Application of SNP (Single Nucleotide Polymorphism) molecular marker related to inclined length character of 6-month-old beef cattle

Abstract

The invention belongs to the technical field of beef cattle molecular marker-assisted selection, and particularly relates to application of an SNP molecular marker related to the inclined length character of a beef cattle 6-month-old body. The SNP molecular marker is located at a basic group of a 71085551 site of a No.3 chromosome in a beef cattle genome GCF002263795.1 AR-UCD1.2 genomic.fna, the SNP site of the molecular marker has G / A polymorphism, and A is an unfavorable allelic variation of the oblique length character of the beef cattle at the age of 6 months. By detecting the base type of the SNP site of the molecular marker, the molecular marker is used for detecting or assisting in detecting the oblique length character of the beef cattle at the age of 6 months, genetic breeding of the oblique length character of the beef cattle at the age of 6 months is improved, and the breeding process of beef cattle varieties is accelerated.

Description

Technical Field

[0001] The invention relates to the technical field of molecular marker-assisted selection of beef cattle, and in particular to the application of a SNP molecular marker associated with the oblique elongation trait of 6-month-old beef cattle. Background Art

[0002] As an important pillar of my country's animal husbandry, the beef cattle industry has an output value of nearly 200 billion yuan, and the number of cattle in stock accounts for 10% of the world's total. Although my country is a major beef cattle breeding country, there is still a large gap compared with other breeding powers in the world. One of the main reasons is that the selection and breeding of excellent beef cattle breeds is relatively backward and the germplasm resources are not fully explored.

[0003] The oblique length of a cattle, that is, the distance from the front edge of the shoulder blade to the ischium, is one of the important indicators for evaluating the body shape of beef cattle. It directly reflects the development of the beef cattle in terms of body length, and can also indirectly reflect the degree of muscle development of the beef cattle. A longer oblique length usually means that the beef cattle have a faster growth rate in the same period of time, which may mean that the beef cattle have more muscle mass and muscle volume, which is beneficial to the meat yield and meat quality of the beef cattle. By measuring the oblique length of 6-month-old beef cattle, its growth rate and growth potential can be evaluated, and it can also provide a basis for breeding decisions. Therefore, studying and evaluating the oblique length of 6-month-old beef cattle can provide important reference and guidance for beef cattle production, and help optimize the growth performance and meat quality of beef cattle.

[0004] Molecular marker-assisted breeding utilizes the characteristics of molecular markers being closely linked to target trait genes. By detecting molecular markers, the presence of target genes can be detected to achieve the purpose of selecting target traits. It has the advantages of being fast, accurate, and not affected by environmental conditions. Single nucleotide polymorphism (SNP) is a type of molecular marker, which refers to the change in DNA sequence caused by the variation of a single nucleotide at the same position in the genome between individuals, which can subsequently affect gene expression, transcriptional activity, and splicing modification. Beef cattle have a long growth cycle. Screening genes related to economic traits and genetic markers such as SNPs, combined with marker-assisted breeding methods, early selection of beef cattle can accelerate the breeding process of beef cattle. Summary of the invention

[0005] The object of the present invention is to provide a SNP molecular marker associated with the oblique elongation trait of beef cattle at 6 months of age, so as to provide guidance for the detection of growth and meat production performance of beef cattle or molecular marker-assisted breeding.

[0006] The technical solution of the present invention is as follows:

[0007] The invention provides a beef cattle SNP molecular marker, which is located at the base of the 71085551 position of chromosome 3 in the beef cattle genome GCF_002263795.1_ARS-UCD1.2_genomic.fna. The SNP site of the molecular marker has a G / A polymorphism and is named g.71085551G>A, wherein A is an unfavorable allele variation of the oblique length trait of the beef cattle at 6 months of age.

[0008] Application of the beef cattle SNP molecular marker and the material for detecting the beef cattle SNP molecular marker in any of the following aspects:

[0009] Used to detect or assist in detecting the oblique length trait of beef cattle at 6 months old;

[0010] Used to improve the genetic breeding of oblique body length traits in 6-month-old beef cattle;

[0011] Preferably, the nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.1.

[0012] In the present invention, the substance for detecting beef cattle SNP molecular markers includes PCR primers for amplifying genomic DNA fragments including the molecular marker SNP site, or a kit containing the primers.

[0013] Preferably, the nucleotide sequences of the primers are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0014] Preferably, the kit further comprises a PCR amplification reagent, and / or an enzyme cleavage reagent, wherein the enzyme cleavage reagent comprises the restriction endonuclease MnlI.

[0015] The present invention also provides a method for detecting the oblique body length trait of beef cattle at 6 months of age, comprising: detecting the base type at position 71085551 of chromosome 3 of the beef cattle genome, and the oblique body length trait of the GG genotype and AG genotype groups at 6 months of age is longer than that of the AA genotype group.

[0016] Preferably, the method for detecting the base type at position 71085551 of chromosome 3 of the beef cattle genome includes: designing a primer set for amplifying the nucleotide sequence shown in SEQ ID NO.1, using the primer set to perform PCR amplification on beef cattle genomic DNA, using restriction endonuclease MnlI to digest the obtained amplification product, performing agarose gel electrophoresis on the digestion product, and judging the base type at position 71085551 of chromosome 3 of the beef cattle genome according to the electrophoresis bands: the digestion product is AA type for band 1, GG type for band 2, and AG type for band 3.

[0017] Further preferably, the size of the enzyme digestion product with only one band is 461 bp, the sizes of the enzyme digestion product with two bands are 275 bp and 186 bp respectively, and the sizes of the enzyme digestion product with three bands are 461 bp, 275 bp and 186 bp respectively.

[0018] The present invention also provides a genetic breeding method for optimizing the oblique elongation trait of beef cattle at 6 months of age, comprising: determining the base type of the 71085551st position of chromosome 3 of the breeding cattle in the core group of beef cattle, and making corresponding selections according to the base type:

[0019] The successive breeding of breeding cattle selects individuals with GG and AT bases at position 71085551 of chromosome 3, and eliminates AA individuals to increase the frequency of gene G at this position generation by generation, thereby optimizing the oblique body length trait of offspring beef cattle at 6 months of age.

[0020] Preferably, the base at position 71085551 of bovine chromosome 3 is as shown in the 196th bp of the sequence shown in SEQ ID NO.1.

[0021] Beneficial effects of the present invention:

[0022] The present invention studies and determines the SNP molecular markers that affect the oblique length trait of beef cattle at 6 months of age, and uses the molecular markers for early molecular marker-assisted selection, which can accelerate the breeding process of beef cattle varieties.

[0023] The present invention predicts the body plagioclase trait of beef cattle at 6 months of age by detecting the base type of the molecular marker SNP site, and the body plagioclase trait of the GG genotype and AG genotype groups at 6 months of age is longer than that of the AA genotype group. A primer set for amplifying molecular markers affecting the body plagioclase trait of beef cattle at 6 months of age is used, and an efficient and accurate molecular marker-assisted breeding technology for beef cattle is established through the molecular markers and primer sets, which is applied to beef cattle breeding, and can screen calves with excellent body plagioclase traits at 6 months of age, and timely eliminate inferior calves, thereby reducing the breeding cycle and improving the breeding efficiency of cattle farms. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 These are the GWAS results for body length of 6-month-old beef cattle, where A is the Manhattan plot and B is the QQ plot.

[0025] Figure 2 These are the results of the effect analysis of SNP molecular markers and the oblique elongated phenotype of beef cattle at 6 months of age.

[0026] Figure 3 Agarose gel electrophoresis results of PCR amplification products.

[0027] Figure 4 The results of agarose gel electrophoresis of the digestion products. DETAILED DESCRIPTION

[0028] The invention performs whole genome resequencing on beef cattle genomic DNA, compares the resequencing data with a beef cattle reference genome (GCF_002263795.1_ARS-UCD1.2_genomic.fna), obtains all high-quality SNPs on the genome, and obtains a molecular marker associated with the oblique long body trait of beef cattle at 6 months of age by analyzing the correlation between each site and the oblique long body trait of beef cattle at 6 months of age. The SNP molecular marker is located at the base of the 71085551th site of chromosome 3 of the cattle genome GCF_002263795.1_ARS-UCD1.2_genomic.fna, and the SNP site of the molecular marker has a G / A polymorphism, wherein A is an unfavorable allele variation of the oblique long body trait of beef cattle at 6 months of age.

[0029] The nucleotide sequence of the SNP molecular marker of the present invention is shown in SEQ ID NO: 1:

[0030] ATTATCTAGCAATCTGGGCTTGCATTTTATTAACATTTATTCTGAATAAATTCGTCTCTCAAATGTGAATTTGTTGAGCACCAGCAAAGATTCAATTTTTTTTTTTTTTTGCTTGTCACATTGAGATGAAGCCTACTGTGATGAATTATTAGGACAATGAAAATTAAACAAGAGTGAAGGCTGTAATTTGAGAGNGAAATAAATCTGCAACTTGCAGAAAGAACAGTAGCT TGGAAGATTTATCTCTCTTTTAAAGTCACCTGTCATAATATGGTAACGCTAGGCATCAGAATTTGAAAGATGGCTTCAAAATCTCCTTATTGACAATATTTCTAAGTGGCCAACTTTTCATGTGCCACCGTGTGGGGGTGGGGGGAGCTTGCTGCCTGTCTTTTATCTTTGCCATGATTTGAAGGAGACGTTTATAATAATTAATAACTGAGAAGGTAGGTTGCTTTG (SEQ ID NO.1).

[0031] In the sequence SEQ ID NO.1, the base at position 196 has a G / A polymorphism, which is significantly correlated with the body oblique length of beef cattle at 6 months of age. The body oblique length of individuals with AA genotype at 6 months of age is extremely significantly lower than that of individuals with GG genotype (P<0.01), and the body oblique length of individuals with AA genotype at 6 months of age is significantly lower than that of individuals with AG genotype (P<0.05).

[0032] In the present invention, if the base at position 196 of the molecular marker nucleotide sequence mutates from G to A, it cannot be recognized and cut by the restriction endonuclease Mnl I. If no mutation occurs, it can be cut by Mnl I.

[0033] The present invention provides a substance for detecting the beef cattle SNP molecular marker, including PCR primers for amplifying genomic DNA fragments including the molecular marker SNP site, or a kit containing the primers. Among them, the primer set for amplifying the SNP molecular marker of the present invention includes an upstream primer F: 5'-ATTATCTAGCAATCTGGG-3' (SEQ ID NO.2) and a downstream primer R: 5'-CAAAGCAACCTACCTTCT-3' (SEQ ID NO.3). The kit also includes a PCR amplification reagent, and / or an enzyme cutting reagent, and the enzyme cutting reagent includes a restriction endonuclease Mnl I.

[0034] In the present invention, the PCR amplification reagent is preferably 2×Taq Fast Master Mix, which is a mixture of Taq DNA polymerase, dNTP mixture, MgC12 and reaction buffer pre-prepared into a 2-fold concentration and obtained after optimizing the ratio, and has good amplification efficiency and high detection sensitivity.

[0035] The above primer set is used to perform PCR amplification on the genomic DNA of beef cattle. As an embodiment, the PCR amplification program is 98°C 45s; 98°C 10s, 55°C 30s, 72°C 1min, 35 cycles; 72°C 5min; 12°C 1min. The obtained amplified product is digested with restriction endonuclease Mnl I and electrophoresed. If no mutation occurs in the double-stranded DNA, the electrophoresis detection result is two bands (GG type: 275bp, 186bp); if only one single-stranded DNA mutates, the electrophoresis detection result is three bands (AG type: 461bp, 275bp, 186bp); if both double-stranded DNA mutates, they cannot be cut by Mnl I, and the electrophoresis detection result is one band (AA type: 461bp).

[0036] The criteria for judging the quality of the oblique length of beef cattle at 6 months of age are:

[0037] If the enzyme digestion product is 1 band, it is AA type, and the body length of the 6-month-old cattle is poor;

[0038] If the enzyme digestion product is 2 bands, it is GG type, and the body length of the cattle is best at 6 months of age;

[0039] If the enzyme digestion product is 3 bands, it is AG type. The cow is 6 months old and has a medium body length.

[0040] The invention uses restriction endonuclease Mnl I to digest the target fragment obtained by amplification of the primer set, and by detecting the number of bands after the digestion, the genotype of the cattle can be determined, thereby achieving the purpose of determining the quality of the oblique elongation trait of the 6-month-old beef cattle, and the oblique elongation trait of the 6-month-old beef cattle can be detected and the genetic breeding of the oblique elongation trait of the 6-month-old beef cattle can be optimized.

[0041] The SNP molecular marker of the present invention can be applied to the association analysis of the oblique length-related genotype of beef cattle at 6 months of age or the oblique length-related trait of beef cattle at 6 months of age, providing a new molecular marker resource for molecular marker-assisted selection of growth and meat production performance of beef cattle.

[0042] The technical solution of the present invention will be described in more detail below in conjunction with the embodiments and drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0043] The reagents and consumables used in the present invention are all common commercial products and can be purchased from the market.

[0044] The following uses Charolais cattle as an example to illustrate the technical solution of the present invention, but it is not intended to limit the technical solution of the present invention. Those skilled in the art can apply the technical solution of the present invention to other beef cattle breeds, and detect and optimize the breeding of the oblique elongation trait of beef cattle at 6 months of age, which also falls within the protection scope of the present invention.

[0045] Example 1

[0046] Screening of molecular markers associated with body length obliquely in 6-month-old beef cattle

[0047] (1) Charolais cattle phenotypic data collection

[0048] A total of 240 Charolais cattle born between 2013 and 2023 were selected as the research subjects, and the body length trait data of the Charolais cattle group at 6 months of age were collected.

[0049] (2) Charolais cattle sample collection and genomic DNA preparation

[0050] A 5 mL blood sample was collected from the jugular vein of Charolais cattle using a veterinary blood collection needle and placed in an EDTA anticoagulant tube and stored at 4°C. After extracting leukocytes from Charolais cattle blood samples, the sample genomic DNA was extracted using the Beijing Tianmo DNA extraction kit according to the manufacturer's instructions and stored in a -80°C refrigerator after passing the quality inspection.

[0051] (3) Whole genome resequencing and SNPs detection and filtering

[0052] The DNA that passed the quality inspection was sent to the BGI platform for whole genome resequencing with a sequencing depth of 10× to obtain the original data. Fastp software was used to filter the raw data, and the filtering criteria were as follows: reads with adapters; reads with a certain proportion of N (N means that the base information cannot be determined) (default 5bp); reads containing more than 40% low-quality bases (quality value ≤ 20); sliding window quality trimming: with a sliding window size of 4bp, trimming with an average quality of less than 20. After quality control in the above steps, clean reads were obtained. BWA software was used to align clean reads to the beef cattle reference genome (GCF_002263795.1_ARS-UCD1.2_genomic.fna). The BAM file of the initial alignment result was obtained, sorted using Samtools software, and Picard was used to mark duplicate reads. Then, the GATK4.2.0.0 software toolkit was used to detect SNPs sites, and the Plink software was used to filter the SNP sites (geno 0.1--maf0.05--hwe 1e-06). Finally, Beagle version 5.4 software was used to fill in the genotypes, and finally 4,088,633 high-quality SNPs were obtained for subsequent analysis.

[0053] (4) GWAS analysis

[0054] The FarmCPU model was used to combine the phenotypic values ​​of the 6-month-old Charolais cattle with the SNPs loci for GWAS analysis using rMVP software, and the Manhattan plot and QQ plot were generated ( Figure 1 ). Taking P=2.44E-07 as the threshold of significant SNP loci, the SNPs loci significantly associated with the oblique length trait of Charolais cattle at 6 months of age were obtained.

[0055] Example 2

[0056] SNPs variation site effect analysis

[0057] According to the significant SNP sites and sample genotype information obtained by GWAS analysis, the beef cattle population in step (1) of Example 1 was grouped, and individuals with the same genotype were divided into the same group and the phenotypic values ​​of each group were counted, and the mean and standard deviation were calculated. Then, the effect size of each SNP site mutation on the corresponding phenotype was analyzed by GraphPadPrism 8 and plotted ( Figure 2 ).

[0058] The results of effect analysis showed that the variation of locus 71085551 on chromosome 3 of beef cattle genome GCF_002263795.1_ARS-UCD1.2_genomic.fna could reduce the body oblique length of Charolais cattle at 6 months of age. The body oblique length of homozygous mutant AA genotype at 6 months of age was significantly lower than that of wild GG genotype (P<0.01), indicating that AA was an unfavorable allele variation of this trait.

[0059] Example 3

[0060] PCR-RFLP genotyping, the specific steps are as follows:

[0061] 1) Using the NCBI website, find the gene sequence containing the SNP site in the cattle genome database, select the region extending 1000 bp upstream and downstream of the SNP site as a template, and use Primer5 software to design a specific amplification primer set.

[0062] 2) Collect the blood sample of Charolais cattle to be tested, extract the white blood cells from the blood sample, and use the Beijing Tianmo DNA extraction kit to extract the sample genomic DNA according to the kit instructions. The samples that pass the quality inspection will be used for the next SNP typing.

[0063] 3) Using the extracted whole genome DNA as a template, the DNA sequence containing the SNP molecular marker was amplified by PCR using the primers described in Table 1. The PCR program was 98°C for 45s; 98°C for 10s, 55°C for 30s, 72°C for 1min, 35 cycles; 72°C for 5min; 12°C for 1min. The PCR system is shown in Table 2.

[0064] Table 1 Primer sets and restriction enzymes used in PCR-RFLP

[0065]

[0066] Table 2 PCR reaction system

[0067]

[0068]

[0069] 3) The PCR amplification product was detected using 2% agarose gel electrophoresis at 100 V and 120 mA. After a single band appeared and the size was in line with expectations, subsequent SNP enzyme digestion and typing were performed.

[0070] 4) The PCR amplification product was digested with restriction endonuclease Mnl I from New England Biolabs. The digestion system was prepared and incubated at 37°C for 20 minutes. The digestion system is shown in Table 3.

[0071] Table 3 Enzyme digestion reaction system

[0072]

[0073] 5) After the enzyme digestion is completed, the above enzyme digestion products are detected using 2% agarose gel electrophoresis under 100V, 120mA conditions.

[0074] 6) According to the results of enzyme typing ( Figure 3-4 ), judge the quality of the body oblique length of the Charolais cattle at 6 months old, so as to select the breeding individuals. The judgment criteria are: if the enzyme digestion product is 1 band, it is AA type, and the body oblique length of the Charolais cattle at 6 months old is poor; if the enzyme digestion product is 2 bands, it is GG type, and the body oblique length of the Charolais cattle at 6 months old is the best; if the enzyme digestion product is 3 bands, it is AG type, and the body oblique length of the Charolais cattle at 6 months old is medium.

[0075] In summary, the SNP molecular markers associated with the oblique body elongation trait of beef cattle at 6 months of age provided by the present invention can be used to identify the oblique body elongation trait of beef cattle at 6 months of age according to genotype, thereby achieving early selection and accelerating the breeding process.

[0076] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A use of a beef cattle SNP molecular marker or a substance for detecting the beef cattle SNP molecular marker in any of the following aspects, characterized in that: Used to detect or assist in detecting the oblique length trait of beef cattle at 6 months old; Used to improve the genetic breeding of oblique body length traits in 6-month-old beef cattle; The SNP molecular marker is located at the base of the 71085551 position of chromosome 3 in the beef cattle genome GCF_002263795.1_ARS-UCD1.2_genomic.fna. The SNP site of the molecular marker has a G / A polymorphism, wherein A is an unfavorable allele variation of the oblique length trait of beef cattle at 6 months of age.

2. The use according to claim 1, characterized in that: The nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO.

1.

3. The use according to claim 1, characterized in that: The substance for detecting beef cattle SNP molecular markers includes PCR primers for amplifying genomic DNA fragments including the molecular marker SNP site, or a kit containing the primers.

4. The use according to claim 3, characterized in that: The nucleotide sequences of the primers are shown in SEQ ID NO.2 and SEQ ID NO.

3.

5. The use according to claim 3, characterized in that: The kit also includes a PCR amplification reagent and / or an enzyme cutting reagent, wherein the enzyme cutting reagent includes a restriction endonuclease Mnl I.

6. A method for detecting the oblique length trait of beef cattle at 6 months of age, characterized in that: The base type at position 71085551 of chromosome 3 of the beef cattle genome was detected. The oblique body length trait of the GG and AG genotype groups at 6 months of age was longer than that of the AA genotype group.

7. The method according to claim 6, characterized in that The method for detecting the base type of the 71085551 site of chromosome 3 of the beef cattle genome comprises: designing a primer set for amplifying the nucleotide sequence shown in SEQ ID NO.1, performing PCR amplification on beef cattle genome DNA using the primer set, enzymatically digesting the obtained amplified product using restriction endonuclease Mnl I, performing agarose gel electrophoresis on the enzymatic digestion product, and judging the base type of the 71085551 site of chromosome 3 of the beef cattle genome according to the electrophoresis bands: the enzymatic digestion product has band 1 of AA type, band 2 of GG type, and band 3 of AG type.

8. The method according to claim 7, characterized in that The size of the enzyme digestion product with only one band is 461 bp, the sizes of the enzyme digestion product with two bands are 275 bp and 186 bp respectively, and the sizes of the enzyme digestion product with three bands are 461 bp, 275 bp and 186 bp respectively.

9. A genetic breeding method for optimizing the oblique elongation trait of beef cattle at 6 months of age, characterized in that: Determine the base type of chromosome 3, position 71085551 of the breeding cattle in the core group of beef cattle, and make corresponding choices based on the base type: The successive breeding of breeding cattle selects individuals with GG and AG bases at position 71085551 of chromosome 3, and eliminates AA individuals to increase the frequency of gene G at this position generation by generation, thereby optimizing the oblique body length trait of offspring beef cattle at 6 months of age.

10. The method according to claim 9, characterized in that The base at position 71085551 of the bovine chromosome 3 is shown in the 196 bp sequence shown in SEQ ID NO.1.

Images