Metarhizium anisopliae for controlling red imported fire ants as well as engineering bacteria and application of metarhizium anisopliae

Abstract

The invention relates to the technical field of solenopsis invicta prevention and control, in particular to metarhizium palustris for preventing and controlling solenopsis invicta as well as engineering bacteria and application of the metarhizium palustris. The Metarhizium anisopliae provided by the invention is a strain which is separated from the field and has high toxicity to the solenopsis invicta, and can be used for preventing and treating the solenopsis invicta or constructing engineering bacteria for preventing and treating the solenopsis invicta. The engineering bacterium constructed by the invention has high toxicity to solenopsis invicta, and can enable the bombyx batryticatus infected with the solenopsis invicta to volatilize a large amount of a solenopsis invicta attractant longifolene, so that the bombyx batryticatus has a trapping and killing effect on the worker solenopsis invicta, and the sanitary behavior of the worker is obviously slowed down. When the engineering bacteria constructed by the invention are combined with a small amount of chemical insecticide bait, the control effect of wettable powder taking spores of the engineering bacteria as an active component on a multi-ant nest (a single-ant nest) of solenopsis invicta is 79% (58%) within 3 days, 93% (90%) within 7 days and 98% (98%) within 28 days, and the method has the advantages of safety, high efficiency and the like.

Description

Technical Field

[0001] The invention relates to the technical field of red fire ant control, and in particular to a strain of Metarhizium anisopliae for controlling red fire ants, an engineered strain thereof and an application thereof. Background Art

[0002] The red fire ant is a major invasive alien pest with a varied diet, strong aggressiveness, and high reproductive capacity. It seriously endangers agricultural and forestry production, human and animal health, public safety, and ecological balance. In recent years, the spread of the ant has accelerated in many countries around the world, and new outbreaks are evident. At present, the prevention and control of the red fire ant relies on the large-scale application of contact-killing chemical pesticides, which seriously threatens human health and biodiversity. At the same time, there are many drawbacks such as the risk of drug resistance and environmental pollution. Research and development of environmentally friendly biological control methods to achieve sustainable control of the red fire ant is an important part of the future red fire ant efficient control technology system.

[0003] Domestic and foreign scholars have conducted research on biological control of red fire ants for many years, focusing on screening highly effective strains of insecticidal fungi such as Metarhizium and Beauveria bassiana and developing supporting application technologies. Currently, people have obtained a number of strains with strong toxicity to red fire ants, but the control effect is not ideal. Summary of the invention

[0004] In order to solve the above problems, the present invention provides a strain of Metarhizium anisopliae for controlling red fire ants and its engineered bacteria and applications. The Metarhizium anisopliae provided by the present invention is a strain isolated from the wild with high toxicity to red fire ants, which can be used to control red fire ants or construct engineered bacteria for controlling red fire ants.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] The invention provides a strain of Metarhizium pingshaense, whose preservation number is CGMCCNO.41511.

[0007] The present invention provides the use of Metarhizium anisopliae described in the above technical scheme in preventing and controlling red imported fire ants or in constructing engineered bacteria for preventing and controlling red imported fire ants.

[0008] The present invention provides an engineered bacterium for controlling red imported fire ants, the engineered bacterium comprising a starting strain and a pine longifolene synthesis gene Tps introduced into the starting strain; the starting strain comprises the flat sand green fungus described in the above technical scheme; the amino acid sequence of the protein encoded by the pine longifolene synthesis gene Tps is shown in SEQ ID NO.11.

[0009] Preferably, the engineered bacteria further comprises a selection marker gene introduced into the starting strain; the selection marker gene is the methylmercury demethylase gene Mmd of the starting strain itself, and the nucleotide sequence of the methylmercury demethylase gene Mmd is shown in SEQ ID NO.5.

[0010] Preferably, the methylmercury demethylase gene Mmd is driven by the promoter of the 3-phosphoglyceraldehyde dehydrogenase gene Gpd of the starting strain itself, and the nucleotide sequence of the promoter is shown in SEQ ID NO.6.

[0011] The present invention provides a fungal agent for controlling red imported fire ants, comprising: spore powder, a solid phase carrier, an emulsifier and a dispersant; the spore powder is the spore powder of Metarhizium anisopliae described in the above technical solution and / or the spore powder of the engineered bacteria described in the above technical solution.

[0012] Preferably, the solid phase carrier includes talc; the emulsifier includes sodium dodecyl sulfate; and the dispersant includes sodium methylene bisnaphthalene sulfonate.

[0013] The present invention provides the use of the engineered bacteria described in the above technical solution or the bacterial agent described in the above technical solution in preventing and controlling red fire ants.

[0014] The present invention provides a method for preventing and controlling red fire ants, comprising: applying a bait for luring and killing red fire ants to the surface of a red fire ant nest, and adding a spore suspension to the red fire ant nest after the bait is carried away by the ant colony; the spores in the spore suspension comprise: one or more of the spores of Metarhizium anisopliae described in the above technical solution, the spores of the engineered bacteria described in the above technical solution, and the spore powder in the bacterial agent described in the above technical solution.

[0015] Preferably, the bait for luring and killing red fire ants includes hydrazone.

[0016] Beneficial effects:

[0017] The present invention provides a strain of Metarhizium pingshaense, with a deposit number of CGMCCNO. 41511. The Metarhizium pingshaense provided by the present invention is a strain isolated from the wild and highly toxic to red fire ants, and can be used to control red fire ants or construct engineered bacteria for controlling red fire ants.

[0018] Furthermore, the engineered bacteria constructed by the present invention have high toxicity to red fire ants. By expressing the pine longifolene synthesis gene Tps, the engineered bacteria can make the dead insects infected with red fire ants volatilize a large amount of red fire ant attractant longifolene, which makes the dead insects have a luring and killing effect on red fire ant workers and significantly slows down the hygienic behavior of the workers. When the engineered bacteria constructed by the present invention are used in combination with a small amount of chemical insecticide bait, the wettable powder with the spores of the engineered strain as the active ingredient has a protective effect of 79% (58%) within 3 days, 93% (90%) within 7 days, and 98% (98%) within 28 days on the red fire ant multi-queen nest (single queen nest), and the method has the advantages of safety and high efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0020] Figure 1 The results of phylogenetic analysis based on the nucleotide sequences of TEF genes of strain TM1 (bold) and other taxonomically determined Metarhizium species;

[0021] Figure 2 The results of the toxicity analysis of Metarhizium anisopliae against red imported fire ants; A is the median lethal time (LT) 50 , different letters indicate significant differences, i.e., P<0.05; B is the cumulative mortality of red fire ant workers at different days after inoculation;

[0022] Figure 3 The percentage of preference of red imported fire ants for longifolene; * means P < 0.01, ** means P < 0.001;

[0023] Figure 4 is a map of plasmid pPK2-Mmd-GFP;

[0024] Figure 5 is a map of plasmid pPK2-Tps-Mmd-GFP;

[0025] Figure 6 PCR verification results of the Tps gene inserted into the genome of the engineered strain Mmd-Tps;

[0026] Figure 7 The results of the analysis of the attraction of the dead insects obtained by infecting red fire ant workers with the engineered strain Mmd-Tps; where A is the median lethal time LT of the engineered strain Mmd-Tps to red fire ant workers 50; B is the fire ant larvae infected with Mmd-Tps; C is the volatile amount of longifolene in the larvae; D is the response index of fire ant workers to the engineered strain Mmd-Tp larvae detected by the two-way selection method; E is the result of the preference analysis of healthy fire ant workers to Mmd-Tps larvae; different letters indicate significant differences, i.e. P<0.05; B~E are 10 7 Infection results of spores / mL spore concentration;

[0027] Figure 8 The results of the hygienic behavior analysis of healthy worker ants in the ant colony towards the dead insects of Metarhizium anisopliae and its engineered strain Mmd-Tp; A is the statistical result of the time when the two dead insects began to abandon the corpses; B is the proportion of individuals re-inoculated with spores on the body surface of dead insects during the process of moving corpses;

[0028] Fig. 9 These are the results of the efficacy test of the engineered strain Mmd-Tps combined with hydrazone bait against red imported fire ants; A is the control effect of a single-queen ant nest; B is the control effect of a multi-queen ant nest; C is the migration rate of the ant nest after treatment; different letters indicate that the effects of different control methods in the same social type are significantly different, i.e. P<0.05.

[0029] Biological Deposit Description

[0030] Metarhizium flatshaense, biologically classified as Metarhiziumpingshaense, was deposited in the China General Microbiological Culture Collection (CGMCC) on September 18, 2024. The deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCCNO.41511. DETAILED DESCRIPTION

[0031] The present invention provides a strain of Metarhiziumpingshaense, with a preservation number of CGMCCNO.41511. The Metarhiziumpingshaense provided by the present invention has a spore concentration of 10 7 spores / mL, the LT 50 The half-lethal time is only 3.4 days, and the lethality rate after 14 days of inoculation is 95%. The speed of killing red fire ants by this strain is better than that of the reported insecticidal fungal strains retrieved.

[0032] Based on the above advantages, the present invention provides the use of the Metarhizium anisopliae described in the above technical scheme in preventing and controlling red fire ants or constructing engineered bacteria for preventing and controlling red fire ants.

[0033] The present invention provides an engineered bacterium for controlling red imported fire ants, the engineered bacterium comprising a starting strain and a pine longifolene synthesis gene Tps introduced into the starting strain; the starting strain comprises the Metarhizium anisopliae described in the above technical solution; the amino acid sequence of the protein encoded by the pine longifolene synthesis gene Tps is preferably as shown in SEQ ID NO.11, specifically as follows:

[0034] .

[0035] As an embodiment, the nucleotide sequence of the pine longifolene synthesis gene Tps is shown in SEQ ID NO.12, which is as follows:

[0036]

[0037] Due to the hygiene and migration behavior of red fire ants, fungal insecticides are not effective. The present invention found that longifolene has an attractant effect on red fire ant workers. When the concentration is 10 -3 g / mL, 10 -4 g / mL, 10 -5 g / mL, the effect is significant, and the engineered bacteria constructed by utilizing this characteristic and the high toxicity of Pingsha Green Anisopliae can effectively lure and kill red fire ants; the dead insects formed by killing the red fire ant queens by the engineered strain can volatilize the red fire ant attractant longifolene, which can lure and kill healthy worker ants and significantly slow down the hygienic behavior of the worker ants; the engineered bacteria provided by the present invention have a high preventive effect on both single-queen and multi-queen nests of red fire ants, with a preventive effect of 90% after one week of treatment and 98% after four weeks.

[0038] As an embodiment, the screening marker gene of the engineering bacteria is the methylmercury demethylase gene Mmd of the starting strain itself, and the nucleotide sequence of the methylmercury demethylase gene Mmd is shown in SEQ ID NO.5; the methylmercury demethylase gene Mmd is driven by the promoter of the 3-phosphoglyceraldehyde dehydrogenase gene Gpd of the starting strain itself, and the nucleotide sequence of the promoter is shown in SEQ ID NO.6. When the engineering strain is genetically transformed with insecticidal fungi, herbicide resistance genes are often used as screening marker genes, but these exogenous marker genes are prone to cause concerns about the safety of the engineering strain. The screening marker gene of the present invention is the methylmercury demethylase gene Mmd of Metarhizium anisopliae itself, and its expression is also driven by the promoter of the 3-phosphoglyceraldehyde dehydrogenase gene Gpd of the fungus itself, that is, the engineering strain does not contain an exogenous screening marker gene, so there is no risk of horizontal transfer of exogenous resistance genes, and the safety of the engineering strain is guaranteed.

[0039] The present invention provides a fungal agent for controlling red imported fire ants, comprising: spore powder, a solid phase carrier, an emulsifier and a dispersant; the spore powder is the spore powder of Metarhizium anisopliae described in the above technical solution and / or the spore powder of the engineered bacteria described in the above technical solution.

[0040] As an embodiment, the solid phase carrier can be talc; the emulsifier can be sodium dodecyl sulfate; the dispersant can be sodium methylene bisnaphthalene sulfonate; the spore powder is pure spore powder, which is obtained by sieving with a 50-mesh standard sieve (pore size 0.355 mm).

[0041] As an embodiment, the bacterial agent is composed of the following components in percentage by mass: 35% fungal spore powder, 57% talcum powder, 3% sodium dodecyl sulfate and 5% sodium methylene bisnaphthalene sulfonate. The bacterial agent provided by the invention can be prepared into a spore suspension by adding water on site when preventing and controlling red fire ants.

[0042] The solid phase carrier, emulsifier and dispersant in the bacterial agent provided by the present invention can be mixed with spore powder to prepare a wettable powder, so that the spore powder can be better dissolved in water and is easy to use; wherein the carrier mainly plays two roles, one is to serve as a tiny container for fungal spores, so that the spores can be attached to the carrier, and at the same time, it serves as a solid diluent to dilute the spore powder to avoid the spore powder concentration being too high and agglomerating during use; the second is to protect and restore the activity of the spores to avoid the spores from losing their vitality after long-term storage and prolonging the storage time of the spores; the emulsifier can help the hydrophobic spores to be suspended in water, so that the spores can be diluted and spread, and wetted faster in water; the dispersant can increase the viscosity of the solution, thereby increasing the resistance of the spores to sedimentation, delaying their sedimentation, and improving the suspension stability of the spore suspension.

[0043] Based on the above advantages, the present invention provides the use of the engineered bacteria described in the above technical solution or the bacterial agent described in the above technical solution in preventing and controlling red fire ants.

[0044] The present invention provides a method for preventing and controlling red fire ants, comprising: applying a bait for luring and killing red fire ants to the surface of a red fire ant nest, and adding a spore suspension to the red fire ant nest after the bait is carried away by the ant colony; the spores in the spore suspension comprise: one or more of the spores of Metarhizium anisopliae described in the above technical solution, the spores of the engineered bacteria described in the above technical solution, and the spore powder in the bacterial agent described in the above technical solution.

[0045] As an embodiment, the bait for luring and killing red fire ants can be hydrazone; the usage amount of the bait for luring and killing red fire ants is 20g / each ant nest; the ant nest can be a single queen ant nest and / or a multi-queen ant nest.

[0046] The method provided by the present invention uses a small amount of chemical bait to kill red fire ants to treat the ant nest, so that the activity of the ant colony decreases, and then a spore suspension prepared by a wettable powder of an engineered strain of Metarhizium anisopliae (or a wild strain) is poured into the nest. The dead insects formed by killing red fire ants by the strain can further lure and kill other individuals in the red fire ant nest, causing the fungus to spread in the ant nest and eventually kill the entire ant nest. The method provided by the present invention has a good control effect on red fire ants, and greatly reduces the amount of chemical pesticides used, and has a great application prospect.

[0047] To further illustrate the present invention, a strain of Metarhizium anisopliae for controlling red imported fire ants and its engineered bacteria and applications provided by the present invention are described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0048] Example 1 Screening of highly toxic Metarhizium anisopliae strains against red imported fire ants

[0049] A strain of Metarhizium anisopliae was isolated from the grassland soil of Tianmu Mountain in Hangzhou, China and named TM1. PCR amplification was performed based on the 5′ end of elongation factor 1-α (5TEF) using primers EF1T and EF2T. The specific sequence is as follows:

[0050] EF1T: 5'-atgggtaaggargacaagac-3', SEQ ID NO. 13;

[0051] EF2T: 5'-ggargtaccagtsatcatgtt-3', SEQ ID NO.14;

[0052] The sequence obtained by sequencing is shown in SEQ ID NO.15, which is as follows:

[0053] 5'-ttttttttagtggatatgaggggcaagactcacatcaacgtggtcgttatcgtaagtcgcctgcctccatttcgaact -3'

[0054] Phylogenetic analysis was performed by combining it with the 5TEF reference sequences of nine representative species of the genus Metarhizium that had been verified by taxonomy. The results showed that the strain (TM1) was Metarhizium pingshaense (Mp). Figure 1, is a phylogenetic tree constructed by the maximum likelihood method. The Genbank gene accession number of each sequence is shown after the branches; the numbers on the nodes represent the support rates of the maximum likelihood method (left), the neighbor-joining method (middle) and the Bayesian deductive method (right); the hyphen (-) indicates that there is no support rate at this node in the corresponding method; the scale bar represents the estimated number of nucleotide substitutions at each site.

[0055] Spores of Metarhizium anisopliae (Mp) cultured on PDA medium for 14 days were taken and dissolved in 0.01% TritonX-100. After vortexing and homogenization, the spore suspension was obtained by passing through a glass wool filter. The spore concentration of the suspension was determined by a hemocytometer and diluted to the required concentration (10 5 , 10 6 , 10 7 spores / mL) are used to inoculate red fire ants. The inoculation is carried out in an immersion manner, that is, the red fire ant workers are picked into a 50mL centrifuge tube containing 15mL of spore suspension, and gently shaken for 15s to immerse all the red fire ant workers in the spore suspension, and then quickly transferred to absorbent paper to absorb the moisture on the insect body surface. Each group of 10 worker ants are transferred to an insect box and placed in an incubator at 25°C and a light / dark cycle of 12h:12h. Honey water is placed in the insect box as food, and fresh honey water is replaced every 2 days. The death situation is observed every day, and the insect corpses are removed in time and cultured in a moisturizing manner for 3 to 5 days to observe whether green muscardine worms are formed. The formed worms are counted as dead insects. The toxicity test was repeated 3 times, with 100 insects tested each time, and 0.01% TritonX-100 was used as a blank control. The statistical results of the median lethal time and mortality rate are shown in Figure 2 .

[0056] The results showed that the Metarhizium anisopliae obtained by the present invention is a strain with high toxicity to red imported fire ants. 7 spores / mL, the LT 50 The half-lethal time is only 3.4 days, and the lethality rate is 95% after 14 days of inoculation. The speed of killing red fire ants by this strain is better than that of the reported insecticidal fungal strains retrieved. [1]～[4] The strain was deposited in China General Microbiological Culture Collection Center (CGMCC) with the deposit number CGMCC NO.41511.

[0057] [1] Metarhizium brunneum, Metarhizium anisopliae: Jin XX, Streett D, Huang YB, Ugine T. Development of a novel bioassay system to assess the effectiveness of entomopathogenic fungi against imported fireants. Biocontrol Science and Technology, 2012, 22(2): 233-241.

[0058] [2] Isaria fumosorosea, Beauveria bassiana, Metarhizium anisopliae: Qiu HL, Lu LH, Zhang CY, He YR. Pathogenicity of individual isolates of entomopathogenic fungi affects feeding prefererce of red imported fire ants Solenopsis invicta. Biocontrol Science and Technology, 2014, 24(11): 1286-1296.

[0059] [3] Beauveria bassiana: Li J, Guo Q, Lin MF, Jiang L, Ye JW, ChenDS, Li ZG, Dai JQ, Han SC. Evaluation of a new entomopathogenic strain of Beauveria bassiana and a new field delivery method against Solenopsis invicta. PLoS One, 2016, 11(6): e0158325.

[0060] [4] 11 strains of Beauveria bassiana and 9 strains of Metarhizium anisopliae: Wu Zhipeng, Tong Yinghua. Determination of pathogenicity of Beauveria bassiana and Metarhizium anisopliae to workers of red imported fire ants. Journal of Forestry and Environment, 2020, 40(01): 99-105.

[0061] Example 2 The attraction of longifolene to red imported fire ants

[0062] The attraction of longifolene to red imported fire ant workers was tested by the two-way selection method. Two circular filter papers with a diameter of 6 mm were placed on both sides of a 15 cm diameter petri dish. The two circular filter papers contained 10 μL of paraffin oil and 10 μL of paraffin oil solution containing longifolene, respectively. Different concentrations (10 -3 g / mL, 10 -4 g / mL, 10 -5 g / mL, 10 -6 g / mL, 10 -7 g / mL, 10 -8 g / mL, 10 -9 g / mL) of longifolene circular filter paper; then 20 healthy and active red fire ant workers were placed in the middle of the culture dish, and the choice of the workers was recorded after 10 minutes. The experiment was repeated 15 times, and the results are shown in Figure 3 The results showed that longifolene has an attractant effect on red fire ant workers. -3 g / mL, 10 -4 g / mL, 10 -5 g / mL, the effect is significant.

[0063] Example 3 Construction of plasmid pPK2-Mmd-GFP with the methylmercury demethylase gene Mmd of Metarhizium anisopliae as a screening marker gene

[0064] 1) The original plasmid vector used for construction was pPK2-Bar-GFP (published in the literature [Zhang et al., Horizontal gene transfer allowed the emergence of broad host range entomopathogens. Proc. Natl. Acad. Sci. USA 2019, 116, 7982-7989]), the herbicide-resistant Bar gene expression cassette was cut out by restriction endonucleases EcoRI and EcoRV, and the large fragment DNA (pPK2-GFP) produced by enzyme cutting was recovered.

[0065] 2) Using the genome of Metarhizium anisopliae (denoted as Mp) screened in Example 1 as a template, PCR amplification was performed using primers Gpd-F and Gpd-R to obtain the promoter of the 3-phosphoglyceraldehyde dehydrogenase gene Gpd, and PCR amplification was performed using primers Mmd-F and Mmd-R to obtain a DNA fragment containing the open reading frame and terminator region of the methylmercury demethylase gene Mmd. The primer sequences are as follows:

[0066] Gpd-F: 5'-ggagatctgatatcactagtattaaacatggcacact-3' (SEQ ID NO. 1);

[0067] Gpd-R: 5'-atggggctctgttgactcattttgcgtgtgtgtatatgga-3' (SEQ ID NO. 2);

[0068] Mmd-F: 5'-atgagtcaacagagccccat-3' (SEQ ID NO.3);

[0069] Mmd-R: 5'-gggaattcattcagaacggagaagt-3' (SEQ ID NO.4);

[0070] The system and procedure for amplifying Gpd and Mmd fragments are the same, as follows:

[0071] The total reaction system was 50 μL, including 4 μL of template genome (concentration was 100 ng / μL), 2×Phanta Max Buffer 25 μL, dNTP Mix (10 mM each) 1 μL, 2 μL of upstream and downstream primers (10 μM) each, and PhantaMax Super-Fidelity DNA Polymerase 1 μL. 2 Add HO to make up to 50 μL.

[0072] The reaction procedure was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 56°C for 15 s, extension at 72°C for 1 min 30 s, 32 cycles; and extension at 72°C for another 5 min.

[0073] 3) Using the two PCR reaction products obtained in step 2) (the two DNA fragments have a 20 bp overlapping region) as templates, Gpd-F and Mmd-R were used as primers to amplify a long DNA fragment (Gpd-Mmd) containing the Gpd promoter, the Mmd gene open reading frame and the terminator. The amplification system and procedure are as follows:

[0074] The total reaction system was 50 μL, and the template DNA in the system was 4 μL of Gpd and Mmd fragments obtained in step 2) (concentration of each was 100 ng / μL), 2×PhantaMax Buffer 25 μL, dNTPMix (10 mM each) 1 μL, upstream and downstream primers (10 μM) 2 μL each, PhantaMax Super-Fidelity DNA Polymerase 1 μL, and ddH 2 Add 0.1% HO to make up to 50 μL.

[0075] The reaction procedure was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 56°C for 15 s, extension at 72°C for 2 min 40 s, 32 cycles; and extension at 72°C for another 5 min.

[0076] 4) The DNA fragment Gpd-Mmd obtained in step 3) was digested with EcoRⅤ and EcoR I, and ligated with the fragment pPK2-GFP obtained in step 1) by digestion with EcoRⅤ and EcoR I to obtain the recombinant plasmid pPK2-Mmd-GFP ( Figure 4 ), wherein the screening marker gene is the methylmercury demethylase gene Mmd (SEQ ID NO.5) of Metarhizium anisopliae, and its expression is driven by the promoter of the 3-phosphoglyceraldehyde dehydrogenase gene Gpd (SEQ ID NO.6) of Metarhizium anisopliae. The specific sequence is as follows:

[0077] The nucleotide sequence of the Mmd gene is shown in SEQ ID NO.5, and is as follows:

[0078]

[0079] The nucleotide sequence of the gpd gene promoter is shown in SEQ ID NO.6, and is as follows:

[0080]

[0081] Example 4 Construction of an engineered strain of Metarhizium anisopliae Mmd-Tps that produces volatile longifolene and can kill red imported fire ants

[0082] The TPS coding sequence obtained by digestion with restriction endonucleases BamH I and EcoRV in the Chinese patent with publication number CN116904329A was ligated with the vector pPK2-bar-Ptef (Zhang X, Meng Y, Huang Y, Zhang D, Fang WA novel cascade allows Metarhizium robertsii to distinguish cuticle and hemocoel microenvironments during infection of insects. PLoS Biol. 2021Aug4; 19(8): e3001360.) digested with the same enzymes to obtain the Tps expression vector pPK2-bar-Tps-Ptef. Then, pPK2-bar-Tps-Ptef was used as a template and Tef-EcoRI-F (SEQ ID NO.7) and Trpc-XbalI-R (SEQ ID NO. NO.8) as primers, PCR amplification was performed to obtain the PTef-Tps-TTrpc fragment (containing the constitutive promoter pTef, the pine longifolene synthase development reading frame and the terminator Ter). The primer sequences are as follows:

[0083] Tef-EcoRI-F: 5'-ccgaattctagcaacagtcagctagacg-3' (SEQ ID NO. 7);

[0084] Trpc-XbaI-R: 5'-gctctagagcattgcagatgagctgtat-3' (SEQ ID NO. 8).

[0085] The PTef-Tps-TTrpc fragment was digested with restriction endonucleases EcoR I and Xba I, and then ligated with the vector pPK2-Mmd-GFP (constructed in Example 3) double-digested with the same enzymes to obtain the expression vector pPK2-Tps-Mmd-GFP ( Figure 5 ).

[0086] The pPK2-Tps-Mmd-GFP plasmid was transferred into the AGL1 strain of Agrobacterium tumefaciens, and then the genetic transformation of Metarhizium robertsii mediated by Agrobacterium tumefaciens was performed to obtain the engineered strain Mmd-Tps. The transformation method was carried out according to the literature (Xu C, Zhang X, Qian Y, Chen X, Liu R, Zeng G, Zhao H, Fang W. A high-throughput gene disruption methodology for the entomopathogenic fungus Metarhizium robertsii. PLoS One. 2014, 9(9): e107657.), including:

[0087] Take equal volumes of Agrobacterium tumefaciens bacterial suspension and Metarhizium anisopliae spore suspension, vortex gently to mix, and evenly spread on an induction solid medium (see literature records) containing 200 μmol acetosyringone (AS) covered with black sterile filter paper (Macherey-Nagel, Germany), and culture it upright in a 26°C incubator for about 2 days until white fluffy hyphae grow on the black filter paper. Transfer the black filter paper to M-100 solid medium containing 400 μg / mL cefotaxime and 10 μg / mL methylmercury, and cover it with the same medium. After 3 to 5 days, pick out a single colony that may be a transformant and place it on M-100 solid medium containing 10 μg / mL methylmercury, and perform secondary screening in combination with green fluorescent protein (GFP). Transformants with green fluorescence were screened by observation, and a small amount of hyphae was selected as a template for fungal PCR verification to verify that the Tps gene was inserted into the genome of Metarhizium anisopliae to successfully construct the engineered strain Mmd-Tps. The primers used were Tps-F (SEQ ID NO.9) and Tps-R (SEQ ID NO.10). The PCR verification results are as follows: Figure 6 The primer sequences are as follows:

[0088] Tps-F: 5'-atggcccagatctccatc-3' (SEQ ID NO.9);

[0089] Tps-R: 5'-ttagatggggacctggtcg-3' (SEQ ID NO. 10).

[0090] Example 5 Toxicity of the engineered strain Mmd-Tps to red imported fire ants, and analysis of the amount of longifolene volatiles from the infected dead insects and their attractiveness to worker ants

[0091] 1. Methods

[0092] Toxicity determination method: The toxicity determination of Mmd-Tps to red imported fire ant workers was consistent with the Pseudomonas anisopliae strain screened in Example 1.

[0093] Method for detecting the volatile amount of longifolene: When the worker ants of the red fire ants inoculated with the flat sand green anisopliae die, the insect corpses are disinfected with sodium hypochlorite solution (0.4%) and moisturized for 7 days to form dead insects covered with mycelium. 0.5g of dead insects are placed in a sample injection bottle and inserted into an extraction head (50 / 30μm DVB / CAR / PDMS) for adsorption for 40min, during which the sample injection bottle is placed in a 40℃ water bath. Then, the volatile substances adsorbed on the extraction head are analyzed by SPME-GC-MS. Manual injection is used at the injection port, the injection port temperature is 250℃, the analysis is 3min, and the DB-5MS (30m×0.25mm, 0.25μm) chromatographic column is used for analysis. The GC-MS program is as follows: the starting temperature is 40℃, maintained for 2min; the temperature is increased to 180℃ at 5℃ / min, and then the temperature is increased to 270℃ at 10℃ / min, and maintained for 10min. Based on the total ion current (TIC) graph, the mass spectrometry data of the chromatographic peak was compared with the mass spectrometry library NIST05 to preliminarily predict the compounds in the chromatographic peak. According to the CAS number of the compound provided by the mass spectrometry library, a chemically synthesized standard product was purchased and compared with the C 7 -C 40 The normal alkane mixed standard was subjected to GC-MS analysis, and the linear retention index (LRI) was calculated according to the linear retention index (LRI) calculation formula (Formula I):

[0094] RI x =100×z+100×(RT x -RT z ) / (RT z+1 -RT z ) Formula I;

[0095] Among them, RI x is the linear retention index of target component x, z is the number of carbon atoms contained in the normal alkane before the target component x is eluted, RT x is the retention time of target component x, RT z is the retention time of the z-th carbon n-alkane, RT z+1 is the retention time of the z+1th carbon n-alkane.

[0096] The compound was confirmed to be the same substance as the standard according to the retention index. Finally, the volatile amount of longifolene in the worms infected by the wild-type strain (Mp) and Mmd-Tps was calculated according to the confirmed longifolene peak area.

[0097] Method for determining the attraction to worker ants: The worker ants were placed in a -80°C low-temperature refrigerator and frozen to death for later use. The dead insects formed by infection with the wild strain Mp and the engineered strain Mmd-Tps were used for two-way selection method detection. 0.1g of the frozen dead insect corpses and dead insects were placed on both sides of a culture dish with a diameter of 15cm, and then 20 healthy and active red fire ant workers were placed in the middle of the culture dish. After 10 minutes, the choices of the healthy worker ants were recorded, and the response index (Response index) = (the number of worker ants who chose dead insects - the number of worker ants who chose frozen dead insect corpses) / the total number of worker ants was calculated. In order to examine the preference of healthy worker ants for dead insects formed by infection with the wild strain and the engineered strain Mmd-Tps, the two dead insects (0.1g each) were placed on both sides of the culture dish and tested by two-way selection method, and the preference percentage was calculated.

[0098] 2. Results

[0099] LT of the engineered strain Mmd-Tps 50 There was no significant difference with the wild type of Metarhizium anisopliae (P>0.05) ( Figure 7 A in the figure). Worker ants infected by Mp and Mmd-Tps showed the same typical fungal lethal symptoms, that is, dense hyphae grew on the body of the insect after 3 days of moisturizing culture, and then began to produce spores ( Figure 7 B) in the figure indicates that the expression of the Tps gene does not affect the virulence of Metarhizium anisopliae to red imported fire ants.

[0100] Both the engineered strain Mmd-Tps and the wild-type strain can volatilize longifolene, but the amount of longifolene volatilized by the Mmd-Tps strain is 59 times that of the Mp strain, reaching 509 ng / g strain ( Figure 7 C).

[0101] Mmd-Tps dead insects have a significant attractant effect on red fire ant workers, with a response index of 0.61 ( Figure 7 D in Figure 1). The preference experiment showed that healthy worker ants preferred Mmd-Tps to Mp (63% vs. 37%) ( Figure 7 E).

[0102] Example 6 Effect of the engineered strain Mmd-Tps on the hygienic behavior of red imported fire ants

[0103] 1. Methods

[0104] In order to analyze the behavior of worker ants abandoning the dead bodies of Mp and Mmd-Tps infected red fire ant workers, and the probability of being inoculated with spores from dead bodies during this process, artificial ant colonies were first established in insect boxes (30×30×15 cm), each of which consisted of 500 worker ants, 20 larvae, and 1 reproductive ant. Then, 50 dead bodies were placed in the box of each artificial ant colony, and the time when the worker ants began to abandon the dead bodies was recorded. The dead bodies were 107 The insects were infected with Mp and Mmd-Tps suspensions with a concentration of spores / mL and then cultured in moist soil for 7 days to obtain dead insects. After 24 hours, 50 worker ants were randomly selected, ground and smeared on the green ant screening medium. After culturing at 26°C for 5 days, the colony counts (CFUs) were calculated, and the number of spores adhered to the body surface of each worker ant was expressed according to the number of strains. The experiment was repeated 5 times.

[0105] 2. Results

[0106] Healthy worker ants began to discard Mp zombies in less than 5 minutes (average 282 seconds), while the start time of discarding Mmd-Tps zombies was delayed 8.6 times (average 2429 seconds) (p < 0.001) ( Figure 8 A in the figure). After 24 hours, only 4% of the worker ants carrying Mp zombies were inoculated with spores, while the proportion of worker ants carrying Mmd-Tps zombies that were inoculated increased by 7.5 times (30%). This is because the latter has a stronger attraction to the worker ants, which prolongs the contact time between the worker ants and the zombies ( Figure 8 B).

[0107] Example 7 Preparation of Metarhizium anisopliae Wettable Powder

[0108] The surface of Metarhizium anisopliae spores is hydrophobic and difficult to be directly suspended in water. For ease of use, the present invention provides a wettable powder of Metarhizium anisopliae, which is composed of the following components in percentage by mass: 35% Metarhizium anisopliae spore powder, 57% talcum powder, 3% sodium dodecyl sulfate (SDS) and 5% sodium methylenebisnaphthalene sulfonate (dispersant NNO).

[0109] When used, dissolve the wettable powder in water to a final concentration of 1×10 7 spores / mL of bacterial suspension and inject it into the ant nest to infect red fire ants.

[0110] Example 8: Combination of engineered strain Mmd-Tps and hydrazone bait to control red imported fire ants

[0111] 1. Methods

[0112] The experiment for preventing and controlling red fire ant nests (single queen type and multiple queen type) was set up with the following 6 treatments.

[0113] (1) Fill 1×10 7 spores / mL of the wild-type strain Mp spore suspension, 2 L per nest, recorded as Mp;

[0114] (2) Fill 1×10 7 spores / mL of the engineered strain Mmd-Tps spore suspension (the bacterial suspension prepared in Example 7), 2 L per nest, recorded as Mmd-Tps;

[0115] (3) 0.73% hydrazone bait (20 g per nest, evenly sprinkled on the nest, the same below), recorded as baiting;

[0116] (4) 0.73% hydrazone bait was used for treatment. After 3 days, 1×10 7 spores / mL of Mp spore suspension, 2 L per nest, recorded as bait + Mp;

[0117] (5) 0.73% hydrazone bait was used for treatment. After 3 days, 1×10 7 spores / mL of Mmd-Tps spore suspension, 2 L per nest, recorded as bait + Mmd-Tps;

[0118] (6) Inject 0.01% TritonX-100, 2 L per nest. This treatment is the blank control and is recorded as the control.

[0119] The wild-type strain Mp spore suspension is similar to the bacterial suspension prepared in Example 7, except that the engineered strain Mmd-Tps is replaced by the wild-type strain Mp.

[0120] The test was conducted in an insect-proof net room, with 15 ant nests treated each time and repeated 3 times. To prevent nest migration caused by human interference, the spore suspension should be slowly poured into the anthill. The death of the ant nest was observed before and 3 days, 7 days, 14 days, 21 days and 28 days after the nest filling. The surface of the anthill was tapped for 1 minute. During this period, the nest with less than 3 worker ants leaving the nest was considered dead. At the same time, the migration and division of the treated ant nests were observed, and the ant nest control effect was calculated based on the death, migration and division of the ant nest. Ant nest control effect (%) = (1-number of live ant nests after treatment / number of live ant nests before treatment) × 100.

[0121] 2. Results

[0122] The test results show that ( Fig. 9A to C), the control effects of using only hydrazone bait and using only wild-type strain Mp were similar. After 28 days of both treatments, the control effect on single-queen ant nests was about 40%, of which 20% to 30% of the ant nests had split nests and migrated. The control effect on multi-queen ant nests was less than 30%. After treatment with hydrazone bait, the control effect was 28.9%, and 20% of the ant nests had migrated. After treatment with wild-type strain Mp, the control effect was only 11.1%. The control effect of using only Mmd-Tps was significantly higher than that of using only Mp. After 2 weeks of treatment, the control effect of using Mp alone on single-queen ant nests was 12.3%, while the control effect of Mmd-Tps was 41.8%. After 28 days, the control effect of Mmd-Tps reached 71%. The control effect of Mmd-Tps on multi-queen ant nests was also high, reaching 31% after 28 days. After treatment, both strains showed nest migration or nest splitting behaviors, but there was no significant difference between the two. The combined use of hydrazone bait and green anisopliae significantly improved the control effect. When Mp was used in combination with the bait, the control effect on single-queen ant nests was 51% (54% for multiple queens) after one week of treatment; the control effect on single-queen ant nests was 73% (71% for multiple queens) after 28 days of treatment. The engineered strain Mmd-Tps combined with the bait had a higher control effect, and nest migration or nest splitting was rarely seen; the control effect on single-queen ant nests reached 58% after 3 days of treatment, and the control effect on multiple queen ant nests was as high as 79%. After 7 days, the control effect on multiple queen nests was 93% (90% for single queen nests), and after 28 days, the control effect on both social ant nests was 98%, and 4 out of 6 tests achieved 100% control effect.

[0123] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A strain of Metarhizium pingshaense, characterized in that: The deposit number is CGMCCNO.41511.

2. Use of the Metarhizium anisopliae described in claim 1 in preventing and controlling red imported fire ants or in constructing engineered bacteria for preventing and controlling red imported fire ants.

3. An engineered bacterium for controlling red imported fire ants, characterized in that: The engineered bacteria comprises a starting strain and a pine longifolene synthesis gene Tps introduced into the starting strain; the starting strain comprises the Metarhizium anisopliae described in claim 1; the amino acid sequence of the protein encoded by the pine longifolene synthesis gene Tps is shown in SEQ ID NO.

11.

4. The engineered bacteria according to claim 3, characterized in that The engineered bacteria also include a selection marker gene introduced into the starting strain; the selection marker gene is the methylmercury demethylase gene Mmd of the starting strain itself, and the nucleotide sequence of the methylmercury demethylase gene Mmd is shown in SEQ ID NO.

5.

5. The engineered bacteria according to claim 4, characterized in that The methylmercury demethylase gene Mmd is driven by the promoter of the 3-phosphoglyceraldehyde dehydrogenase gene Gpd of the starting strain itself, and the nucleotide sequence of the promoter is shown in SEQ ID NO.

6.

6. A fungicide for preventing and controlling red imported fire ants, characterized in that: include: Spore powder, a solid phase carrier, an emulsifier and a dispersant; the spore powder is the spore powder of Metarhizium anisopliae described in claim 1 and / or the spore powder of the engineered bacteria described in any one of claims 2 to 5.

7. The bacterial agent according to claim 6, characterized in that The solid phase carrier includes talc; the emulsifier includes sodium dodecyl sulfate; and the dispersant includes sodium methylene bisnaphthalene sulfonate.

8. Use of the engineered bacteria according to any one of claims 2 to 5 or the bacterial agent according to claim 6 or 7 in controlling red imported fire ants.

9. A method for preventing and controlling red fire ants, characterized in that: include: A bait for luring and killing red fire ants is applied to the surface of a red fire ant nest. After the bait is carried away by the ant colony, a spore suspension is added to the red fire ant nest; the spores in the spore suspension include: one or more of the spores of the green muscardine described in claim 1, the spores of the engineered bacteria described in any one of claims 2 to 5, and the spore powder in the bacterial agent described in claim 6 or 7.

10. The method according to claim 9, characterized in that The bait for luring and killing red fire ants includes hydrazone.

Images