A lipase mutant and its application in the purification of natural vitamin E

Abstract

The present invention relates to the field of genetic engineering and protein modification technology, and specifically to a lipase mutant. The present invention is based on the wild-type lipase TLS and provides lipase mutants comprising a single point mutation of T136W, two points of G113V / T136W, and three points of G113V / T136W / I277P. Compared with the wild type, the lipase mutant has significantly enhanced tolerance to acidic conditions. After treatment at pH 3.0 for 15 minutes, the residual enzyme activity rate of the mutant can still reach 30.20%-44.33%, which is much higher than that of the wild type. The lipase mutant can significantly promote the methyl esterification of free fatty acids, with a conversion rate of up to 72.40%-89.23%; among them, the lipase mutant comprising the three-point mutation of G113V / T136W / I277P has the highest methyl ester conversion rate, reaching 89.23%, achieving unexpected technical effects. The lipase mutant can be widely used in the purification of natural vitamin E.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and protein engineering technology, specifically relating to a lipase mutant and its application in the purification of natural vitamin E. Background Technology

[0002] Deodorized distillate is an important raw material for extracting natural vitamin E. As a byproduct of oil refining, its main components are free fatty acids, glycerides, natural vitamin E, sterols, sterol esters, and other oxidative decomposition products. However, due to the similar physicochemical properties of the components and the easy oxidation of natural vitamin E, it is often difficult to directly extract high levels of natural vitamin E from deodorized distillate. Pretreatment of the raw material is necessary to improve the selectivity of the separation process.

[0003] Domestic natural vitamin E manufacturers mainly use the esterification-cold precipitation-molecular distillation process. Generally, the free fatty acids and glycerides in the deodorized distillate are first subjected to a methyl esterification reaction with methanol to convert them into fatty acid methyl esters with lower boiling points. At the same time, the viscosity of the entire system is reduced, which is conducive to the separation of phytosterols in the later stage, thereby achieving the purpose of purifying natural vitamin E.

[0004] Traditional chemical pretreatment processes for deodorized distillates typically use concentrated sulfuric acid as a catalyst. These processes have short reaction times and high esterification efficiency, but require high reaction temperatures and highly corrosion-resistant production equipment. In addition, the production process generates a large amount of waste acid water, which pollutes the environment.

[0005] To overcome the shortcomings of chemical methods, enzymatic methyl esterification has become a research hotspot in recent years. Lipases can catalyze various reaction types, including esterification, transesterification, and hydrolysis. Enzymatic reactions offer mild conditions, high efficiency and specificity, and are characterized by low energy consumption, high yield, and easy product separation and purification, aligning with the principles of green environmental protection and sustainable development. However, the presence of fatty acids in the deodorized distillate results in a low initial pH, significantly inhibiting enzyme activity and greatly reducing catalytic efficiency. Adjusting the pH with alkaline solutions can easily damage the active structure of vitamin E. While lipase immobilization improves the enzyme's tolerance to acidic environments, it increases costs. Therefore, there is an urgent need to develop an acid-resistant lipase strain with high catalytic activity to improve production efficiency and reduce production costs. Summary of the Invention

[0006] This invention addresses the problems of existing technologies by providing a lipase mutant and its application in the purification of natural vitamin E. Based on the lipase TLS, this invention, through extensive mutation screening, ultimately obtains a lipase mutant with significantly improved acid resistance. This mutant exhibits excellent catalytic activity, which can improve production efficiency, reduce the use of chemical reagents, and lower production costs during application.

[0007] In one aspect, this invention provides a lipase mutant in which the 136th amino acid of the lipase with the amino acid sequence SEQ ID NO:1 is changed from Thr to Trp.

[0008] The amino acid sequence of the above-mentioned lipase mutant is SEQ ID NO:3, and the nucleic acid sequence of one of its encoding genes is SEQ ID NO:4.

[0009] One aspect of this invention provides a lipase mutant in which the 113th amino acid of the lipase with the amino acid sequence SEQ ID NO:3 is changed from Gly to Val.

[0010] The amino acid sequence of the above-mentioned lipase mutant is SEQ ID NO:5, and the nucleic acid sequence of one of its encoding genes is SEQ ID NO:6.

[0011] One aspect of this invention provides a lipase mutant in which the 277th amino acid of the lipase with the amino acid sequence SEQ ID NO:5 is changed from Ile to Pro.

[0012] The present invention also relates to DNA molecules encoding the above-mentioned lipase mutants.

[0013] The present invention also includes a recombinant expression vector carrying the above-mentioned DNA molecules.

[0014] The present invention also provides a host cell comprising the above-described recombinant expression vector.

[0015] The host cell was Pichia pastoris.

[0016] This invention provides lipase mutants based on the wild-type lipase TLS, containing single-point (T136W), two-point (G113V / T136W), and three-point (G113V / T136W / I277P) mutations, respectively. Compared with the wild type, the lipase mutants exhibit significantly enhanced tolerance to acidic conditions. After treatment at pH 3.0 for 15 minutes, the residual enzyme activity of the mutants still reaches 30.20%-44.33%, far exceeding that of the wild type; among them, the lipase mutant containing the three-point (G113V / T136W / I277P) mutation has the highest residual enzyme activity, reaching 44.33%. The lipase mutants significantly promote the methyl esterification of free fatty acids, with a conversion rate as high as 72.40%-89.23%; among them, the lipase mutant containing the three-point (G113V / T136W / I277P) mutation has the highest methyl ester conversion rate, reaching 89.23%, achieving unexpected technical results. The lipase mutant can be widely used for the purification of natural vitamin E. Detailed Implementation

[0017] The present invention will be further described below with reference to specific implementation examples, which will enable those skilled in the art to better understand and master the invention. Experimental conditions and methods not specifically described in this embodiment can be referred to in *Molecular Cloning: A Laboratory Guide* (Sambrook et al., Cold Spring Harbor Laboratory Press, 1989) or according to the manufacturer's recommendations. For reagent usage and dosage, unless otherwise specified, they should be used according to conventional methods and dosages. Non-inventive modifications made by those skilled in the art based on the principles of this invention are considered to be within the scope of protection of this invention.

[0018] Experimental materials and reagents:

[0019] Experimental strains and vectors: Escherichia coli DH5α, Pichia pastoris GS115, and vector pPIC9k were purchased from Invitrogen.

[0020] Main reagents: PCR enzymes and ligases were purchased from Takara, restriction endonucleases were purchased from Fermentas, plasmid extraction kits and gel purification and recovery kits were purchased from Omega, and GeneMorph II random mutation kits were purchased from Beijing Bomais Biotechnology Co., Ltd.

[0021] Culture medium formulation:

[0022] Escherichia coli culture medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0;

[0023] LB+Amp medium: LB medium with 100 μg / mL ampicillin;

[0024] LB+Kanamycin medium: LB medium supplemented with 50 μg / mL kanamycin;

[0025] Yeast medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose;

[0026] Yeast selection medium (MD medium): 2% glucose, 1.34% YNB, 4×10⁻⁶ -5 % Biotin, 2% Agar Powder;

[0027] BMGY medium: 2% peptone, 1% yeast extract, 100mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % Biotin, 1% Glycerin;

[0028] BMMY medium: 2% peptone, 1% yeast extract, 100mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % Biotin, 0.5% Methanol;

[0029] The present invention will now be described in detail with reference to the embodiments.

[0030] Example 1: Synthesis of lipase gene and acquisition of recombinant plasmid

[0031] Using the lipase (named TLS) gene sequence shown in SEQ ID NO: 2 as a reference, the gene was artificially synthesized at Shanghai Jierui Biotechnology Co., Ltd., and its encoded amino acid sequence is SEQ ID NO: 1.

[0032] The primer sequences are as follows:

[0033] 5' primer TLS-F: GGC GAATTC GGCCAGTCCTATTCGTCGAG (The underlined part is the EcoRI restriction enzyme recognition site)

[0034] 3' primer TLS-R: ATA GCGGCCGC TACCCATTTCCACGCAGGTC (The underlined part is the NotI restriction enzyme recognition site).

[0035] Using the synthesized lipase TLS gene as a template, PCR amplification was performed using the primers described above. The PCR amplification system consisted of: 1 μL template, 1 μL upstream primer, 1 μL downstream primer, 10 μL 5×PS Buffer, 4 μL dNTPs (2.5 mM), 1 μL Primer-Star DNA polymerase, and 32 μL ddH2O, for a total reaction volume of 50 μL. The PCR cycling program was: 95℃ pre-denaturation for 5 min, 30 cycles: 94℃ for 30 sec, 55℃ for 30 sec, 72℃ for 2 min, and 72℃ for 10 min. The PCR product was recovered from the gel, digested with EcoRI and NotI, and ligated into the pPIC-9k vector digested with the same enzymes overnight at 16℃. This ligation was then used to transform *E. coli* DH5α, plated on LB+Amp plates, and incubated upside down at 37℃. After the transformants appeared, colony PCR was used to verify positive clones, and sequencing confirmed the correct recombinant plasmid pPIC9K-TLS.

[0036] Example 2: Screening of lipase mutants

[0037] To improve the enzyme activity of the aforementioned lipase under acidic conditions without damaging the protein's secondary structure and active site, a large number of mutation sites were screened for in this gene. Using lipase TLS as a template, PCR amplification was performed using the aforementioned primers with the GeneMorph II random mutation PCR kit (Stratagene). The PCR product was recovered from the gel, digested with enzymes, and ligated into the pET-28a vector that had been digested with the same enzymes. The transformed cells were then transformed into E. coli BL21(DE3), plated on LB+Kana plates, and incubated upside down at 37°C. After the transformants appeared, they were picked one by one into a 96-well plate with a toothpick. 150 μL of LB+Kana medium containing 0.1 mM IPTG was added to each well, and the cells were incubated at 37°C and 220 rpm for about 6 hours. After centrifugation and discarding the supernatant, the cells were resuspended in buffer and repeatedly freeze-thawed to obtain E. coli cell lysate containing lipase.

[0038] 40 μL of lysis buffer was transferred to two new 96-well plates, and the lipase activity was measured after reacting at pH 3.0 and pH 5.0 for 15 min, respectively. The results showed that some mutants did not exhibit any change in enzyme activity under acidic conditions; some mutations even worsened their acid tolerance or enzyme activity; and some mutations, while improving the pH tolerance of lipase TLS, significantly altered the enzyme's active properties, which did not meet the requirements. Finally, the mutation sites that significantly improved the acid tolerance of lipase TLS without affecting its enzyme activity and original enzymatic properties were obtained: G113V, T136W, and I277P.

[0039] The lipase mutant containing the T136W single-point mutation was named TLS-M1, and its amino acid sequence is SEQ ID NO:3. Based on this sequence, a coding nucleotide sequence was synthesized as SEQ ID NO:4.

[0040] The lipase mutant containing the two-point mutation G113V / T136W was named TLS-M2, and its amino acid sequence is SEQ ID NO:5. Based on this sequence, a coding nucleotide sequence was synthesized as SEQ ID NO:6.

[0041] The lipase mutant containing the G113V / T136W / I277P three-point mutation was named TLS-M3, and its amino acid sequence is SEQ ID NO:7. Based on this sequence, a coding nucleotide sequence was synthesized as SEQ ID NO:8.

[0042] Example 3 Construction of Pichia pastoris engineered strains

[0043] 3.1 Construction of Recombinant Plasmids

[0044] Using the genes of the aforementioned lipase TLS and its mutants as templates, the PCR products were amplified, recovered by gel electrophoresis, digested with EcoRI and NotI, and then ligated into the pPIC-9k vector digested with the same enzymes. The ligation was performed overnight at 16°C and transformed into E. coli DH5α. The transformed plasmids were plated on LB+Amp plates and incubated upside down at 37°C. After the transformants appeared, the positive clones were verified by colony PCR. The correct recombinant plasmids were finally obtained after sequencing verification.

[0045] 3.2 Preparation of competent yeast cells

[0046] Pichia pastoris strain GS115 was activated on YPD plates and cultured at 30°C for 48 hours. Then, a single activated GS115 colony was inoculated into 5 mL of YPD liquid medium and cultured at 30°C and 220 rpm for approximately 18 hours. The culture was then transferred to 50 mL of YPD liquid medium. In Erlenmeyer flasks containing YPD liquid culture medium, the cells were incubated at 30°C and 220 rpm for approximately 5 hours. The cell density was then measured using a UV spectrophotometer. Once the OD600 value was within the range of 1.1–1.3, the cells were centrifuged at 4°C and 6000 rpm for 3 minutes. 5 ml of the cells were collected and transferred to sterile EP tubes. The supernatant was gently discarded, and any remaining supernatant was blotted dry with sterile filter paper. The cells were then resuspended in 2 mL of pre-cooled sterile water. After centrifugation at 4°C and 6000 rpm for 3 minutes, the supernatant was gently discarded, and the cells were resuspended in 2 mL of pre-cooled sorbitol (1 mol / L). After centrifugation at 4°C and 6000 rpm for 3 minutes, the supernatant was gently discarded, and the cells were gently resuspended in 100–150 μl of pre-cooled sorbitol (1 mol / L).

[0047] 3.3 Conversion and Screening

[0048] The recombinant plasmids of the constructed lipase TLS and its mutants were linearized with Sac I. After purification and recovery, the linearized fragments were transformed into Pichia pastoris GS115 via electroporation. Recombinant Pichia pastoris strains were screened on MD plates. A single transformant was transferred to BMGY medium and cultured at 30°C with shaking at 250 rpm for 1 day. Then, it was transferred to BMMY medium and cultured at 30°C with shaking at 250 rpm, with 0.5% methanol added daily. After 3 days of induction, the bacterial cells were removed by centrifugation, and the supernatant was used to determine the lipase activity.

[0049] The results showed that the enzyme activity of lipase in the fermentation supernatant of the recombinant Pichia pastoris strains expressing lipase TLS and its mutants constructed in this invention was 176-225 U / ml.

[0050] Lipase activity assay

[0051] (1) Definition of enzyme activity unit

[0052] According to GB / T23535-2009, the amount of enzyme required to generate 1 μmol of fatty acid per minute under the conditions of 40℃ and pH 7.5 is defined as one enzyme activity unit, denoted by U.

[0053] (2) Measurement method

[0054] Olive oil and 4% (w / v) polyvinyl alcohol (PVA) were mixed at a ratio of 1:3 (v / v) and homogenized twice using a high-speed homogenizer, with an interval of 5 min and each treatment lasting 3 min, to obtain a milky white PVA emulsion. The emulsified olive oil was used as the substrate for lipase hydrolysis. Two 100 mL beakers were prepared. 4 mL of olive oil emulsion and 5 mL of citrate-phosphate buffer were added to each beaker (B), one blank beaker (A) and one sample beaker (B). 15 mL of 95% ethanol was added to beaker A. The mixture was preheated in a 40°C water bath for 5 min. Then, 1 mL of the enzyme solution to be tested was added to each beaker (A) and B. The mixture was immediately mixed and the reaction time was set. After 15 min of reaction time, 15 mL of 95% ethanol was immediately added to beaker B to terminate the reaction. The beakers were then removed. The beakers were placed on a magnetic stirrer and titrated with 0.05 mol / L sodium hydroxide standard solution while stirring until a faint red color appeared and remained unchanged for 30 s. The volume of sodium hydroxide standard solution consumed was recorded.

[0055] Enzyme activity calculation formula:

[0056]

[0057] In the formula: X D V1 represents the enzyme activity of the sample (U / mL); V2 represents the volume of sodium hydroxide standard solution consumed during sample titration (mL); V3 represents the volume of sodium hydroxide standard solution consumed during blank titration (mL); c represents the concentration of sodium hydroxide standard solution (mol / L); 50 represents the equivalent of 50 μmol of fatty acid in 1 mL of 0.05 mol / L sodium hydroxide solution; n1 represents the dilution factor of the sample; 0.05 represents the conversion factor for sodium hydroxide standard solution concentration; and 1 / 15 represents the reaction time (15 min).

[0058] Example 4: Acidity Analysis of Lipase Mutants

[0059] The supernatant of Pichia pastoris fermentation of the recombinant lipase and its mutant obtained above was added to citrate-phosphate buffer at pH 3.0. After 15 min, the residual viability of the lipase was detected. The relative enzyme activity was calculated with the initial enzyme activity as 100% relative enzyme activity (see Table 1).

[0060] Table 1. Acid resistance analysis of lipase mutants

[0061] lipase mutation site Residual enzyme activity after treatment at pH 3.0 for 15 min Wild TLS - 3.20％ mutant TLS-M1 T136W 30.20％ mutant TLS-M2 G113V / T136W 38.80％ mutant TLS-M3 G113V / T136W / I277P 44.33％

[0062] As shown in Table 1, the lipase mutants provided by this invention exhibit significantly enhanced tolerance to acidic conditions compared to the wild-type lipase TLS. After treatment at pH 3.0 for 15 minutes, the residual enzyme activity of the mutants still reached 30.20%-44.33%, far exceeding that of the wild type. Among them, the lipase mutant containing the G113V / T136W / I277P three-point mutation had the highest residual enzyme activity, reaching 44.33%, achieving an unexpected technical effect.

[0063] Example 5: Application of lipase mutants in the purification of natural vitamin E

[0064] Deodorizer distillates of vegetable oils are mixtures of fractions obtained during the deodorization process, primarily containing large amounts of free fatty acids, vitamin E, glycerides, and other components. Based on the ease of separating vitamin E from fatty acid monoesters, the free fatty acids and neutral oils in the deodorizer distillate are typically first converted into fatty acid monoesters, followed by further separation of vitamin E from these monoesters. Lipases can be used for the methyl esterification of free fatty acids in vegetable oil deodorizer distillates, thus facilitating the purification of vitamin E.

[0065] 1. Enzyme solution:

[0066] Fermentation supernatant of Pichia pastoris engineered strains that constructed recombinant expression of lipase TLS and its mutants in Example 3.

[0067] 2. Esterification process

[0068] Take 20 μL of enzyme solution, add 80 μL of water, 300 μL of deodorized soybean oil distillate, and 40 μL of methanol (add 5 μL every half hour, for a total of 8 times), place in a shaker, react at 40℃ and 1000 rpm for 12 h. After centrifugation at 12000 rpm for 3 min, determine the acid value of the upper oil phase according to the medium-heat ethanol method of national standard GB5009.229-2016, and calculate the methyl ester conversion rate according to the following formula:

[0069]

[0070] In the formula: C is the methyl ester conversion rate, %; X0 is the initial acid value of the soybean deodorized distillate, mgKOH / g; X1 is the acid value of the upper oil phase after the reaction, mgKOH / g.

[0071] Table 2. Effect of lipase mutants on the conversion rate of free fatty acid methyl esters

[0072] lipase mutation site Methyl ester conversion rate Wild TLS - 13.22％ mutant TLS-M1 T136W 72.40％ mutant TLS-M2 G113V / T136W 80.58％ mutant TLS-M3 G113V / T136W / I277P 89.23％

[0073] As shown in Table 2, compared with the wild-type lipase TLS, the lipase mutant provided by this invention can significantly promote the methyl esterification of free fatty acids, with a conversion rate as high as 72.40%-89.23%. Among them, the lipase mutant containing the G113V / T136W / I277P three-point mutation has the highest methyl ester conversion rate, reaching 89.23%, achieving unexpected technical results.

[0074] The lipase mutant provided by this invention has strong acid resistance and can be widely used for the methyl esterification of free fatty acids, thereby improving conversion efficiency and facilitating the purification of vitamin E.

[0075] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A lipase mutant, characterized in that, The amino acid sequence of the mutant is SEQ ID NO:

7.

2. The gene encoding the lipase mutant of claim 1.

3. The gene as described in claim 2, characterized in that, The nucleotide sequence of the gene is SEQ ID NO:

8.

4. A recombinant expression plasmid comprising the gene of claim 2 or 3.

5. A host cell, characterized in that, The host cell comprises the recombinant expression plasmid as described in claim 4; the host cell is a non-animal and non-plant variety.

6. The host cell as described in claim 5, characterized in that, The host cell is Pichia pastoris.

7. The application of the lipase mutant of claim 1 in the purification of natural vitamin E.

Images