimilarly, BnH12001 (racemate) (1 μM) enhanced BDNF and GluN2B expression in SH-SY5Y cells after 6 and 24 h of administration ( Figure 9a and 9b BnH12001 significantly inhibited HDAC4 protein expression in the barrel cortex of mice by oral administration and intraperitoneal injection, and this inhibitory effect lasted for at least 9 days ( Fig.10a and 10b ).

[0784] The effect of BnH12001 on thalamocortical EPSC potency and the involvement of BDNF-TrkB signaling were investigated. Fig.11a As shown in Figures A1 to B), BDNF application to the barrel cortex of mice using an Alzet osmotic pump significantly increased TC EPSC potency, while the IPSC / EPSC ratio was not altered. This BDNF-induced enhancement of TC EPSC potency was almost completely blocked by the application of cyclotraxin B (1 μM) ( Fig.11a Similarly, orally administered BnH12001 (3 μM) significantly enhanced TC EPSC potency in layer 4 barrel cortex ( Fig.11b A1 to B), this enhancement was almost completely blocked by the administration of cyclotoxin B (1 μM) ( Fig.11b C1 to D).

[0785] Example 11. Confirmation of the efficacy of BnH12001 enantiomers

[0786] Example 11.1. Analysis of efficacy of enhancing synaptic plasticity in vitro

[0787] The potency and GABA / AMPA ratio in the barrel cortex were measured after oral administration of BnH12001 enantiomer (3R,6S, 98%<) and BnH12001 enantiomer (3S,6R, 98%<) to confirm the efficacy of these compounds.

[0788] BnH12001 (racemate), BnH12001 enantiomer (3R, 6S, 98% <) and BnH12001 enantiomer (3S, 6R, 98% <) were orally administered to 8-week-old C57BL / 6J mice at a dose of 1 mg / kg. Five mice were used in the control group (solvent control) and the compound administration group, respectively. As a result, it was confirmed that both the racemate and the enantiomer maintained the excitation / inhibition balance and were able to increase the TC synaptic efficacy in the sensory cortex. Both enantiomers showed superior efficacy to the racemate, especially the BnH12001 enantiomer (3S, 6R, 98% <) showed the highest efficacy ( Fig.12a and Figure 12b ).

[0789] Example 11.2. Effects on BDNF and GluN2B Expression and Thalamocortical EPSC Potency

[0790] BnH12001 enantiomer (3S, 6R, 98%<) (1 μM) increased BDNF and GluN2B expression by 24 h treatment in primary cultured cortical neurons (DIV 14) ( Fig.13a ).

[0791] In addition, BnH12001 enantiomer (3S, 6R, 98% <) was orally administered to 8-week-old C57BL / 6J mice at a dose of 1 mg / kg, and the mice were killed 2 days later to observe changes in the expression of HDAC4, BDNF, and GluN2B. As a result, it was confirmed that when BnH12001 enantiomer (3S, 6R, 98% <) was administered, HDAC4 was effectively degraded, and the expression of BDNF and GluN2B was significantly increased compared to the group not treated with the compound (solvent control). Therefore, it was confirmed that BnH12001 enantiomer (3S, 6R, 98% <) also exerts excellent efficacy in vivo ( Fig.13b ).

[0792] On the other hand, BnH12001 enantiomer (3S, 6R, 98%<) was orally administered to 13-month-old C57BL / 6J mice at a dose of 1 mg / kg, and the mice were killed 2 days later to observe changes in GluN2B expression. As a result, it was confirmed that when BnH12001 enantiomer (3S, 6R, 98%<) was administered, the expression of GluN2B was significantly increased compared with the group not treated with the compound (solvent control) ( Fig.13c ).

[0793] Example 12. In vitro cytotoxicity of various BnH12 series compounds

[0794] The cytotoxicity of the compounds was evaluated by treating cells with various BnH12 series compounds and measuring cell viability using the experimental procedures described in Example 2. As a result, almost all compounds achieved cell viability of more than 85% at a concentration of 10uM, and also achieved cell viability of more than 80% when the concentration was increased to 100uM.

[0795] [Table 5]

[0796]

[0797]

[0798]

[0799] In the 293T cell line, the results of measuring cell viability based on compound concentration (10 or 100 μM) showed that most compounds did not show significant changes in cell viability in both concentration ranges.

[0800] Example 13. Confirmation of the efficacy of various BnH12 series compounds

[0801] Using the experimental procedures described in Example 3, it was determined whether various BnH12 series compounds increase GluN2B expression, and the results are shown in Table 6. These in vitro experimental results are expressed as relative values ​​to the group not treated with the compound (solvent control), and the effect of the group not treated with the compound was set to 1.

[0802] [Table 6]

[0803]

[0804]

[0805] As can be seen from Table 6, the representative compounds of the present invention showed excellent effects compared with the solvent control. In particular, BnH12001 enantiomer (3S, 6R, 98%<), BnH12018, BnH12025, BnH12038, BnH12060, BnH12061, BnH12063, BnH12069, BnH12073, BnH12074 and BnH12096 showed excellent effects.

Claims

1. A compound represented by formula (1), a stereoisomer thereof or a pharmaceutically acceptable salt thereof, characterized in that: R 1 C 1-6 Alkyl, C 3-12 Cycloalkyl, aryl or heteroaryl, one or more hydrogen atoms in the group are not replaced or are independently replaced by halogen atoms, C 1-6 Alkyl, C 1-6 Alkoxy, nitro, with more than one C 1-6 Alkyl substituted or unsubstituted amino, or hydroxy substituted, A is C=O or a bond, Q is -(CR 4 R 5 ) m - or key, at this time, R 4 and R 5 are each independently hydrogen or C 1-6 Alkyl, m is an integer from 1 to 6, R 2 For hydrogen, C 1-6 Alkyl or aryl, R 3 is hydrogen, carboxyl, N-hydroxycarboxamide or carboxamide, in which one or more hydrogen atoms are not replaced or replaced by C 1-6 Alkyl substitution, n is 0 or 1.

2. The compound according to claim 1, its stereoisomer or a pharmaceutically acceptable salt thereof, characterized in that: R 1 C 1-6 Alkyl, C 3-12 Cycloalkyl, phenyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, pyrrolyl, furyl or thienyl, in which one or more hydrogen atoms are unsubstituted or are independently replaced by halogen atoms, C 1-6 Alkyl, C 1-6 Alkoxy, nitro, with more than one C 1-6 The alkyl group may be substituted with an amino group or a hydroxy group.

3. The compound according to claim 1, its stereoisomer or a pharmaceutically acceptable salt thereof, characterized in that: R 1 is methyl, cyclohexyl, phenyl, 4-methoxyphenyl, 4-(tert-butyl)phenyl, 2-chlorophenyl, 3-chlorophenyl, 4-chlorophenyl, 4-fluorophenyl, 4-bromophenyl, 3,4-dichlorophenyl, 2-chloro-4-fluorophenyl, p-tolyl, m-tolyl, pyridin-4-yl, thien-2-yl, furan-2-yl, pyridin-3-yl, pyridin-2-yl, pyrimidin-5-yl, pyrimidin-2-yl, 4-nitrophenyl, 4-aminophenyl, 3-nitrophenyl, 3-aminophenyl, 4-methoxy-pyridin-3-yl, 6-methoxy-pyridin-3-yl, 4-(dimethylamino)phenyl or 4-hydroxy-phenyl.

4. The compound according to claim 1, its stereoisomer or a pharmaceutically acceptable salt thereof, characterized in that: R 2 H or C 1-6 alkyl.

5. The compound according to claim 1, its stereoisomer or a pharmaceutically acceptable salt thereof, characterized in that: R 3 It is H, carboxyl, methylcarboxyl, ethylcarboxyl, N-hydroxycarboxamide, carboxamide or sodium carboxylate.

6. A compound represented by formula (2-A) or (2-B), a stereoisomer thereof or a pharmaceutically acceptable salt thereof, characterized in that: or Among them, R 4 C 1-6 Alkyl, C 3-12 Cycloalkyl, phenyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, pyrrolyl, furanyl or thienyl, in which one or more hydrogen atoms are unsubstituted or are independently replaced by halogen atoms, C 1-6 Alkyl, C 1-6 Alkoxy, nitro, with more than one C 1-6 Alkyl substituted or unsubstituted amino, or hydroxy substituted, R 5 and R 6 are independently hydrogen or C 1-6 alkyl.

7. A compound represented by formula (4), its stereoisomer or a pharmaceutically acceptable salt thereof, characterized in that < img src='' class="img-anchor" img-id="FDA0005151331070000023" / > In, in, R 2 For hydrogen, C 1-6 Alkyl or aryl, R 3 is hydrogen, carboxyl, N-hydroxycarboxamide or carboxamide, in which one or more hydrogen atoms are not replaced or replaced by C 1-6 Alkyl substitution, n is 0 or 1.

8. A compound represented by formula (5), its stereoisomer or a pharmaceutically acceptable salt thereof, characterized in that < img src='' class="img-anchor" img-id="FDA0005151331070000031" / > In, in, R 2 For hydrogen, C 1-6 Alkyl or aryl, R 4 is phenyl or phenyl substituted by one or more halogens, n is 0 or 1.

9. The compound according to claim 1, its stereoisomer or a pharmaceutically acceptable salt thereof, characterized in that: The compound is selected from the following compounds, 10. The compound according to claim 9, characterized in that The compound is BnH12001 or its enantiomer.

11. The compound according to claim 1, its stereoisomer or a pharmaceutically acceptable salt thereof, characterized in that: The stereoisomers are optical isomers.

12. The compound according to claim 1, its stereoisomer or a pharmaceutically acceptable salt thereof, characterized in that: The compounds are inhibitors of HDAC.

13. The compound according to claim 12, its stereoisomer or a pharmaceutically acceptable salt thereof, characterized in that: The HDAC is HDAC4.

14. The compound according to claim 1, its stereoisomer or a pharmaceutically acceptable salt thereof, characterized in that: The compounds enhance synaptic plasticity.

15. A pharmaceutical composition, characterized in that The active ingredient comprises the compound according to any one of claims 1 to 14, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof.

16. The pharmaceutical composition according to claim 15, characterized in that The composition is used for preventing or treating neurotic disorders or neurodegenerative disorders.

17. The pharmaceutical composition according to claim 16, characterized in that The compound, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof is delivered to the brain at a concentration of about 0.1 to about 3 μM.

18. The pharmaceutical composition according to claim 16, characterized in that The disorder is Alzheimer's disease.

19. The pharmaceutical composition according to claim 16, characterized in that The disorder is PTSD.

20. The pharmaceutical composition according to claim 15, characterized in that A second therapeutic agent is also included.

21. The pharmaceutical composition according to claim 20, characterized in that The second therapeutic agent is aducanumab.

22. A method for preventing or treating a neurotic disorder or a neurodegenerative disorder, characterized in that: The method comprises administering the compound, stereoisomer or pharmaceutically acceptable salt thereof according to any one of claims 1 to 14 to an individual in need of preventing or treating a neurotic disorder or a neurodegenerative disorder.

Images