Fusion protein capable of improving base editing activity and reducing off-target level

Abstract

The invention provides a fusion protein capable of improving base editing activity and reducing off-target level, and relates to the technical field of biology. According to the invention, a degradation system based on tDeg fusion protein is introduced into a base editing system for the first time to obtain a new base editing system capable of improving the base editing efficiency and reducing the off-target level, specifically, a degradation determinant sequence and RNA binding polypeptide are fused with a base editing element of a base editor to obtain fusion protein; and meanwhile, Pepper RNA is introduced into a loop region of the sgRNA, so that the base editing system disclosed by the invention is obtained. The high-efficiency and low-off-target-rate base editing system constructed by the invention can further promote wide application of base editing tools, especially gene therapy and clinical disease treatment.

Description

Technical Field

[0001] The present application relates to the field of biotechnology, and in particular to a fusion protein that improves base editing activity and reduces off-target levels. Background Art

[0002] Studies have shown that about 60% of genetic diseases are caused by single base mutations. The efficiency of repairing these genetic diseases using traditional CRISPR-mediated homologous recombination is very low, and the treatment effect is poor. The new generation of gene editing technology, namely base editing technology, can achieve efficient base conversion, bringing hope of cure for genetic diseases caused by single base mutations. At present, the main representatives of base editing technology are cytosine base editing technology (CBE) and adenine base editing technology (ABE), which are formed by the fusion of cytosine deaminase or adenine deaminase with Cas9, and can achieve efficient C to T and A to G base conversion at specific sites in the genome, respectively, and can be applied to the treatment and correction of 16% and 47% of genetic diseases caused by base mutations, respectively.

[0003] ABE is one of the most important basic research tools in base editors. Its initial editing efficiency was relatively low. After development in recent years, its editing efficiency has been effectively improved through directed evolution and rational design, resulting in more efficient versions such as ABE8e and ABE8r. However, the editing efficiency of these efficient versions of ABE is limited, and it also brings new safety risks, such as unpredictable DNA off-target in the genome.

[0004] In summary, there is an urgent need for base editing tools that combine editing accuracy and high editing efficiency. Summary of the invention

[0005] In order to further improve the editing efficiency and reduce the off-target risk, the present invention introduces a degradation system based on tDeg fusion protein into the base editing system, establishing a new strategy to improve the base editing efficiency and reduce the off-target level.

[0006] On the one hand, the present application provides a fusion protein, which includes a protein degradation element (tDeg) and a base editing element; the protein degradation element includes a degradation determinant and an RNA binding polypeptide (Tat peptide).

[0007] Furthermore, the protein degradation element is located at the C-terminus of the fusion protein; preferably, the RNA binding polypeptide and the degradation determinant are sequentially connected starting from the N-terminus of the sequence toward the C-terminus.

[0008] Among them, two amino acids in the degradation determinant are shared with the RNA binding polypeptide, so their position order is (starting from the N-terminus of the sequence to the C-terminus): RNA binding polypeptide-degradation determinant.

[0009] Furthermore, the degron comprises an amino acid sequence as shown in SEQ ID NO.1 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.1.

[0010] The amino acid sequence shown in SEQ ID NO.1 or an amino acid sequence having at least 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% sequence identity with SEQ ID NO.1.

[0011] Preferably, the sequence encoding the degradation determinant comprises the nucleotide sequence shown in SEQ ID NO.2 or a nucleotide sequence having at least 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% sequence identity with SEQ ID NO.2.

[0012] Furthermore, the RNA binding polypeptide comprises an amino acid sequence as shown in SEQ ID NO.3 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.3.

[0013] Preferably, the RNA binding polypeptide comprises an amino acid sequence as shown in SEQ ID NO.3 or an amino acid sequence having at least 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% sequence identity with SEQ ID NO.3.

[0014] Preferably, the sequence encoding the RNA-binding polypeptide comprises the nucleotide sequence shown in SEQ ID NO.4 or a nucleotide sequence having at least 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% sequence identity with SEQ ID NO.4.

[0015] More preferably, the protein degradation element comprises an amino acid sequence as shown in SEQ ID NO.5 or an amino acid sequence having at least 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% sequence identity with SEQ ID NO.5;

[0016] The sequence encoding the protein degradation element includes the nucleotide sequence shown in SEQ ID NO.6 or a nucleotide sequence having at least 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% sequence identity with SEQ ID NO.6.

[0017] Furthermore, the base editing element comprises a glycosylase, a nucleoside deaminase and / or a nuclease.

[0018] The base editing element may be a functional element or a combination thereof for realizing base editing in a known base editor. The base editor includes but is not limited to a base editor at the DNA level such as ABE, CBE, ACBE, CGBE, AYBE, gGBE, or a base editor at the RNA level such as REPAIR, RESCUE or one or more thereof.

[0019] In a preferred embodiment, the ABE base editing system is used as an example to introduce a protein degradation element (tDeg) for modification.

[0020] Further, the nucleoside deaminase includes cytosine deaminase and / or adenosine deaminase; preferably, the deaminase is adenosine deaminase; more preferably, the adenosine deaminase is TadA-8e; more preferably, the amino acid sequence of the adenosine deaminase includes the sequence shown in SEQ ID No.7 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.7; more preferably, the nucleotide sequence encoding the adenosine deaminase includes the sequence shown in SEQ ID No.8 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.8.

[0021] Further, the nuclease is selected from one or any several of Cas9, Cas3, Cas8a, Cas8b, Cas10d, Cse1, Csy1, Csn2, Cas4, Cas10, Csm2, Cmr5, Fok1, and Cpf1; preferably, the nuclease is Cas9; more preferably, the Cas9 is spCas9n; more preferably, the amino acid sequence of the spCas9n includes the amino acid sequence shown in SEQ ID No.9 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.9; more preferably, the coding sequence of the spCas9n includes the nucleotide sequence shown in SEQ ID No.10 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.10.

[0022] Furthermore, the fusion protein further comprises NLS; preferably, the NLS is located at at least one end of the fusion protein; more preferably, the NLS is located at both ends of the fusion protein.

[0023] Those skilled in the art will appreciate that the fusion protein of the present application can be constructed using known NLS sequences.

[0024] In a preferred embodiment, the amino acid sequence of the NLS is shown as SEQ ID No.11; the coding sequence of the NLS is shown as SEQ ID No.12.

[0025] Those skilled in the art will appreciate that a known linker can be added between the protein degradation element and the base editing element for connection, and that the fusion protein can also be subjected to known modifications, including phosphorylation, acetylation, ubiquitination, glycosylation, etc., without affecting the function of the fusion protein itself.

[0026] In a preferred embodiment, the base editing element and the protein degradation element in the fusion protein are connected in sequence starting from the N-terminus of the sequence toward the C-terminus.

[0027] In a preferred embodiment, starting from the N-terminus of the sequence toward the C-terminus, the NLS, adenine deaminase, nuclease, NLS, and protein degradation element in the fusion protein are connected in sequence.

[0028] On the other hand, the present application also provides a biomaterial, which comprises any one of the following A)-D):

[0029] A) a gene encoding the fusion protein;

[0030] B) an expression cassette, the expression cassette comprising the gene described in A);

[0031] C) a recombinant vector, the recombinant vector containing A) the gene and / or B) the expression cassette;

[0032] D) a recombinant cell or recombinant bacterium, comprising the fusion protein, A) the gene, B) the expression cassette and / or C) the recombinant vector.

[0033] The expression cassette described herein may also include functional elements such as promoters, terminators, and marker genes, and those skilled in the art may make routine selections based on actual conditions, as long as the expression of the gene described in A) can be achieved. The structure and composition of the expression cassette are not excessively restricted here.

[0034] The vector described in this article refers to a vector that can carry exogenous DNA or target gene into host cells for amplification and expression. The vector can be a cloning vector or an expression vector. Those skilled in the art can choose according to actual conditions, and no excessive restrictions are imposed here.

[0035] It is understandable that those skilled in the art can select appropriate gene editing systems and gene editing methods according to actual conditions to complete the transformation of the above-mentioned mutants.

[0036] On the other hand, the present application also provides a base editing system, which includes the fusion protein or the biological material.

[0037] Preferably, the base editing system is a single-base gene editing system.

[0038] Furthermore, the system also includes sgRNA, which guides the fusion protein to perform base editing on the target gene; preferably, the sgRNA also includes an RNA-binding polypeptide response sequence (TAR, Pepper RNA), which binds to the RNA-binding polypeptide response sequence; more preferably, the RNA-binding polypeptide response sequence includes a nucleotide sequence as shown in SEQ ID NO.13 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.13.

[0039] More preferably, the RNA-binding polypeptide response sequence comprises a nucleotide sequence as shown in SEQ ID NO.13 or a nucleotide sequence having at least 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity with SEQ ID NO.13.

[0040] In a preferred embodiment, the editing target is ABLIM3, and the sequence of the human endogenous target ABLIM3 is shown as SEQ ID NO.16.

[0041] Preferably, the RNA binding polypeptide is inserted into the loop region of the sgRNA.

[0042] The sgRNA sequence is shown as SEQ ID No.14.

[0043] In a preferred embodiment, the sequence of the RNA binding polypeptide after insertion into the sgRNA is as shown in SEQ ID No.15.

[0044] Those skilled in the art will appreciate that this application only uses the target ABLIM3 as an example, and other editing targets can be selected and designed for gene editing operations on this basis, and no excessive restrictions are imposed here.

[0045] In a preferred embodiment, when the base editing element is ABE, the system can achieve single base editing from A to G.

[0046] On the other hand, the present application also provides the use of a protein degradation element in a base editing system, wherein the protein degradation element includes a degradation determinant and an RNA binding polypeptide; preferably, the use includes reducing the off-target level of the base editing system and / or improving the gene editing efficiency of the base editing system.

[0047] The base editing system includes but is not limited to one or more base editing systems at the DNA level such as ABE, CBE, ACBE, CGBE, AYBE, gGBE, or base editing systems at the RNA level such as REPAIR and RESCUE.

[0048] On the other hand, the present application also provides the use of the fusion protein, the biomaterial, or the base editing system in reducing off-target levels and / or improving gene editing efficiency.

[0049] Furthermore, the off-target level includes off-target at the DNA level and / or off-target at the RNA level; preferably, off-target at the DNA level includes sgRNA-dependent off-target and / or non-Cas9-dependent off-target.

[0050] In this application, the off-target level that is not dependent on Cas9 is used as an example to test the off-target level.

[0051] On the other hand, the present application also provides the use of the fusion protein, the biomaterial, or the base editing system in gene editing for non-disease diagnosis and treatment purposes and / or preparation of gene editing products.

[0052] The present invention has the following beneficial effects:

[0053] This application introduces a degradation system based on tDeg fusion protein into the base editing system for the first time, thereby obtaining a new base editing system that improves the base editing efficiency while reducing the off-target level. Specifically, the degradation determinant sequence and the RNA-binding polypeptide are fused with the base editing element of the base editor to obtain a fusion protein, and Pepper RNA is introduced into the loop region of the sgRNA to obtain the base editing system of this application.

[0054] The high-efficiency and low off-target rate base editing system constructed in this application will further promote the widespread application of base editing tools, especially in gene therapy and clinical disease treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] The drawings described herein are used to provide a further understanding of the present application and constitute a part of the present application. The illustrative embodiments of the present application and their descriptions are used to explain the present application and do not constitute an improper limitation on the present application. In the drawings:

[0056] Figure 1 This is the working principle diagram of ABE8e++;

[0057] Figure 2 Build schematics for ABE8e++;

[0058] Figure 3 Comparison of the editing efficiency of ABE8e++ at the endogenous human target ABLM3;

[0059] Figure 4 Comparison of off-target effects of ABE8e and ABE8e++. DETAILED DESCRIPTION

[0060] In order to more clearly explain the overall concept of the present application, the following is described in detail in conjunction with the accompanying drawings of the specification by way of embodiment. In the following description, a large number of specific details are provided to provide a more thorough understanding of the present invention. However, it is obvious to those skilled in the art that the present invention can be implemented without one or more of these details. In other examples, in order to avoid confusion with the present invention, some technical features well known in the art are not described.

[0061] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0062] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0063] Unless otherwise specified, in the following embodiments, the reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased commercially. The plasmids, endonucleases, PCR enzymes, column-based DNA extraction kits and DNA gel recovery kits used in the following examples are commercial products, and the specific operations are performed according to the kit instructions.

[0064] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are intended to describe specific embodiments, rather than to limit the scope of protection of the present invention. The test methods in the following examples without specifying specific conditions are generally carried out under conventional conditions or under conditions recommended by the manufacturers.

[0065] When the embodiments give numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the grasp of the prior art by those skilled in the art and the record of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention can also be used to realize the present invention.

[0066] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in the present invention all adopt conventional techniques in the field of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields, and can be specifically carried out according to Molecular Cloning: A Laboratory Manual (Fourth Edition).

[0067] In the present specification, the amino acids at the corresponding positions are represented by the recognized IUPAC single-letter abbreviations, wherein each amino acid and its abbreviation are: alanine (Ala or A), arginine (Arg or R), asparagine (Asn or N), aspartic acid (Asp or D), cysteine ​​(Cys or C), glutamine (Gln or Q), glutamic acid (Glu or E), glycine (Gly or G), histidine (His or H), isoleucine (Ile or I), leucine (Leu or L), lysine (Lys or K), methionine (Met or M), phenylalanine (Phe or F), proline (Pro or P), serine (Ser or S), threonine (Thr or T), tryptophan (Trp or W), tyrosine (Tyr or Y) and valine (Val or V).

[0068] 1.1 Plasmid design and construction

[0069] 1.1.1 The present invention introduces a degradation determinant sequence (i.e., Arg-Arg-Arg-Gly) and an RNA binding peptide (Tat peptide) into ABE8e (wherein the degradation determinant sequence and the RNA binding peptide form tDeg), and simultaneously introduces Pepper RNA into the loop region of sgRNA. When the fusion protein exists independently, the degradation determinant will recruit proteasomes to degrade the protein; and when the fusion protein binds to the corresponding sgRNA, the Tat peptide can bind to TAR (Pepper RNA) to protect the degradation determinant, thereby preventing the recruitment of proteasomes required for protein hydrolysis and enhancing its stability (e.g., Figure 1 ). A precise adenine base editor, ABE8e++, was developed to enhance base editing activity while reducing off-target effects.

[0070] The fusion protein in the present invention is based on the ABE8e backbone and constructed using the ClonExpress MultiS one-step cloning kit (Vazyme). The ABE8e (#138489) plasmid was obtained from Addgene, and the polymerase chain reaction (PCR) was performed using KOD-Plus-Neo DNA polymerase (Toyobo, code: KOD-401). The schematic diagram of the structure of the fusion protein ABE8e++ is shown in Figure 2 The involved sequences are shown in Table 1.

[0071] Table 1 Proteins and sequences

[0072]

[0073]

[0074]

[0075] In the present invention, the RNA binding peptide (Tat peptide) corresponding to the trans-activation response element (TAR) - Pepper RNA is fused to the loop region of sgRNA, and Genewiz (Suzhou, China) synthesizes the sgRNA vector fused with PepperRNA. Specifically, the Pepper RNA (ggctcgttgagctcattagctccgagcc, SEQ ID NO.13) sequence is inserted into the loop region of sgRNA (sequence: gttttagagctagaaatagcaagttaaaat aaggctagtccgttatcaacttaagtggcaccgagtcggtgc, SEQ ID NO.14) to obtain the sgRNA vector fused with Pepper RNA (sequence: gttttagagctagaaatagcaagttaaaataaggctagtcc gttatcaacttggctcgttgagctcattagctccgagccaagtggcaccgagtcggtgc, SEQ ID NO.15). The sgRNA expression plasmid was constructed by annealing the oligonucleotides (Oligo in Table 2) at 95°C for 5 minutes, then cooling to room temperature and ligating into the synthetic BbsI linearized vector containing PepperRNA sgRNA (Thermo Fisher Scientific) to obtain ABLIM3-Pepper RNA.

[0076] In this invention, the human endogenous target ABLIM3 (GTCATCCAGTGCTACCGCTGTG G, SEQ ID NO.16) was used as an example to test the targeted editing efficiency of ABE8e++. For unpredictable DNA off-target, an improved R-loop experiment was used for evaluation, that is, the dSaCas9-sgRNA plasmid was replaced with the nSaCas9-sgRNA plasmid at the orthogonal R-loop site in the genome to perform Cas9-independent DNA off-target analysis (reference: Doman, JL, Raguram, A., Newby, GA et al. Eva luation and minimization of Cas9-independent off-target DNA editing by cyto sine base editors. Nat Biotechnol 38, 620–628 (2020). https: / / doi.org / 10.1038 / s41587-020-0414-6). The nSaCas9-sgRNA (#138162) plasmid was obtained from Addgene.

[0077] 1.1.2 The plasmid and related sequences constructed in 1.1.1 were sequenced by Sanger sequencing to ensure that they were completely correct.

[0078] 1.2 Cell transfection

[0079] HEK293T 2×10 5 The cells were plated in 24-well plates. When the cells grew to 70%-80%, 3 μl of polyethylenimine (PEI, Polysciences) and 1 μg of plasmid DNA (375 ng nSaCas9-sgRNA plasmid, 375 ng base editing plasmid and 250 ng sgRNA plasmid) were added to the cells. Each plasmid combination was transfected in 3 replicates, with 2×10 5 At the same time, a blank control without transfection of any plasmid was set up. After 24h and 48h of transfection, the supernatant was discarded and 500μl of complete medium (DMEM+FBS+PS) was added. After 72h, 0.25% trypsin (Gibco) was used for digestion and centrifugation to prepare for extraction of cell genome.

[0080] The base editing plasmid was ABE8e++, with ABE8e as the control;

[0081] nSaCas9-sgRNA plasmid including Sa site 1 (R-loop1)

[0082] (GTGGTAGACAGCATGTGTCCTA)、Sa site 3(R-loop3)

[0083] (GTGTCAGGTAATGTGCTAAACA)、Sa site 4(R-loop4)

[0084] (GGTGGAGGAGGGTGCATGGGGT)、Sa site 5(R-loop5)

[0085] (TCTGCTTCTCCAGCCCTGGC),Sa site 6(R-loop6)

[0086] (GATGTTCCAATCAGTACGCA);

[0087] The sgRNA plasmid was the aforementioned ABLIM3-Pepper RNA.

[0088] 1.3 Genome extraction and amplicon library preparation

[0089] 72h after transfection, genomic DNA of cells was extracted using QuickExtractTMDNA extraction kit (QE09050) of BIOSEARCH. The corresponding identification primers (Table 2) were designed using the operation flow of the Hitom kit, that is, the bridging sequence 5'-ggagtgagtacggtgtgc-3' was added to the 5' end of the forward identification primer, and the bridging sequence 5'-gagttggatgctggatgg-3' was added to the 5' end of the reverse identification primer, and a round of PCR products was obtained. The obtained products were subjected to a second PCR using primers containing different barcode sequences. Subsequently, the PCR products of different tags were pooled together and deep sequenced on the Illumina HiSeq platform.

[0090] Table 2 Target related sequences used

[0091]

[0092] 1.4 Data Analysis

[0093] www.rgenome.net was used to process the NGS results. According to the tool characteristics, it was an adenine base editor, and the analysis type of SpCas9 NGG and ABE was selected. The A>G on the PAM sequence (usually 2-14nt) was counted, and the data was summarized and plotted using Graphpad. The statistical results of the editing efficiency of ABE8e++ at the endogenous target ABLM3 in humans are as follows Figure 3 The off-target efficiency statistics of ABE8e and ABE8e++ are shown in Figure 4 As shown, the blank control group is untreated, indicating the mutations existing in the genome itself.

[0094] in conclusion:

[0095] like Figure 3 As shown, ABE8e++ and ABE8e can both produce editing in A4 and A8 of the ABLIM3 target site, but with different editing efficiencies. At the A4 position, in different R-loop groups, the editing efficiency of ABE8e++ was 1.06, 1.19, 1.03, 1.08, and 1.13 times the original, respectively. The highest editing efficiency was 50.7% (R-loop3 group), which was 8% (1.19 times) higher than the efficiency of the ABE8e group of 42.7%. At the A8 position, the editing efficiency of ABE8e++ was 1.05, 1.19, 1.08, 1.08, and 1.13 times the original, respectively. The highest editing efficiency was 50.7% (R-loop3 group), which was 8.1% (1.19 times) higher than the efficiency of the ABE8e group of 42.6%. Therefore, the strategy of introducing tDeg fusion protein into ABE can effectively improve its targeted editing efficiency.

[0096] like Figure 4 As shown, in terms of non-Cas9-dependent off-target levels, the non-targeted editing produced by ABE8e++ decreased significantly, with an average decrease of 0.15 times. On R-loop3, 4, and 6, ABE8e++ brought about a 0.15, 0.10, and 0.20-fold reduction in off-target levels, respectively. Among them, at the R-loop6 site, ABE8e++ brought about a 0.53% (0.20-fold) reduction in off-target levels (2.64% in the ABE8e group and 2.11% in the ABE8e++ group). Therefore, it can be seen from the above results that the strategy of introducing tDeg fusion protein into ABE can effectively reduce its unpredictable DNA off-target.

[0097] The above is only an embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various changes and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application should be included in the scope of the claims of the present application.

Claims

1. A fusion protein, characterized in that The fusion protein includes a protein degradation element and a base editing element; the protein degradation element includes a degradation determinant and an RNA binding polypeptide.

2. The fusion protein according to claim 1, characterized in that The protein degradation element is located at the C-terminus of the fusion protein; preferably, the RNA binding polypeptide and the degradation determinant are sequentially connected starting from the N-terminus of the sequence toward the C-terminus.

3. The fusion protein according to claim 1, characterized in that The degradation determinant comprises an amino acid sequence as shown in SEQ ID NO.1 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.1; and / or, the RNA-binding polypeptide comprises an amino acid sequence as shown in SEQ ID NO.3 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.

3.

4. The fusion protein according to claim 1, characterized in that The base editing element comprises a glycosylase, a nucleoside deaminase and / or a nuclease; Preferably, the nucleoside deaminase comprises cytosine deaminase and / or adenosine deaminase; more preferably, the deaminase is adenosine deaminase; more preferably, the adenosine deaminase is TadA-8e; more preferably, the amino acid sequence of the adenosine deaminase comprises the sequence shown in SEQ ID No.7 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.7; more preferably, the nucleotide sequence encoding the adenosine deaminase comprises the sequence shown in SEQ ID No.8 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.8; Preferably, the nuclease is selected from one or any several of Cas9, Cas3, Cas8a, Cas8b, Cas10d, Cse1, Csy1, Csn2, Cas4, Cas10, Csm2, Cmr5, Fok1, and Cpf1; more preferably, the nuclease is Cas9; more preferably, the Cas9 is spCas9n; more preferably, the amino acid sequence of the spCas9n includes the amino acid sequence shown in SEQ ID No.9 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.9; more preferably, the coding sequence of the spCas9n includes the nucleotide sequence shown in SEQ ID No.10 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.10; Preferably, the fusion protein further comprises NLS; preferably, the NLS is located at at least one end of the fusion protein; more preferably, the NLS is located at both ends of the fusion protein.

5. Biomaterial, characterized in that The biological material includes any one of the following A)-D): A) a gene encoding the fusion protein according to any one of claims 1 to 4; B) an expression cassette, the expression cassette comprising the gene described in A); C) a recombinant vector, the recombinant vector containing A) the gene and / or B) the expression cassette; D) A recombinant cell or recombinant bacterium, comprising the fusion protein according to any one of claims 1 to 4, the gene according to A), the expression cassette according to B and / or the recombinant vector according to C).

6. A base editing system, characterized in that: The system comprises the fusion protein according to any one of claims 1 to 4 or the biomaterial according to claim 5 .

7. The base editing system according to claim 6, characterized in that The system further comprises an sgRNA, wherein the sgRNA guides the fusion protein to perform base editing on the target gene; preferably, the sgRNA further comprises an RNA-binding polypeptide response sequence, wherein the RNA-binding polypeptide response sequence binds to the RNA-binding polypeptide; more preferably, the RNA-binding polypeptide response sequence comprises a nucleotide sequence as shown in SEQ ID NO.13 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.

13.

8. Application of a protein degradation element in a base editing system, characterized in that: The protein degradation element includes a degradation determinant and an RNA binding polypeptide; preferably, the application includes reducing the off-target level of the base editing system and / or improving the gene editing efficiency of the base editing system.

9. Use of the fusion protein as described in any one of claims 1 to 4, or the biomaterial as described in claim 5, or the base editing system as described in claim 6 or 7 in reducing off-target levels and / or improving gene editing efficiency.

10. Use of the fusion protein as described in any one of claims 1 to 4, or the biomaterial as described in claim 5, or the base editing system as described in claim 6 or 7 in gene editing for non-disease diagnosis and treatment purposes and / or preparation of gene editing products.

Images