A molecular marker associated with the fat content of millet grains, a KASP primer pair and its application

Abstract

This invention belongs to the field of molecular biology, specifically relating to a molecular marker, KASP primer pair, and their applications related to the fat content of millet grains. The molecular marker provided by this invention is located at 45054761 bp on chromosome 5 of the millet genome, with a single nucleotide polymorphism of G / A. This molecular marker is associated with the fat content of millet grains; genotypes AA or GA indicate high grain fat content, while genotype GG indicates low grain fat content. Based on this molecular marker, a KASP primer pair was developed. Only DNA extraction, PCR amplification, and KASP genotyping are required for rapid and high-throughput detection of samples, distinguishing between millet with high and low grain fat content. This method is effective in identifying the fat content trait in millet grains and can be applied to millet breeding and high-quality genetic improvement research, providing a new option for breeding applications that increase millet fat content.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a molecular marker, KASP primer pair and their application related to the fat content of millet grains. Background Technology

[0002] The human body can synthesize certain saturated and monounsaturated fatty acids, but it cannot synthesize some fatty acids (called essential fatty acids) necessary for normal growth, such as linoleic acid and alpha-linolenic acid, which must be obtained from food. With improved living standards, people have increasingly higher nutritional requirements for food. Plants contain 40% to 50% less saturated fatty acids than animal fats, significantly reducing the likelihood of developing hypertension and coronary heart disease due to long-term consumption of large amounts of saturated fatty acids. People are gradually shifting their fat intake from animal fats to vegetable oils, leading to a growing demand for vegetable oils that are low in saturated fatty acids and high in unsaturated fatty acids.

[0003] Millet, also known as foxtail millet, is an important coarse grain crop. Its grains are rich in a balanced blend of protein, carbohydrates, and fat, and also contain essential amino acids, phosphorus, iron, and vitamins (A, B, C, and D). The fat in millet is stored in the germ and aleurone layer, with an average fat content of 4.05%, higher than rice and wheat but lower than corn. Millet fat is rich in essential fatty acids such as linoleic acid, linolenic acid, and arachidonic acid, with unsaturated fatty acids accounting for over 80%, possessing anti-inflammatory properties and helping to prevent and treat arteriosclerosis. Therefore, developing effective molecular markers for detecting the fat content of millet and efficiently assisting in the breeding of millet with high fat content is an urgent breeding requirement.

[0004] The crude fat content of millet is a complex quantitative trait controlled by multiple genes and various environmental conditions. Currently, only a small number of QTLs (quantitative trait loci) and genes related to soybean oil synthesis and 100-grain weight have been verified, and traditional breeding methods are insufficient to easily and effectively increase the crude fat content of millet. Discovering fat-related gene loci in millet grains and developing related molecular markers will not only provide a deeper understanding of the nutritional characteristics of millet and offer a scientific basis for improving millet quality and human diets, but also provide a theoretical basis for a more profound understanding of the molecular genetic mechanisms underlying the expression of quality-related traits in millet grains. Furthermore, it will provide a theoretical foundation for using molecular markers to improve the quality of millet varieties, helping to breed specialized new millet varieties and promoting millet breeding and production. Summary of the Invention

[0005] The purpose of this invention is to provide a molecular marker, KASP primer pair and their application related to the fat content of millet grains, to rapidly screen and identify the fat content trait of millet grains, and to improve the breeding efficiency of millet with high grain fat content.

[0006] This invention provides a molecular marker associated with the fat content of millet grains. The molecular marker is located at 45054761 bp on chromosome 5 of the millet genome and has a single nucleotide polymorphism of G / A.

[0007] Preferably, the molecular marker is located at 151 bp of the nucleotide sequence shown in SEQ ID NO.1, and has a single nucleotide polymorphism of G / A.

[0008] The present invention also provides a KASP primer pair for identifying the molecular markers described in the above technical solutions, including forward primer 1, forward primer 2 and reverse primer;

[0009] The forward primer 1 comprises the nucleotide sequence shown in SEQ ID NO. 2; the 5' end of the nucleotide sequence shown in SEQ ID NO. 2 contains a fluorescent marker 1;

[0010] The forward primer 2 comprises the nucleotide sequence shown in SEQ ID NO.3; the 5' end of the nucleotide sequence shown in SEQ ID NO.3 contains a fluorescent label 2;

[0011] The reverse primer comprises a nucleotide sequence as shown in SEQ ID NO.4;

[0012] The fluorescent marker 1 and fluorescent marker 2 produce different colors.

[0013] Preferably, the fluorescent marker 1 is a FAM marker; the fluorescent marker 2 is a HEX marker.

[0014] The present invention also provides a kit for identifying the molecular markers described in the above technical solutions, the kit comprising the KASP primer pair described in the above technical solutions.

[0015] This invention also provides the application of the molecular markers or KASP primer pairs or kits described above in one or more of the following:

[0016] (1) To identify or assist in the identification of the fat content of millet grains;

[0017] (2) Distinguish between millet varieties or strains with high grain fat content and those with low grain fat content;

[0018] (3) To cultivate or assist in the cultivation of millet individual plants, lines, strains or varieties with high or low grain fat content;

[0019] (4) Screening or assisted screening of millet individual plants, lines, strains or varieties with high or low grain fat content;

[0020] (5) Prepare products for detecting the fat content of millet or millet hybrids;

[0021] (6) Prepare products to distinguish between millet with high grain fat content and millet with low grain fat content;

[0022] (7) To prepare products for the cultivation or auxiliary cultivation of millet individual plants, lines, strains or varieties with high or low grain fat content;

[0023] (8) Prepare products for screening or assisting screening of millet individual plants, lines, strains or varieties with high or low grain fat content.

[0024] The present invention also provides a method for identifying the fatty properties of millet grains, comprising the following steps:

[0025] Using the genomic DNA of the millet seed to be identified as a template, PCR amplification was performed using the KASP primer pair described in the above technical solution to obtain the amplification product;

[0026] The amplification products were subjected to fluorescence detection, and the results were determined based on the fluorescence signal.

[0027] If only the fluorescence signal corresponding to the positive primer 1 is detected, the genotyping result of the millet to be identified is GG, and the millet to be identified has the trait of low grain fat content.

[0028] If only the fluorescence signal corresponding to the positive primer 2 is detected, the genotyping result of the millet to be identified is AA, and the millet to be identified has the trait of high grain fat content.

[0029] If fluorescent signals corresponding to both forward primer 1 and forward primer 2 are detected simultaneously, the genotyping result of the millet to be identified is GA, and the millet to be identified has the trait of high grain fat content.

[0030] Preferably, the genomic DNA includes leaf genomic DNA.

[0031] Preferably, the PCR amplification system, in 10 μL, comprises: 5 μL of HiGeno 2× Probe Mix A solution, 0.14 μL of 100 μmol / L SNP Primer Mix solution, 4-50 ng of genomic DNA, and the remainder being sterile water;

[0032] The volume ratio of 100 μmol / L forward primer 1, 100 μmol / L forward primer 2 and 100 μmol / L reverse primer in the SNP Primer Mix solution is 1:1:3.

[0033] Preferably, the PCR amplification program is as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, 55℃~61℃ extension for 40 s, 10 cycles; 95℃ denaturation for 20 s, 55℃ extension for 40 s, 31 cycles.

[0034] Beneficial effects:

[0035] This invention provides a molecular marker associated with millet grain fat content, located at 45054761 bp on chromosome 5 of the millet genome, with a single nucleotide polymorphism of G / A. When the millet genotype is AA or GA, it exhibits the trait of high grain fat content; when the millet genotype is GG, it exhibits the trait of low grain fat content. This molecular marker is associated with millet grain fat content and can distinguish between millet with high and low grain fat content.

[0036] This invention develops KASP primer pairs based on the aforementioned molecular markers, enabling selection related to millet grain fat content. Rapid and high-throughput detection of samples can be achieved through simple genomic DNA extraction, PCR amplification, and KASP genotyping, distinguishing between millet with high and low grain fat content. This method is effective for identifying millet grain fat content traits and can be applied to millet breeding and high-quality genetic improvement research, providing a new option for breeding applications aimed at increasing millet fat content. Attached Figure Description

[0037] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0038] Figure 1 A schematic diagram of the QTL localization results of millet in Embodiment 1 of the present invention;

[0039] Figure 2 The diagram shows the genotyping of different millet germplasms using molecular markers from Example 1. In this diagram, the small circle within ellipse 1 represents the high crude fat millet germplasm with genotype (AA); the small circle within ellipse 2 represents the template-free control NTC; the small circle within ellipse 3 represents the low crude fat millet germplasm with genotype (GG); and the small circle within ellipse 4 represents the high crude fat millet germplasm with genotype (GA).

[0040] Figure 3The results show the statistical results of KASP genotyping and crude fat content in 2020; where *** indicates p < 0.001; * indicates p < 0.05.

[0041] Figure 4 The results show the statistical results of KASP genotyping and crude fat content in 2021; where *** indicates p < 0.001; * indicates p < 0.05. Detailed Implementation

[0042] This invention provides a molecular marker associated with the fat content of millet grains. The molecular marker is located at 45054761 bp on chromosome 5 of the millet genome and has a single nucleotide polymorphism of G / A.

[0043] In this invention, as one embodiment, the molecular marker is located at 151 bp of the nucleotide sequence shown in SEQ ID NO.1, and the single nucleotide polymorphism is G / A. Specifically, the nucleotide sequence shown in SEQ ID NO.1 is: 5'-GTGCGTCCGTCTGCGGCCGCCACCTCCGTGGCCTCCGTCGCCCGCCGCCAGCTCCTAGTCCATCCCCCGCCAGCCCGTCACCTCCCTGCAGTCCCTCTGCCCAGTGCCCAGATCCCATCACGGAACTCGAGGGAACATGCTGCCAACACTRCTTGGAACTTTTAAGAGATGGTGTTCCATTTTTCTGAACAATTTGGCATTCCAGGCAAATTAGAAAGCACTGCAGTTCTCAAAGCAATTTGTGCTCCACCGAGCCTCACGTCTGCCTGACACCAGGTTCACAGCCTCCATAGATGAAATC-3'; where R is the polymorphic site and the single nucleotide polymorphism is G / A.

[0044] This invention constructs a RIL genetic population using millet germplasms (Jingu 21 and GBS) with different fat content as parents. QTL mapping was performed on millet grain fat content, and a novel QTL locus, qFAT-5, controlling the level of fat content in millet grains, was detected. After identification and screening of markers on both sides, it was determined that the genotype of the tightly linked marker Bin showed the highest phenotypic significance in terms of grain fat content. Based on this, a molecular marker was developed. This molecular marker is located at 45054761 bp on chromosome 5 of the millet genome, with a single nucleotide polymorphism of G / A. This molecular marker can be used for efficient screening of millet grain fat content. When the millet genotype is AA or GA, it exhibits the trait of high grain fat content; when the millet genotype is GG, it exhibits the trait of low grain fat content. The molecular marker described in this invention is related to the fat content of millet grains and can distinguish between millet with high and low fat content. Using this molecular marker for screening can improve the efficiency of selecting millet grains with high and low fat content in millet breeding.

[0045] The present invention also provides a KASP primer pair for identifying the molecular markers described in the above technical solutions, including forward primer 1, forward primer 2 and reverse primer;

[0046] The forward primer 1 comprises the nucleotide sequence shown in SEQ ID NO. 2; the 5' end of the nucleotide sequence shown in SEQ ID NO. 2 contains a fluorescent marker 1;

[0047] The forward primer 2 comprises the nucleotide sequence shown in SEQ ID NO.3; the 5' end of the nucleotide sequence shown in SEQ ID NO.3 contains a fluorescent label 2;

[0048] The reverse primer comprises a nucleotide sequence as shown in SEQ ID NO.4;

[0049] The fluorescent marker 1 and fluorescent marker 2 produce different colors.

[0050] In this invention, as one embodiment, the fluorescent label 1 is a FAM label. As one embodiment, the fluorescent label 2 is a HEX label. As one embodiment, the nucleotide sequence of the forward primer 1 is shown in SEQ ID NO. 5. As one embodiment, the nucleotide sequence of the forward primer 2 is shown in SEQ ID NO. 6.

[0051] The present invention also provides a kit for identifying the molecular markers described in the above technical solutions, the kit comprising the KASP primer pair described in the above technical solutions.

[0052] In one embodiment of this invention, the kit also includes other reagents for KASP detection, including but not limited to HiGeno 2× Probe MixA solution (Thermo Fisher Scientific Inc.) and / or sterile water.

[0053] This invention develops KASP primer pairs based on the aforementioned molecular markers, enabling selection related to millet grain fat content. Rapid and high-throughput detection of samples can be achieved through simple genomic DNA extraction, PCR amplification, and KASP genotyping, distinguishing between millet with high and low grain fat content. This method is effective for identifying millet grain fat content traits and can be applied to millet breeding and high-quality genetic improvement research, providing a new option for breeding applications aimed at increasing millet fat content.

[0054] In view of the advantages of the molecular markers or KASP primer pairs or kits provided by the present invention, the application of the molecular markers or KASP primer pairs or kits in one or more of the following is also within the scope of protection of the present invention: (1) identifying or assisting in the identification of millet grain fat content; (2) distinguishing between millet with high grain fat content and millet lines or varieties with low grain fat content; (3) cultivating or assisting in the cultivation of millet individual plants, lines, varieties or varieties with high or low grain fat content traits; (4) screening or assisting in the screening of millet varieties with high or low grain fat content traits. (5) Prepare products for detecting the grain fat content trait of millet or millet hybrid offspring; (6) Prepare products for distinguishing between millet with high grain fat content and millet with low grain fat content; (7) Prepare products for cultivating or assisting in the cultivation of millet plants, lines, strains or varieties with high or low grain fat content; (8) Prepare products for screening or assisting in the screening of millet plants, lines, strains or varieties with high or low grain fat content.

[0055] The present invention also provides a method for identifying the fatty properties of millet grains, comprising the following steps:

[0056] Using the genomic DNA of the millet seed to be identified as a template, PCR amplification was performed using the KASP primer pair described in the above technical solution to obtain the amplification product;

[0057] The amplification products were subjected to fluorescence detection, and the results were determined based on the fluorescence signal.

[0058] If only the fluorescence signal corresponding to the positive primer 1 is detected, the genotyping result of the millet to be identified is GG, and the millet to be identified has the trait of low grain fat content.

[0059] If only the fluorescence signal corresponding to the positive primer 2 is detected, the genotyping result of the millet to be identified is AA, and the millet to be identified has the trait of high grain fat content.

[0060] If fluorescent signals corresponding to both forward primer 1 and forward primer 2 are detected simultaneously, the genotyping result of the millet to be identified is GA, and the millet to be identified has the trait of high grain fat content.

[0061] This invention uses the genomic DNA of millet seeds to be identified as a template and performs PCR amplification using the KASP primer pair described in the above-mentioned technical solution to obtain the amplification product. In one embodiment of this invention, the genomic DNA includes leaf genomic DNA. This invention does not have strict requirements on the method of obtaining the genomic DNA; conventional methods in the art can be used, such as the CTAB (hexadecyltrimethylammonium bromide) extraction method.

[0062] In this invention, as one embodiment, the PCR amplification system, in 10 μL volumes, comprises: 5 μL of HiGeno 2× Probe Mix A solution, 0.14 μL of 100 μmol / L SNP Primer Mix solution, 4-50 ng of genomic DNA, and the remainder being sterile water. As one embodiment, the volume ratio of forward primer 1, forward primer 2, and reverse primer in the SNP Primer Mix solution is 1:1:3; as one embodiment, the independent concentrations of forward primer 1, forward primer 2, and reverse primer are each 100 μmol / L.

[0063] In this invention, as one embodiment, the PCR amplification program is as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, 55℃~61℃ extension for 40 s, 10 cycles; 95℃ denaturation for 20 s, 55℃ extension for 40 s, 31 cycles.

[0064] After obtaining the amplification product, the present invention performs fluorescence detection on the amplification product and makes a determination based on the fluorescence signal:

[0065] If only the fluorescence signal corresponding to the positive primer 1 is detected, the genotyping result of the millet to be identified is GG, and the millet to be identified has the trait of low grain fat content.

[0066] If only the fluorescence signal corresponding to the positive primer 2 is detected, the genotyping result of the millet to be identified is AA, and the millet to be identified has the trait of high grain fat content.

[0067] If fluorescent signals corresponding to both forward primer 1 and forward primer 2 are detected simultaneously, the genotyping result of the millet to be identified is GA, and the millet to be identified has the trait of high grain fat content.

[0068] In one embodiment of this invention, the fluorescence detection is performed using a quantitative fluorescence analyzer (ABI Co., USA) and Taqman Genotyper Software.

[0069] The method provided by this invention is simple and can rapidly and with high throughput detect the genotype of millet seeds and determine the fat content trait in millet grains. It can be applied to millet breeding and high-quality genetic improvement research, providing a new option for breeding applications that increase millet fat content. The millet grain fat described in this invention is crude millet grain fat.

[0070] To further illustrate the present invention, the following detailed description, in conjunction with the accompanying drawings and embodiments, provides a molecular marker related to the fat content of millet grains, a KASP primer pair, and their applications, but these descriptions should not be construed as limiting the scope of protection of the present invention.

[0071] Example 1

[0072] Screening of SNP sites associated with crude fat content in millet

[0073] (1) 114 RIL populations constructed using Jingu 21 and GBS as parents were used as experimental materials and planted in Taigu in May 2020 and 2021, respectively.

[0074] (2) After the millet matures, the crude fat content of different materials is measured according to the following steps. The results are shown in Table 1.

[0075] Crude fat content determination method: Mature millet ears were collected from the field and air-dried for 3 to 5 days. The grains were then separated from the ears and hulled using a rice huller to remove impurities and broken grains. A 6SXZ-68 color sorter was used to select millet grains that were plump and uniform in size. The millet grains were ground into powder using a vibrating ball mill, and 10 g of the powder was weighed and passed through a 100-mesh sieve. 3 g of the millet powder sample was placed in a sample box, compacted, and leveled. The crude fat content of the millet was determined using a NIRS™DS 2500 benchtop near-infrared spectroscopy system (Denmark) in the wavelength range of 1100–2498 nm. Each sample was scanned three times to eliminate the influence of particle size and uniformity on the spectrum. Finally, the data read by the instrument were exported for analysis.

[0076] Table 1. Statistical results of RIL population names and crude fat content of 114 millet samples.

[0077]

[0078] (3) Simplified genome sequencing: Young, fresh, and healthy leaves from the parents and the 114 mature single plants mentioned above were collected, and DNA was extracted using the CTAB method. DNA quality was assessed using 1% agarose gel electrophoresis. After passing the quality test, the DNA was sent to the Shenzhen BGI Agricultural Application Research Institute for simplified genome sequencing. Following data quality testing, sequencing data filtering, alignment of reads with the reference genome, and population variation detection, a sliding window method was used to select 15-20 markers as a window. The genotype of each window and the exchange sites of each progeny material were determined, constructing a parental genotype map for each progeny material. The genetic distance of all BIN markers was calculated using the MSTmap (http: / / mstmap.org / ) software with the kosambi algorithm.

[0079] (4) QTL mapping: Complete interval mapping in QTL Icimapping 4.2 was used for QTL mapping and effect analysis of crude fat trait. The LOD threshold was 2.5, and the mapping step size was set to 0.1 cM. QTL naming rule: Q + English abbreviation of trait + chromosome number. One QTL significantly associated with crude fat content was identified by complete interval mapping. It was located on chromosome 5 using bin markers. SNP variant sites were searched within the bin marker segment, and KSAP markers were developed, as shown in Tables 2-5. Figure 1 As shown: Among them, Figure 1 In the middle, A represents the results of QTL mapping of crude fat traits using bin markers in 2020; Figure 1 In the middle B, the results of crude fat trait localization using KASP marker QTLs developed in 2020 are shown. Figure 1 C represents the QTL localization result of bin tags in 2021; Figure 1 D represents the QTL mapping results for the KASP marker in 2021. The results show that the newly developed KASP is significantly linked to the crude fat trait, and the phenotypic explanatory power is increased.

[0080] Table 2. QTL mapping results of crude fat content in the RIL population in 2020 (bin markers)

[0081]

[0082] Table 3. QTL mapping results of crude fat content in the RIL population in 2020 (KASP markers)

[0083]

[0084] Table 4. QTL mapping results of crude fat content in the RIL population in 2021 (bin markers)

[0085]

[0086] Table 5. QTL mapping results of crude fat content in the RIL population in 2021 (KASP markers)

[0087]

[0088] (5) Development of SNP site variations

[0089] By simplifying genome sequencing, a genetic map of a high-density RIL population was constructed. After complex interval mapping, QTLs were located to the scaffold_5_bin198 and scaffold_5_bin199 marker intervals on chromosome 5 of the millet genome. Further analysis revealed an SNP variation at 45054761 bp on chromosome 5 of the millet genome. A 301 bp sequence was obtained by selecting 150 bp sequences upstream and downstream of this site. The nucleotide sequence of this 301 bp is shown in SEQ ID NO.1. The nucleotide at position 151 is either G or A, corresponding to position 45054761 bp on chromosome 5 of the millet genome, where the nucleotide is either G or A.

[0090] (6) For the SNP site variation in step (5), KASP primers were designed on the Poly Marker website according to the KASP design principle. Two forward primers, KASP45054761-F1 and KASP45054761-F2, and a reverse primer, KASP45054761-R, were designed. Their nucleotide sequences are as follows:

[0091] KASP45054761-F1: 5'-GGGAACATGCTGCCAACACTG-3' (SEQ ID No. 2);

[0092] KASP45054761-F2: 5'-GGGAACATGCTGCCAACACTA-3' (SEQ ID No. 3);

[0093] KASP45054761-R: 5'-GCTTTCTAATTTGCCTGGAATGC-3' (SEQ ID NO. 4).

[0094] The KASP primers mentioned above were designed based on the genotypic variations at position 45054761 bp on chromosome 5 of single plants with high and low crude fat content. The genotype for high crude fat content is AA or GA, and the genotype for low crude fat content is GG.

[0095] The FAM fluorescent adapter sequence was ligated to the 5' end of primer KASP45054761-F1, and the HEX fluorescent adapter sequence was ligated to the 5' end of primer KASP45054761-F2, resulting in forward primers 1 and 2. The primer sequences after ligation with fluorescent adapters are as follows:

[0096] Forward primer 1: 5'- GAAGGTGACCAAGTTCATGCT GGGAACATGCTGCCAACACTG-3' (SEQ ID NO. 5, where the underlined portion is the FAM fluorescent tag sequence);

[0097] Forward primer 2: 5'- GAAGGTCGGAGTCAACGGATT GGGAACATGCTGCCAACACTA-3' (SEQ ID NO. 6, where the underlined portion is the HEX fluorescent tag sequence);

[0098] The aforementioned forward primer 1, forward primer 2, and universal reverse primer KASP45054761-R were used as KASP primer pairs for molecular marker detection.

[0099] Example 2

[0100] Genotyping and crude fat content identification

[0101] (1) Using the leaves of 114 RIL population lines in Example 1 as experimental materials, the genomic DNA of the leaves of the experimental materials was extracted using the CTAB (hexadecyltrimethylammonium bromide) method.

[0102] (2) Using the genomic DNA from step (1) as a template, PCR amplification was performed using the KASP primer pair obtained in Example 1 to obtain the amplification products; wherein,

[0103] The PCR amplification reaction system, in 10 μL volumes, includes: 5 μL HiGeno 2x Probe Mix A solution, 0.14 μL SNP PrimerMix solution (primer mixture prepared according to a volume ratio of F1:F2:R = 1:1:3), 4-50 ng DNA sample, and sterile water to a final volume of 10 μL; the negative control uses ddH2O instead of template DNA for the reaction.

[0104] The PCR amplification program was as follows: Stage 1: 95℃ pre-denaturation for 10 min; Stage 2: 95℃ denaturation for 20 s, followed by extension at 55℃~61℃ for 40 s, for a total of 10 cycles; Stage 3: 95℃ denaturation for 20 s, followed by extension at 55℃ for 40 s, for a total of 31 cycles.

[0105] (3) After amplification, KASP detection was performed based on the AQP genotyping system operating instructions (purchased from Beijing Jiacheng Biotechnology Co., Ltd.). The PCR program on the ABI7500 qPCR instrument was set to 55℃ for 30s. The results file was exported, and the genotypes were further determined according to the sample clusters. The results were analyzed using Taqman Genotyper Software to obtain the relative fluorescence values ​​of HEX and FAM for each PCR reaction well (FAM fluorescent tag sequences were observed at excitation wavelength of 485nm and emission wavelength of 520nm, and HEX fluorescent tag sequences were observed at excitation wavelength of 528nm and emission wavelength of 560nm). Based on the relative fluorescence values, the samples were genotyped, classified, and statistically analyzed. The results are shown in Tables 6-7 and 7. Figures 2-4 As shown.

[0106] Table 6 Genotyping results of 114 millet RIL populations

[0107]

[0108] Note: #N indicates invalid data.

[0109] Table 7. Statistical results of KASP genotyping and crude fat content in 114 millet RIL populations

[0110]

[0111] According to Tables 6-7 and Figures 2-4 It can be seen that the PCR product of the sample only detected the fluorescent signal corresponding to the forward primer 1 connected to the fluorescent adapter sequence, so the genotype of the detection site is GG, and it is determined to be a single plant with low crude fat content; the PCR product of the sample only detected the fluorescent signal corresponding to the forward primer 2 connected to the fluorescent adapter sequence, so the genotype of the detection site is AA, and it is determined to be a single plant with high crude fat content; the PCR product of the sample detected the fluorescent signals corresponding to both the forward primer 1 and the forward primer 2 connected to the fluorescent adapter sequences, so the genotype of the detection site is GA, and it is determined to be a single plant with high crude fat content.

[0112] As can be seen from the above, the technical solution provided by this invention is related to the fat content of millet grains, and can distinguish between millet with high and low fat content. It also has a genetic linkage relationship with protein content and can be applied to millet breeding and high-quality genetic improvement research.

[0113] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A KASP primer pair for identifying molecular markers, characterized in that, It includes forward primer 1, forward primer 2, and reverse primer; The nucleotide sequence of the forward primer 1 is shown in SEQ ID NO. 5; The nucleotide sequence of the forward primer 2 is shown in SEQ ID NO. 6; The nucleotide sequence of the reverse primer is shown in SEQ ID NO.4; The molecular marker is located at 151 bp of the nucleotide sequence shown in SEQ ID NO.1, and has a single nucleotide polymorphism of G / A.

2. A kit for identifying molecular markers, characterized in that, The kit contains the KASP primer pair as described in claim 1; The molecular marker is located at 151 bp of the nucleotide sequence shown in SEQ ID NO.1, and has a single nucleotide polymorphism of G / A.

3. The use of the KASP primer pair of claim 1 or the kit of claim 2 in one or more of the following: (1) To identify or assist in the identification of the fat content of millet grains; (2) Distinguish between millet with high grain fat content and millet with low grain fat content; (3) Cultivating or assisting in the cultivation of millet with high or low grain fat content; (4) Screening or assisted screening of millet with high or low grain fat content; (5) Prepare products for detecting the fat content of millet grains; (6) Prepare products to distinguish between millet with high grain fat content and millet with low grain fat content; (7) To prepare millet with high or low grain fat content for cultivation or assisted cultivation; (8) Prepare millet with high or low grain fat content for screening or auxiliary screening; The millet mentioned is a strain of the RIL population constructed using Jin Gu 21 and GBS as parents; If only the fluorescence signal corresponding to the positive primer 1 is detected, the genotyping result of the millet to be identified is GG, and the millet to be identified has the trait of low grain fat content. If only the fluorescence signal corresponding to the positive primer 2 is detected, the genotyping result of the millet to be identified is AA, and the millet to be identified has the trait of high grain fat content. If fluorescent signals corresponding to both forward primer 1 and forward primer 2 are detected simultaneously, the genotyping result of the millet to be identified is GA, and the millet to be identified has the trait of high grain fat content.

4. A method for identifying the fat content of millet grains, characterized in that, Includes the following steps: Using the genomic DNA of the millet seed to be identified as a template, PCR amplification was performed using the KASP primer pair described in claim 1 to obtain the amplification product; The amplification products were subjected to fluorescence detection, and the results were determined based on the fluorescence signal. If only the fluorescence signal corresponding to the positive primer 1 is detected, the genotyping result of the millet to be identified is GG, and the millet to be identified has the trait of low grain fat content. If only the fluorescence signal corresponding to the positive primer 2 is detected, the genotyping result of the millet to be identified is AA, and the millet to be identified has the trait of high grain fat content. If the fluorescence signals corresponding to forward primer 1 and forward primer 2 are detected simultaneously, the genotyping result of the millet to be identified is GA, and the millet to be identified has the trait of high grain fat content. The millet described is a strain of the RIL population constructed using Jin Gu 21 and GBS as parents.

5. The method according to claim 4, characterized in that, The genomic DNA includes leaf genomic DNA.

6. The method according to claim 4 or 5, characterized in that, The PCR amplification system, in 10 μL increments, includes: 5 μL of HiGeno 2× Probe Mix A solution, 0.14 μL of 100 μmol / L SNP Primer Mix solution, 4–50 ng of genomic DNA, and the remainder of sterile water; The volume ratio of 100 μmol / L forward primer 1, 100 μmol / L forward primer 2 and 100 μmol / L reverse primer in the SNP Primer Mix solution is 1:1:

3.

7. The method according to claim 6, characterized in that, The PCR amplification program is as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, 55℃~61℃ extension for 40 s, 10 cycles; 95℃ denaturation for 20 s, 55℃ extension for 40 s, 31 cycles.

Images