Nasopharynx cancer-targeted nano train drug loading system as well as preparation method and application thereof

Abstract

The invention provides a nasopharynx cancer targeting nano train drug delivery system, and belongs to the field of nano materials and biomedical engineering, the targeting specificity of a nucleic acid aptamer S3 is utilized, nano train loading chemotherapeutic drug adriamycin is coupled, and nano train drug-loading nanoparticles modified by the nucleic acid aptamer S3 are prepared and used for targeted killing of NPC cells and tissues. The aptamer-modified nano train can reduce toxic and side effects on normal tissues and cells while remarkably improving the loading capacity of the medicine and improving the targeting property on nasopharyngeal carcinoma; besides, the nucleic acid aptamer S3, the NK cells and the combined S3-NK cells are prepared, the targeting characteristic of the nucleic acid aptamer and the immunocompetence of the NK cells are fully utilized through the combined strategy, a treatment platform with a synergistic effect is formed, the targeting delivery and treatment effect on nasopharyngeal carcinoma cells is remarkably improved, and wide clinical application prospects are shown.

Description

Technical Field

[0001] The invention belongs to the field of nano materials and biomedical engineering, and specifically relates to a nano train drug delivery system targeting nasopharyngeal carcinoma and a preparation method and application thereof. Background Art

[0002] Nasopharyngeal carcinoma (NPC) is a malignant tumor with unique regional characteristics, especially in southern my country. NPC is highly malignant and highly sensitive to radiotherapy. Clinically, simple radiotherapy is often used for early NPC patients, but NPC often lacks obvious symptoms in the early stage. Many patients have entered the middle and late stages when diagnosed, missing the best time for treatment. The 5-year survival rate of radiotherapy alone is only 35-52%. Although combined chemotherapy can improve the treatment effect, it also brings serious toxic side effects. With the progress of medical research, immunotherapy, as an emerging treatment method, has shown great potential in the treatment of many cancers, including NPC. The combined use of NK cell-mediated immunotherapy with radiotherapy and targeted therapy is becoming more and more widespread, achieving better therapeutic effects while reducing their toxic side effects. Therefore, in order to improve the accuracy and effectiveness of NPC treatment, probes for NPC-specific molecular markers are screened, and the specific probes are used to produce targeted drugs and targeted NK cells. Targeted drugs can accurately deliver drugs to cancer cells and reduce damage to normal cells. At the same time, targeted NK cells can more effectively target and eliminate tumors, achieving the goal of "killing two birds with one stone", improving the effectiveness of targeted therapy while reducing its toxic side effects, and providing a new treatment option for NPC patients.

[0003] Nucleic acid aptamers, also known as "chemical antibodies", are single-stranded oligonucleotides screened from a large number of nucleic acid libraries through the exponential enrichment ligand binding process (SELEX, Systematic Evolution of Ligands by Exponential enrichment) technology. These aptamers can highly specifically recognize and bind to their target molecules, including proteins, small molecules, and even cells and tissues. Compared with traditional antibodies, nucleic acid aptamers have many advantages, such as small size, good biocompatibility, high stability, low production cost, and easy chemical modification. When used as targeting groups, nucleic acid aptamers have a small size and produce little steric hindrance, thereby enhancing the ability to bind to the target, showing great potential in targeted therapy.

[0004] Doxorubicin (DOX) is a widely used chemotherapy drug for the treatment of various cancers, including NPC. Although conventional DOX chemotherapy can improve the efficacy to a certain extent, it is often accompanied by toxic side effects such as bone marrow suppression and cardiotoxicity during the treatment process, which seriously limits its application and therapeutic effect in NPC. Therefore, nucleic acid aptamers are coupled to a nano drug delivery system loaded with doxorubicin, namely a "nano train". This drug delivery system uses the high specificity and affinity of nucleic acid aptamers to accurately identify and target specific markers on the surface of tumor cells. Under the guidance of aptamers, the "nano train" loaded with doxorubicin can efficiently deliver drugs to the tumor site, thereby significantly reducing the toxic side effects on normal cells and tissues while improving the therapeutic effect. However, the tumor microenvironment is complex and changeable, and the therapeutic effect of single chemotherapy is limited. Combined immunotherapy is very necessary, which can not only provide direct tumor killing effects, but also identify and eliminate escaped cancer cells, achieve long-term monitoring and prevent recurrence.

[0005] NK cell-based immunotherapy has shown great potential. NK cells do not require antigen presentation, prior sensitization or clonal expansion to kill tumor cells. They induce target cell death by releasing perforin and activate cell signaling pathways to trigger cell apoptosis. These inherent characteristics of NK cells show their great application value in adoptive tumor immunotherapy. However, due to the lack of cell-specific receptors, NK cells have poor selectivity, which limits their clinical application. By modifying the aptamer S3 on the surface of NK cells through sugar metabolism labeling and click reaction, this aptamer-modified NK cell can more accurately recognize specific markers on the surface of tumor cells, thereby significantly improving the targeting of NK cells to tumors. In this way, the immune killing ability of NK cells is significantly enhanced, while reducing damage to normal cells and reducing toxic side effects.

[0006] In summary, utilizing the targeting specificity of nucleic acid aptamers, coupling the "nanotrain" with the chemotherapy drug DOX, and combining it with the NK cell adoptive immunotherapy strategy can improve the targeted therapy effect while reducing toxic side effects, and has broad clinical application prospects. Summary of the invention

[0007] In order to solve the above technical problems, the present invention provides a nano-train drug delivery system targeting nasopharyngeal carcinoma, and a preparation method and application thereof, and proposes a preparation method and application of a "nano-train" drug delivery system modified with a nucleic acid aptamer S3 specifically targeting NPC cells and an engineered NK cell product for the combined treatment of nasopharyngeal carcinoma. The combined system is combined with the "nano-train" and NK cells respectively through nucleic acid aptamers. The "nano-train" modified with nucleic acid aptamers can significantly increase the drug loading amount while reducing the toxic side effects on normal tissues and cells. The NK cells modified with nucleic acid aptamers can achieve targeted immunotherapy effects while reducing the risk of CAR-NK easily causing insertion mutations. The combination of the two can achieve more accurate targeting of NPC and significantly improve the treatment effect of NPC. Therefore, the targeting specificity of nucleic acid aptamers is utilized to couple the "nano-train" and NK cells to achieve targeted delivery and treatment of nasopharyngeal carcinoma cells.

[0008] To achieve the above-mentioned purpose, the present invention first provides a nanotrain drug delivery system targeting nasopharyngeal carcinoma, including aptamer nanotrain drug-loaded nanoparticles and engineered NK cells, wherein the aptamer nanotrain drug-loaded nanoparticles include aptamer S3, DNA nanotrain and doxorubicin, wherein the DNA nanotrain is a long double-stranded structure formed by self-assembly of DNA monomers M1 and M2 through hybridization chain reaction under the action of aptamer trigger probe trigger through complementary base pairing; the DNA nanotrain is loaded with doxorubicin and then modified by aptamer S3; the engineered NK cells are NK cells modified by aptamer S3;

[0009] The sequence of the nucleic acid aptamer S3 is shown in SEQ ID NO.1;

[0010] The sequence of the DNA monomer M1 is shown in SEQ ID NO.2;

[0011] The sequence of the DNA monomer M2 is shown in SEQ ID NO.3;

[0012] The sequence of the nucleic acid aptamer trigger probe trigger is shown in SEQ ID NO.4.

[0013] Based on a general inventive concept, the present invention also provides a method for preparing a nanotrain drug delivery system, comprising the following steps:

[0014] S1. Preparation of DNA nanotrain: The 5′ end of the aptamer S3 is modified with the aptamer trigger probe trigger to obtain the chimera S3-trigger, which is introduced into the mixture of DNA monomers M1 and M2. The chimera S3-trigger is self-assembled by hybridization chain reaction based on the principle of complementary base pairing to form the DNA nanotrain S3-NTr.

[0015] S2. Preparation of nucleic acid aptamer nanotrain drug-loaded nanoparticles: Adriamycin and the DNA nanotrain S3-NTr prepared in step S1 were mixed in a Mg-containing 2+ The S3-NTr was placed in Dulbecco's phosphate buffer and placed at room temperature, and doxorubicin was loaded into the drug loading site of S3-NTr to obtain S3-NTr-DOX.

[0016] S3. Preparation of azide-modified NK92 cells: adding N-azidoacetylmannosamine-tetraacylated to NK92 cells, co-incubating with NK92 cells, and then collecting the cells and washing with PBS to obtain azide-modified NK92 cells;

[0017] S4, preparation of engineered NK cells: incubate the azide-modified NK92 cells prepared in S3 with the FAM-labeled, DBCO-modified S3 aptamer in PBS buffer supplemented with 1% fetal bovine serum, and then wash with PBS buffer;

[0018] The sequence of the DBCO-modified S3 aptamer is shown in SEQ ID NO.5.

[0019] Preferably, in step S1, the concentration ratio of the mixture of the chimera S3-trigger and the DNA monomers M1 and M2 is 1:10.

[0020] Preferably, the time of standing at room temperature in step S2 is 2 hours.

[0021] Preferably, the incubation time in step S3 is 24 hours.

[0022] Preferably, the incubation temperature in step S4 is 37° C. and the incubation time is 2 h.

[0023] Based on a general inventive concept, the present invention also provides an application of a nanotrain drug delivery system in the preparation of drugs for the targeted treatment of nasopharyngeal carcinoma.

[0024] Preferably, the nanotrain drug delivery system is any pharmaceutically approved preparation.

[0025] Preferably, the administration order of the nanotrain drug delivery system is: first administer the engineered NK cells, and then administer the nucleic acid aptamer nanotrain drug-loaded nanoparticles S3-NTr-DOX 4 hours later.

[0026] The mechanism of treatment of this regimen is as follows:

[0027] This combined system combines with the "nanotrain" and NK cells respectively through nucleic acid aptamers. The "nanotrain" modified with nucleic acid aptamers can significantly increase the drug loading while reducing the toxic side effects to normal tissues and cells. The NK cells modified with nucleic acid aptamers can achieve targeted immunotherapy effects while reducing the risk of CAR-NK causing insertion mutations. The combination of the two can achieve more accurate targeting of NPC and significantly improve the treatment effect of NPC. Therefore, the targeting specificity of nucleic acid aptamers is utilized to couple the "nanotrain" with NK cells to achieve targeted delivery and treatment of nasopharyngeal carcinoma cells.

[0028] The aptamer nanotrain drug-loaded nanoparticles include aptamer S3, DNA nanotrain and anti-tumor drug DOX. Aptamer S3 is connected to one end of the nanotrain through base complementary pairing, and acts as a targeting molecule to recognize CD109 protein on the surface of nasopharyngeal cancer cells; the nanotrain is self-assembled by DNA monomers M1 and M2 under the action of aptamer trigger probe (S3-trigger), forming a long double-stranded structure, which contains a large number of sites for loading drugs.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] (1) This scheme provides a "nanotrain" drug delivery system (S3-NTr-DOX) modified with nucleic acid aptamer S3 that specifically recognizes NPC cells. The system can specifically recognize and bind to CD109 molecules on the surface of NPC cells to achieve efficient targeted delivery of the anti-tumor drug DOX. Compared with free DOX, S3-NTr-DOX significantly enhances the killing effect of DOX on NPC cells, and also shows good targeted killing in NPC tumor spheres, providing a new and effective means for the targeted treatment of NPC.

[0031] (2) Doxorubicin is a chemotherapy drug widely used in the treatment of various cancers. Although the conventional use of doxorubicin for chemotherapy can improve the therapeutic effect to a certain extent, its killing effect will still affect normal cells and tissues due to its non-targeted nature. The present invention loads doxorubicin onto a "nanotrain" modified with nucleic acid aptamer S3 that can specifically recognize NPC cells. While achieving efficient targeted therapy, the system significantly reduces the toxic effects of doxorubicin on normal tissues and cells. Both in vivo and in vitro experiments have shown that the S3-NTr-DOX treatment group has low or no toxicity to normal tissues and good biosafety, which is expected to reduce the toxic side effects of patients during chemotherapy and improve the quality of life of patients.

[0032] (3) The drug delivery system targeting NPC cells provided by the present invention has a simple preparation method and high drug delivery efficiency. Through in-depth exploration of its mechanism of action, it provides new ideas and strategies for the specific targeted delivery of anti-tumor drugs and the personalized treatment of NPC. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0034] Figure 1 The preparation of nucleic acid aptamer nanotrain (S3-NTr) in Experimental Example 1, a is the reaction scheme of nucleic acid aptamer nanotrain S3-Ntr, b is the synthesis of S3-NTr verified by agarose gel electrophoresis, c is the agarose gel electrophoresis of S3-NTr treated with DNase, d is the agarose gel electrophoresis analysis result of S3-NTr sample using Defined K-SFM and 1640 solution;

[0035] Figure 2 This is the investigation of the targeting of S3-NTr in Experimental Example 2, a is the binding of FITC-labeled S3-NTr to NPC cell lines 6-10B, SUNE-1, HK-1, 5-8F, and C666-1, b is the staining of FITC-labeled S3-NTr on 5-8F and C666-1, and c is the fluorescence imaging of the recognition effect of S3-NTr on tumor spheres formed by 5-8F and C666-1;

[0036] Figure 3 is the in vitro killing effect of S3-NTr-DOX in Experimental Example 3, a is the flow cytometry test results of 5-8F and C666-1, b is the CCK-8 test results of cell viability after NP69, 5-8F and C666-1 were treated with PBS, DOX, NTr-DOX and S3-NTr-DOX respectively, c is the experimental results of counting the number of spheres in each well of the four groups of PBS, DOX, NTr-DOX and S3-NTr-DOX at 0h and 48h after drug addition, d is the cell survival of the DOX group and the S3-NTr-DOX group after 48h of drug treatment;

[0037] Figure 4The effect of S3-NTr-DOX on NPC cell apoptosis in Experimental Example 4, a is the effect of PBS, DOX, NTr-DOX, and S3-NTr-DOX on 5-8F cell apoptosis, b is the effect of PBS, DOX, NTr-DOX, and S3-NTr-DOX on C666-1 cell apoptosis;

[0038] Figure 5 is the in vivo killing effect of S3-NTr-DOX in Experimental Example 5, a is the change in tumor volume of nude mice in the four groups of PBS, DOX, NTr-DOX, and S3-NTr-DOX, b is the final size and weight of tumors of nude mice in the four groups of PBS, DOX, NTr-DOX, and S3-NTr-DOX, and c is the immunohistochemical detection results of the PBS control group, DOX, NTr-DOX, and S3-NTr-DOX treatment groups;

[0039] Figure 6 The biological safety of S3-NTr and S3-NTr-DOX in Experimental Example 6, a is a graph showing the weight changes of nude mice in the three groups of PBS, NTr and S3-NTr, b is a graph showing the weight changes of nude mice in the four groups of PBS, DOX, NTr-DOX and S3-NTr-DOX, and c is a photograph showing the histomorphology of various organs in nude mice;

[0040] Figure 7 The combination of NK cells and S3 in Experimental Example 7 and their targeting to nasopharyngeal carcinoma cells, a is an immunofluorescence image of S3 aptamer labeled on the surface of NK cells, b is a co-incubation of S3-NK cells with nasopharyngeal epithelial cells NP69 and NPC cells 5-8F and C666-1 to detect their targeting, c is the evaluation of the killing activity of S3-NTr-DOX, NK cells, S3-NK cells, S3-NTr-DOX combined with NK cells, and S3-NTr-DOX combined with S3-NK cells on 5-8F cells using the CCK8 method;

[0041] Figure 8 This is a schematic diagram of the administration of S3-NTr-DOX combined with S3-NK cells in Experimental Example 7. DETAILED DESCRIPTION

[0042] In order to make the technical problems, technical solutions and advantages to be solved by the present invention more clear, a detailed description will be given below with reference to the accompanying drawings and specific embodiments.

[0043] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Without departing from the spirit and substance of the present invention, modifications or substitutions made to the methods, steps or conditions of the present invention are within the scope of the present invention.

[0044] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art; unless otherwise specified, the reagents used in the examples are commercially available.

[0045] Experimental Example 1

[0046] Preparation of DNA nanotrain S3-Ntr and investigation of its stability

[0047] A DNA trigger probe was modified at the 5′ end of the aptamer S3, and the chimera S3-trigger was introduced into the mixture of DNA monomers M1 and M2. The hybridization chain reaction self-assembled through the base complementary pairing principle to form the aptamer nanotrain S3-Ntr. The reaction procedure is as follows: Figure 1 As shown in a.

[0048] The synthesis of S3-NTr was verified by agarose gel electrophoresis. Figure 1 As shown in b, M1 alone, M2 alone, a mixture of M1 and M2, and a single trigger did not react in the gel lane, but under the action of S3-trigger, M1 and M2 hybridized and formed hybrid products of varying lengths, indicating the synthesis of S3-NTr. It was verified that the optimal concentration ratio of S3-trigger to M1 / M2 was 1:10.

[0049] (2) Verification of the stability of S3-NTr

[0050] After treating S3-NTr with 1U / mL deoxyribonuclease I (DNase) for 0.5h, the structural integrity of S3-NTr was detected by agarose gel electrophoresis. Figure 1 As shown in c, compared with the untreated sample, the sample amount in the sample port did not decrease significantly, which indicates that S3-NTr has a good resistance to enzyme digestion.

[0051] In addition, S3-NTr was incubated with DefinedK-SFM and 1640 solution containing 10% FBS for 0-64 h, and samples at different time points were taken for agarose gel electrophoresis analysis. Figure 1 As shown in Figure d, after 64 h, the amount of S3-NTr still did not decrease significantly, indicating that S3-NTr can maintain structural stability for a long time in serum or serum-free solution.

[0052] In general, S3-NTr has relatively high stability and can maintain its structural integrity in high enzyme concentrations and complex solutions, further demonstrating that S3-NTr can be used in complex biological systems.

[0053] The sequence of aptamer S3 is:

[0054] 5′–ATCCAGAGTGACGCAGCATCTGAGAATAGTGGTTTGCTGTATGGTG

[0055] GGCGTTGAAAGAGGGGTGGACACGGTGGCTTAGT–3′(SEQ ID NO.1)

[0056] The sequence of DNA monomer M1 is:

[0057] 5′–CGTCGTGCAGCAGCAGCAGCAGCAACGGCTTTGCTGCTGCTGCTGCTGC–3′(SEQ ID NO.2)

[0058] The sequence of DNA monomer M2 is:

[0059] 5′–TGCTGCTGCTGCTGCTGCACGACGGCAGCAGCAGCAGCAGCAAGCCGT–3′(SEQ ID NO.3)

[0060] The sequence of the DNA trigger probe is:

[0061] 5′–TGCTGCTGCTGCTGCTGCACGACGTTT–3′(SEQ ID NO.4)

[0062] The S3-trigger sequence is:

[0063] 5′–TGCTGCTGCTGCTGCTGCACGACGTTTATCCAGAGTGACGCAGCAT

[0064] CTGAGAATAGTGGTTTGCTGTATGGTGGGCGTTGAAAGAGGGGTGGACACGGTGG CTTAGT–3′

[0065] Experimental Example 2

[0066] Investigating the targeting of S3-NTr

[0067] (1) Targeting of S3-NTr to NPC cells

[0068] Flow cytometry was used to detect the binding of FITC-labeled S3-NTr to NPC cell lines 6-10B, SUNE-1, HK-1, 5-8F, and C666-1, and the normal nasopharyngeal epithelial cell line NP69 was used as a negative control. Figure 2a shows that compared with the control, the fluorescence binding peak of the NPC cell line changed and moved to the right, that is, S3-NTr can specifically recognize NPC cells.

[0069] Fluorescence microscopy was used to further observe the staining of 5-8F and C666-1 by FITC-labeled S3-NTr. Figure 2 b shows that S3-NTr can bind to 5-8F and C666-1 to emit fluorescence, which is mainly distributed in the cell membrane and cytoplasm, while the control Lib-NTr cannot bind, indicating that S3-NTr has good recognition of nasopharyngeal carcinoma cells.

[0070] (2) Targeting of S3-NTr to tumor stem cells in NPC cells

[0071] Free 5-8F cells and C666-1 cells were added to a low-adhesion 6-well plate and cultured in serum-free stem cell medium to form free-floating tumor spheres. Non-adherent spheres were observed on days 6-8 and enzymatically dissociated into single cells for passaging. Fluorescence imaging ( Figure 2 c) It was demonstrated that S3-NTr exhibited a good recognition effect on tumor spheres formed by 5-8F and C666-1, indicating that it also has great potential in killing tumor spheres.

[0072] Experimental Example 3

[0073] Preparation of nucleic acid aptamer nanotrain drug-loaded nanoparticles S3-NTr-DOX and investigation of its killing effect in vitro

[0074] (1) Preparation of S3-NTr-DOX

[0075] DOX and S3-NTr were mixed in a 50:1 molar ratio in a 5 mM Mg 2+ The mixture was placed in Dulbecco's phosphate buffered saline (DPBS) at room temperature for 2 h, and DOX was loaded into the drug loading site of S3-NTr to obtain S3-NTr-DOX.

[0076] (2) DOX uptake in NPC cells

[0077] After S3-NTr-DOX is taken up by cells, the drug will be slowly released under the action of nucleases and other factors. A random sequence was connected to the trigger probe, and the NTr-DOX treatment group was set up to explore the drug sustained release effect of the nano drug delivery system. The flow cytometer test results are shown in Figure 2. Figure 3As shown in a, in 5-8F and C666-1 cell lines, compared with the negative control of the PBS group, the fluorescence binding peaks of the DOX, NTr-DOX and S3-NTr-DOX groups shifted to the right at 4h and 8h. At 4h, the fluorescence intensity of DOX in the NTr-DOX group and the S3-NTr-DOX group was not as strong as that in the DOX group, while at 8h, the fluorescence intensity of DOX in the NTr-DOX and S3-NTr-DOX groups gradually increased, proving the effectiveness of the nanostructure. In addition, at any time, the fluorescence intensity of DOX in the S3-NTr-DOX group was stronger than that in the NTr-DOX group, proving the drug targeting of S3-NTr. In NP69, the fluorescence intensity of DOX in the S3-NTr-DOX group was the lowest at any time, proving that S3-NTr-DOX does not recognize normal nasopharyngeal epithelial cells.

[0078] (3) Effect of S3-NTr-DOX on cell proliferation

[0079] CCK-8 assay was used to detect the effects of DOX, NTr-DOX, and S3-NTr-DOX on the viability of NP69, 5-8F, and C666-1 cells. The experimental groups were PBS group, free DOX group, NTr-DOX group, and S3-NTr-DOX group. The half inhibitory concentrations of DOX were: IC 50 (NP69)=1382.0nM,IC 50 (5-8F) = 515.1 nM, IC 50 (C666-1) = 475.6 nM, using the IC of the corresponding cells 50 The cells were incubated for 0d, 1d, 2d, 3d, 4d, and 5d. The culture medium was removed at the corresponding time points, and CCK8 solution was added. The absorbance value (OD) of each group at 450nm was measured using a microplate reader to calculate the survival rate of the treated cells. Figure 3 b The results showed that in NP69, compared with the PBS treatment group, the DOX and NTr-DOX treatment groups could significantly inhibit the cell viability of NP69. The NTr-DOX group also showed that the nanotrain could be taken up by cells. After NP69 treated with S3-NTr-DOX, the cell viability decreased slightly compared with the first day, but compared with DOX and NTr-DOX, its proliferation inhibition effect was not obvious. In 5-8F and C666-1, the killing effect of S3-NTr-DOX was the most obvious. The above results show that S3-NTr-DOX shows good targeting recognition for NPC cells and can significantly inhibit the proliferation of NPC cells.

[0080] (4) Killing effect of S3-NTr-DOX on tumor spheres

[0081] After 5-8F cells were used to culture tumor spheres to a certain size, the killing effect of S3-NTr-DOX on tumor spheres was detected. The tumor spheres were divided into four groups: PBS, DOX, NTr-DOX, and S3-NTr-DOX. The number of spheres in each well was counted at 0h and 48h after drug addition. Figure 3 c shows that after 48 hours of drug treatment, there are obviously floating dead cells in the DOX group and S3-NTr-DOX group, indicating that it has a good killing effect on tumor spheres. Figure 3 As shown in (d), the DOX group and S3-NTr-DOX group had a significant killing effect on tumor spheres.

[0082] Experimental Example 4

[0083] Investigate the effect of S3-NTr-DOX on NPC cell apoptosis

[0084] The AnnexinV-PE / 7-AAD kit double staining method was used to detect cell apoptosis by flow cytometry. The Q1, Q2, Q3, and Q4 areas represent necrosis, late apoptosis, early apoptosis, and surviving cell areas, respectively. Figure 4 As shown in the figure, in 5-8F and C666-1 cells, the apoptosis rate was significantly increased compared with the PBS control group, among which the S3-NTr-DOX group had the highest apoptosis rate. Compared with the NTr-DOX group, the S3-NTr-DOX group had a stronger ability to inhibit cell survival, indicating that in the same drug delivery system, S3-NTr-DOX can better target NPC cells.

[0085] Experimental Example 5

[0086] Investigating the killing effect of S3-NTr-DOX in vivo

[0087] (1) Evaluation of the antitumor activity of S3-NTr-DOX in vivo

[0088] The nude mice were divided into four groups, namely PBS control group, DOX, NTr-DOX, and S3-NTr-DOX. The drugs were administered every three days, 200 μL each time, and the DOX concentration was 2 mg / kg, for a total of ten times. Figure 5 a shows that compared with the PBS control group, the tumor volume of nude mice in the DOX, NTr-DOX, and S3-NTr-DOX treatment groups increased slowly under the action of drugs, but the inhibitory effect of the S3-NTr-DOX treatment group was the most obvious. Figure 5 b shows the final size and weight of the nude mouse tumor after 30 days. Compared with the PBS control group, the tumor sizes of the nude mice in the DOX, NTr-DOX, and S3-NTr-DOX treatment groups were all reduced, but the tumor size of the nude mice in the S3-NTr-DOX treatment group was the smallest, indicating that S3-NTr-DOX can effectively inhibit the growth of tumors in nude mice.

[0089] (2) Immunohistochemistry

[0090] The tumor was embedded in paraffin and sectioned, and the expression of Ki67 in the tumor tissue was detected by immunohistochemistry. Figure 5 As shown in (c), compared with the PBS control group, the expressions of Ki67, a molecule closely related to proliferation, in the DOX, NTr-DOX, and S3-NTr-DOX treatment groups were lower than those in the control group, and the expression of Ki67 in the S3-NTr-DOX treatment group was the lowest.

[0091] Experimental Example 6

[0092] Investigation of the biosafety of S3-NTr and S3-NTr-DOX

[0093] (1) Toxicity of S3-NTr in animals

[0094] PBS, NTr and S3-NTr solutions were injected into nude mice every 3 days, 200 μL each time, and the body weight was measured every 3 days. After 10 injections, the nude mice were killed by cervical dislocation. The body weight changes of the three groups of nude mice are shown in Figure 2. Figure 6 As shown in a, compared with the control group, NTr and S3-NTr had no significant effect on the body weight of nude mice, indicating that this nanocarrier does not affect the growth of nude mice.

[0095] (2) Toxicity of S3-NTr-DOX in animals

[0096] The nude mice were divided into four groups and given drugs every three days, 200 μL each time, with a DOX concentration of 2 mg / kg, for a total of ten times. The mice in each group were weighed during the period. Figure 6 As shown in Figure b, the weight of nude mice in the PBS treatment group continued to increase, while the weight of nude mice in the DOX, NTr-DOX, and S3-NTr-DOX treatment groups decreased, indicating that the nude mice were all affected by the chemotherapy drug DOX. Compared with the DOX treatment group, the weight changes of nude mice in the NTr-DOX and S3-NTr-DOX treatment groups were smaller, indicating that the nanotrain structure can effectively reduce the toxic side effects of chemotherapy drugs.

[0097] (3) Effects of S3-NTr-DOX on the morphology of various organs and tissues in nude mice

[0098] The biosafety of S3-NTr-DOX was tested by comparing the histomorphological photographs of various organs in nude mice. Figure 6 As shown in c, the results of histological evaluation showed that compared with the non-drug group, the pathological morphology of the heart, liver, spleen, lung, kidney and brain of nude mice in the S3-NTr-DOX treatment group were normal, but obvious histomorphological changes appeared in multiple tissues in the free DOX treatment group, indicating that the nanotrain has low or no toxicity to normal tissues and has good biosafety.

[0099] Experimental Example 7

[0100] Investigating the combination of engineered NK cells and S3 and their targeting to nasopharyngeal carcinoma cells

[0101] (1) Preparation of engineered NK cells

[0102] 50 μM N-azidoacetylmannosamine-tetraacylated (Ac4ManNAz) was added to NK92 cells, incubated with NK92 cells for 24 hours, and then washed three times with PBS to obtain azide-labeled NK92 cells. Azide-labeled NK92 cells were incubated with FAM-labeled, DBCO-modified S3 aptamers in PBS buffer supplemented with 1% fetal bovine serum at 37°C for 2 hours, and then washed three times with PBS buffer to obtain S3-NK.

[0103] The sequence of the FAM-labeled DBCO-S3 aptamer is:

[0104] 5′–DBCO-(C6)-ATCCAGAGTGACGCAGCATCTGAGAATAGTGGTTTGC

[0105] TGTATGGTGGGCGTTGAAAGAGGGGTGGACACGGTGGCTTAGT-(C6)-FAM–3′

[0106] The DBCO-S3 aptamer sequence is:

[0107] 5′–DBCO-(C6)-ATCCAGAGTGACGCAGCATCTGAGAATAGTGGTTTG

[0108] CTGTATGGTGGGCGTTGAAAGAGGGGTGGACACGGTGGCTTAGT–3′(SEQ ID NO.5)

[0109] (2) Targeting of S3 and S3-NK to NPC cells

[0110] The nucleic acid aptamer labeled with FAM fluorescence on DBCO-S3 (DBCO-S3-FAM) emits fluorescence. The results of immunofluorescence experiments are shown in Figure 7 As shown in a, fluorescence was detected on the surface of NK cells, and there was a stable fluorescence signal within 24 hours. This shows that the S3 aptamer was successfully labeled on the surface of NK cells. S3-NK cells were co-incubated with nasopharyngeal epithelial cells NP69 and NPC cells 5-8F and C666-1 to detect their targeting. The experimental results are shown in Figure 7As shown in b, S3 can target and recognize NPC cells but not NP69 cells, indicating that S3 is targeted to NPC cells.

[0111] (3) Specific killing effect of S3-NTr-DOX combined with S3-NK cells on nasopharyngeal carcinoma cells

[0112] The experiment was divided into S3-NTr-DOX group, NK cell group, S3-NK cell group, combined treatment group in which NK cells were added for 4 hours before S3-NTr-DOX was added, and combined treatment group in which S3-NK cells were added for 4 hours before S3-NTr-DOX was added. Each group was incubated with 5-8F cells (the concentration of S3-NTr-DOX was designed to be 515.1 nM, and the incubation ratio of NK cells to target cells was 10:1). The CCK8 method was used to evaluate the killing activity of the combined treatment group on 5-8F cells. Figure 7 As shown in Figure c, 5-8F cells in the Control group survived normally, while the survival rates of 5-8F cells in the S3-NTr-DOX, NK cell, S3-NK cell, S3-NTr-DOX combined with NK cell, and S3-NTr-DOX combined with S3-NK cell treatment groups all decreased. Compared with the S3-NTr-DOX, NK cell, and S3-NK cell treatment groups, the combined treatment groups (S3-NTr-DOX combined with NK cell, S3-NTr-DOX combined with S3-NK cell) showed a more obvious downward trend in the survival rate of 5-8F cells, and the S3-NTr-DOX combined with S3-NK cell treatment group showed the most obvious downward range and trend in the survival rate of 5-8F cells. This indicates that S3-NTr-DOX combined with S3-NK cells has the strongest specific killing effect on nasopharyngeal carcinoma cells.

[0113] The schematic diagram of drug administration of S3-NTr-DOX combined with S3-NK cells is shown in Figure 8 shown.

[0114] The above is only a preferred embodiment of the present invention, and the protection scope of the present invention is not limited to the above embodiments. For those skilled in the art, improvements and changes obtained without departing from the technical concept of the present invention should also be regarded as the protection scope of the present invention.

Claims

1. A nanotrain drug delivery system targeting nasopharyngeal carcinoma, characterized in that: It comprises a nucleic acid aptamer nanotrain drug-loaded nanoparticle and an engineered NK cell, wherein the nucleic acid aptamer nanotrain drug-loaded nanoparticle comprises a nucleic acid aptamer S3, a DNA nanotrain and doxorubicin, wherein the DNA nanotrain is a long double-stranded structure formed by self-assembly of a hybridization chain reaction by base complementary pairing of DNA monomers M1 and M2 under the action of a nucleic acid aptamer trigger probe trigger; the DNA nanotrain is loaded with doxorubicin and then modified by the nucleic acid aptamer S3; the engineered NK cell is a NK cell modified by the nucleic acid aptamer S3; The sequence of the nucleic acid aptamer S3 is shown in SEQ ID NO.1; The sequence of the DNA monomer M1 is shown in SEQ ID NO.2; The sequence of the DNA monomer M2 is shown in SEQ ID NO.3; The sequence of the nucleic acid aptamer trigger probe trigger is shown in SEQ ID NO.

4.

2. A method for preparing the nanotrain drug delivery system as claimed in claim 1, characterized in that: The following steps are involved: S1. Preparation of DNA nanotrain: The 5′ end of the aptamer S3 is modified with the aptamer trigger probe trigger to obtain the chimera S3-trigger, which is introduced into the mixture of DNA monomers M1 and M2. The chimera S3-trigger is self-assembled by hybridization chain reaction based on the principle of complementary base pairing to form the DNA nanotrain S3-NTr. S2. Preparation of nucleic acid aptamer nanotrain drug-loaded nanoparticles: Adriamycin and the DNA nanotrain S3-NTr prepared in step S1 were mixed in a Mg-containing 2+ The S3-NTr was placed in Dulbecco's phosphate buffer and placed at room temperature, and doxorubicin was loaded into the drug loading site of S3-NTr to obtain S3-NTr-DOX. S3. Preparation of azide-modified NK92 cells: adding N-azidoacetylmannosamine-tetraacylated to NK92 cells, co-incubating with NK92 cells, and then collecting the cells and washing with PBS to obtain azide-modified NK92 cells; S4. Preparation of engineered NK cells: The azide-modified NK92 cells prepared in S3 were incubated with the FAM-labeled, DBCO-modified S3 aptamer in PBS buffer supplemented with 1% fetal bovine serum, and then washed with PBS buffer; the sequence of the DBCO-modified S3 aptamer is shown in SEQ ID NO.

5.

3. The preparation method according to claim 2, characterized in that: In the step S1, the concentration ratio of the mixture of the chimera S3-trigger and the DNA monomers M1 and M2 is 1:

10.

4. The preparation method according to claim 2, characterized in that: The time of standing at room temperature in step S2 is 2 hours.

5. The preparation method according to claim 2, characterized in that: The incubation time in step S3 is 24 hours.

6. The preparation method according to claim 2, characterized in that: The incubation temperature in step S4 is 37° C. and the incubation time is 2 h.

7. Use of the drug delivery system as claimed in claim 1 or the nanotrain drug delivery system prepared by the preparation method as claimed in any one of claims 2 to 6 in the preparation of drugs for targeted treatment of nasopharyngeal carcinoma.

8. Use according to claim 7, characterized in that The nanotrain drug delivery system is any pharmaceutically approved preparation.

9. The use according to claim 7, characterized in that The administration sequence of the nanotrain drug delivery system is: first administer the engineered NK cells, and then administer the nucleic acid aptamer nanotrain drug-loaded nanoparticles S3-NTr-DOX 4 hours later.

Images