A molecular marker, identification method and application for rapidly identifying the transverse diameter of cucumber fruits

Abstract

The present invention discloses a molecular marker, an identification method and an application for rapidly identifying the transverse diameter of cucumber fruits, belonging to the technical field of cucumber fruit shape identification. The present invention provides two molecular markers closely linked to the transverse diameter of cucumber fruits, namely T6-1 and W6-4. T6-1 and W6-4 are located on chromosome 6, and the physical distance is 141.89 kb. Recombination occurs between the molecular markers T6-1 and W6-4 in fruits with a thin transverse diameter. It is assumed that the genotypes of the molecular markers T6-1 and W6-4 in the long fruit inbred line are AA, and the genotypes of the round fruit inbred line are BB. The bands of the molecular markers T6-1 and W6-4 in fruits with a thin transverse diameter are AB or BA, and those in fruits with a thick transverse diameter are BB. By using the molecular markers and the identification method provided by the present invention, the rapid detection of the transverse diameter of cucumber fruits at the commercial melon stage can be realized at the seedling stage, significantly reducing the identification time and saving the identification cost. Moreover, the identification result is not affected by environmental factors, being stable and reliable. It is of great significance for simplifying the cucumber fruit shape breeding work and promoting the cucumber fruit shape breeding process.

Description

Technical Field

[0001] The present invention relates to the technical field of cucumber fruit shape identification, and in particular to a molecular marker for rapidly identifying the transverse diameter of cucumber fruits, an identification method and an application thereof. Background Art

[0002] Cucumber (Cucumissativus L.) has a crisp taste and is rich in various vitamins needed by the human body. It has the effects of beautifying and delaying aging. It is deeply loved by consumers of all ages. It is an important economic crop of the genus Cucurbitaceae and is widely cultivated around the world. Among them, my country is the world's largest cucumber planting and producing country.

[0003] As people's living standards improve, the demand for high-quality vegetables is growing, and so is the importance attached to the appearance and quality of vegetables. Fruit shape is a key appearance quality trait of cucumbers, typically determined by the fruit shape index (fruit shape index = fruit longitudinal diameter / fruit transverse diameter). Cucumber fruit shape significantly impacts its marketability and yield, as well as its grading in the market.

[0004] Fruit shape is a quantitative genetic trait, with major effect genes and multiple minor effect genes acting synergistically. Unlike quality traits, cucumber fruit shape is not only affected by genetic factors, but also by external environmental conditions such as temperature and humidity, soil conditions, pests and diseases, and pollination. This further increases the difficulty of locating genes related to fruit shape. Currently, most research on cucumber fruit shape remains at the level of rough positioning, and only a small number of related genes have been successfully cloned. Therefore, the development of molecular markers closely linked to fruit shape can realize the identification of cucumber fruit shape at the seedling stage, which is of great significance for simplifying cucumber fruit shape breeding and promoting the cucumber fruit shape breeding process. Summary of the Invention

[0005] The purpose of the present invention is to provide a molecular marker, identification method and application for rapid identification of the transverse diameter of cucumber fruit, so as to realize the seedling identification of cucumber fruit shape, greatly shorten the identification time and cost, and thus help simplify the cucumber fruit shape breeding work and promote the cucumber fruit shape breeding process.

[0006] To achieve the above object, the present invention provides a molecular marker for rapidly identifying the transverse diameter of cucumber fruit, the molecular markers being T6-1 and W6-4; the upstream primer sequence of the molecular marker W6-4 is shown in SEQ ID NO.1, and the downstream primer sequence is shown in SEQ ID NO.2; the upstream primer sequence of the molecular marker T6-1 is shown in SEQ ID NO.13, and the downstream primer sequence is shown in SEQ ID NO.14.

[0007] Preferably, the molecular markers T6-1 and W6-4 are located on chromosome 6, T6-1 is located at 15.18 Mb, and W6-4 is located at 15.32 Mb, with a physical distance of 141.89 kb.

[0008] Preferably, an exchange occurs between molecular markers T6-1 and W6-4 in fruits with a small transverse diameter, and the genotypes of molecular markers T6-1 and W6-4 in the long-fruit inbred line are set to AA, and the genotypes of the round-fruit inbred line are set to BB. The bands of molecular markers T6-1 and W6-4 in fruits with a small transverse diameter are AB or BA, and in fruits with a large transverse diameter are BB.

[0009] Preferably, a fruit with a thin transverse diameter refers to a fruit with a fruit shape index greater than 1.10, and a fruit with a thick transverse diameter refers to a fruit with a fruit shape index less than 1.10.

[0010] Preferably, the fruit shape index = fruit longitudinal diameter / fruit transverse diameter, the fruit longitudinal diameter is the length from the connection between the cucumber stalk and the fruit to the top of the fruit, and the fruit transverse diameter is the diameter of the cucumber fruit at the center.

[0011] A method for rapidly identifying the transverse diameter of cucumber fruit, using the above molecular markers for identification, comprises the following steps:

[0012] S1. Extract genomic DNA from the cucumber plants to be tested;

[0013] S2. Using the DNA solution obtained in step S1 as a template, prepare a reaction system and perform PCR amplification;

[0014] S3. Perform electrophoresis on the amplified product, read the electrophoresis band information, and determine whether the fruits of the cucumber plant to be tested in the commercial period are thin-diameter fruits or thick-diameter fruits.

[0015] Preferably, the reaction system in step S2 is prepared according to the instructions attached to the Taq enzyme.

[0016] Preferably, the PCR amplification program in step S2 is 94°C, 5 min; 94°C, 30 s, Tm, 30 s, 72°C, 10 s, 35 cycles; 72°C, 10 s; 72°C, 10 min, Tm is 50-60°C.

[0017] The invention relates to an application of a molecular marker for rapidly identifying the transverse diameter of cucumber fruit as described above in the breeding of cucumber fruit shape varieties.

[0018] Therefore, the molecular marker, identification method and application for rapid identification of cucumber fruit transverse diameter provided by the present invention have the following specific technical effects:

[0019] (1) The present invention provides two molecular markers closely linked to the transverse diameter of cucumber fruit, namely T6-1 and W6-4. T6-1 and W6-4 are located on chromosome 6, with a physical distance of 141.89 kb. Fruits with small transverse diameters exchange between molecular markers T6-1 and W6-4. The genotypes of molecular markers T6-1 and W6-4 in long-fruit inbred lines are set to AA, and those in round-fruit inbred lines are set to BB. The bands of molecular markers T6-1 and W6-4 in fruits with small transverse diameters are AB or BA, and in fruits with large transverse diameters they are BB.

[0020] (2) By using the molecular markers and identification method provided by the present invention, the transverse diameter of cucumber fruits in the commercial melon period can be quickly detected at the seedling stage, which greatly reduces the identification time and saves the identification cost. In addition, the identification results are not affected by environmental factors and are stable and reliable. This is of great significance for simplifying the cucumber fruit shape breeding work and promoting the cucumber fruit shape breeding process. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments of the present invention. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0022] Figure 1 These are photos of the fruit phenotypes of the parents CNS21 and RNS7 in Example 1 of the present invention on the day of flowering (a), at the commercial melon stage (b), and at the mature melon stage (c);

[0023] Figure 2 This is the technical roadmap for constructing a cucumber chromosome segment replacement line in Example 1 of the present invention;

[0024] Figure 3 This is a replacement fragment information diagram of the BC4F2 population in Example 1 of the present invention;

[0025] Figure 4 The following are the positions of the interval defined by molecular markers M6-4 to M6-6 on chromosomes in Example 2 of the present invention (a); photos of fruits of CSSL6-3 on the day of flowering (b), at the commercial melon stage (c), and at the mature melon stage (d); and photos of fruits of RNS7 on the day of flowering (e), at the commercial melon stage (f), and at the mature melon stage (g); the scale bars in all figures are 1 cm;

[0026] Figure 5The statistical results of fruit length (a), fruit transverse diameter (b), and fruit shape index (c) of CSSL6-3 and RNS7 on the day of flowering, fruit length (d), fruit transverse diameter (e), and fruit shape index (f) of commercial melons, and fruit length (g), fruit transverse diameter (h), and fruit shape index (i) of mature melons in Example 2 of the present invention are shown.

[0027] Figure 6 Graphs showing the growth curves of fruit length (a), fruit transverse diameter (b), and fruit shape index (c) of CSSL6-3 and RNS7 in Example 2 of the present invention;

[0028] Figure 7 These are photos of fruits of RNS7 on the day of flowering (a), at the commercial fruit stage (b), and at the mature fruit stage (c), and of Csfd6.3-NIL on the day of flowering (d), at the commercial fruit stage (e), and at the mature fruit stage (f) in Example 3 of the present invention; the scale in each figure is 3 cm;

[0029] Figure 8 The statistical results of fruit length (a), fruit transverse diameter (b), and fruit shape index (c) of Csfd6.3-NIL and RNS7 on the day of flowering, fruit length (d), fruit transverse diameter (e), and fruit shape index (f) of commercial melons, and fruit length (g), fruit transverse diameter (h), and fruit shape index (i) of mature melons in Example 3 of the present invention are as follows;

[0030] Figure 9 Graphs showing the growth curves of fruit length (a), fruit transverse diameter (b), and fruit shape index (c) of Csfd6.3-NIL and RNS7 in Example 3 of the present invention;

[0031] Figure 10 Figure 1 shows the position of the replacement fragment on the chromosome of the CSSL6-3 strain in Example 4 of the present invention (a), and the relative positions of markers T6-1 and W6-4 on the chromosome and information about the replacement fragment in the exchange plant (b);

[0032] Figure 11 This is a partial electrophoretogram of the screen of 1000 BC4F3 strains and 600 self-pollinated progeny strains using markers T6-1(a) and W6-4(b) in Example 4 of the present invention; wherein C is CNS21, R is RNS7, 1 is the 60-11-71 strain, 2 is the 60-11-60 strain, 3 is the 60-11-29 strain, 4 is the 60-11-19 strain, 5 is the 60-11-44 strain, 6 is the 60-11-46 strain, and 7 is the electrophoresis results of the 60-11-34 strain;

[0033] Figure 12These are photos of fruits of the commercial melons of strains 60-11-71 (a), 60-11-60 (b), 60-11-29 (c), 60-11-19 (d), 60-11-44 (e), 60-11-46 (f), and 60-11-34 (g) in Example 4 of the present invention; among them, the pink tags used as reference are all 2.5 cm × 2.5 cm. DETAILED DESCRIPTION

[0034] The technical solution of the present invention is further described below with reference to the accompanying drawings and embodiments.

[0035] In order to make the purpose, technical solutions and advantages of the present application clearer, more thorough and more complete, the technical solutions of the present invention are clearly and completely described below through the accompanying drawings and Examples. The following detailed description is an explanation of the embodiments and is intended to provide further details of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the application belongs.

[0036] The instruments, equipment, reagents and materials used in the examples were obtained from commercial sources.

[0037] The method steps not described in detail in the embodiment are conventional technical means in this field, wherein the parents and each strain are planted in the No. 9 solar greenhouse of the Horticultural Experiment Station of the South Campus of Shandong Agricultural University. Each exchange individual is numbered and labeled, 2-3 melons are retained on each plant, and the root melons are removed in time. Artificial pollination and labeling are carried out on the day of flowering. The horizontal and vertical diameters of the fruit are measured using a vernier caliper with a range of 150 mm. The horizontal and vertical diameters of the fruit are required to be counted every day from the day of flowering (0 DAA) to the mature melon period (22 DAA). The commercial melon period refers to 12 DAA, the vertical diameter of the fruit is the length value from the connection between the fruit stalk and the fruit to the top of the fruit, and the horizontal diameter of the fruit is the measurement data of the center position of the fruit. Fruit shape index = fruit vertical diameter / fruit horizontal diameter (L / D). Data analysis and statistics were performed in Microsoft Excel 2019 using functions such as STDEV.S and TTEST.

[0038] The PCR amplification system used in the examples was prepared according to the instructions provided with the Taq enzyme. Amplification conditions were: 94°C for 5 min, followed by 35 cycles of (94°C for 30 s, Tm for 30 s, 72°C for 10 s), 72°C for 10 s, and 72°C for 10 min. Tm values ​​were 50-60°C, with T6-1 having a Tm of 55°C and W6-4 having a Tm of 50°C.

[0039] Example 1

[0040] The specific steps for constructing cucumber chromosome segment replacement lines are as follows:

[0041] (1) Parental origin and trait information. The long-fruited inbred line CNS21 was used as the donor parent, and the round-fruited inbred line RNS7 was used as the recipient parent. The long-fruited inbred line CNS21 is a long-stick cucumber selected from the hybrid offspring of two North China types of cucumbers and was donated by Associate Professor Cao Chenxing of the College of Horticultural Science and Engineering, Shandong Agricultural University. The round-fruited inbred line RNS7 is a nearly round cucumber obtained from the National Germplasm Resource Bank. The number of the National Germplasm Center is V05A0941. Both the long-fruited inbred line CNS21 and the round-fruited inbred line RNS7 have been self-pollinated for more than 10 generations to achieve homozygosity.

[0042] Fruits of the long-fruited inbred line CNS21 and the round-fruited inbred line RNS7 at the flowering day (a), the commercial fruit stage (b), and the mature fruit stage (c) Figure 1 As shown, CNS21 and RNS7 have obvious differences in fruit shape. During the commercial melon period, the fruit length (L) of RNS7 is about 5-6 cm, and the fruit shape index (fruit length / fruit transverse diameter, L / D) is about 1; the fruit length of CNS21 is 35-40 cm, and the fruit shape index is about 10.

[0043] (2) Genome resequencing of CNS21 and RNS was performed to obtain sites with insertion or deletion (InDel) of 25 to 40 bp between the parental copies. The sequences of the differential sites were found through the cucumber genome website (http: / / cucurbitgenomics.org / organism / 20), and fragments about 400 bp upstream and downstream of the sites were cut and preserved. InDel marker primers (to ensure primer specificity) were designed using Primer 5 (www.premierbiosoft.com) and DNAMAN (https: / / www.lynnon.com). The primer length was 20 to 25 bp, and the amplified fragment size was between 200 and 300 bp, so that the molecular markers covered the entire genome.

[0044] (3) Construction of cucumber chromosome segment replacement line, the technical route is as follows Figure 2 As shown, the long-fruit inbred line CNS21 and the round-fruit inbred line RNS7 were hybridized to obtain the F1 generation, and then RNS7 was used as the recurrent parent to hybridize with the F1 to obtain the BC1F1 population. After that, RNS7 was still used as the recurrent parent to hybridize with the BC1F1 population to obtain the BC2F1 population, which was hybridized with the BC2F1 population to obtain the BC3F1 population, which was hybridized with the BC3F1 population to obtain the BC4F1 population. The BC4F1 population itself obtained the BC4F2 population. During this period, the molecular markers developed in step (2) were continuously used for screening to ensure that the replacement fragments covered the entire cucumber genome. The replacement fragment information of the BC4F2 population is shown in FIG. Figure 3As shown, the white area represents the homologous segment of the RNS7 allele, the black area represents the homologous segment of the donor CNS21 allele, and each horizontal axis represents a strain.

[0045] Example 2

[0046] Determine the target fragment and examine the relevant strain characteristics, as follows:

[0047] (1) Determine the target fragment. During the cultivation of the BC4F2 population, a cucumber fruit transverse diameter (D)-reduced strain was found, named CSSL6-3. It was found that this strain only contained a homozygous fragment of the long-fruited inbred line CNS21 within the interval of markers M6-4 (upstream primer sequence as shown in SEQ ID NO.1, downstream primer sequence as shown in SEQ ID NO.2) to M6-6 (upstream primer sequence as shown in SEQ ID NO.5, downstream primer sequence as shown in SEQ ID NO.6) on chromosome 6, with a physical distance of 2.16 Mb. The rest of the fragment was replaced by the fragment of the recipient parent RNS7 (as shown in Figure 4 (as shown in part a of the figure). Photos of fruits of CSSL6-3 and RNS7 on the day of flowering, during the commercial fruit stage, and during the mature fruit stage are shown in the figure. Figure 4 As shown in the bg part.

[0048] (2) Compared with RNS7, the fruit traits of CSSL6-3 at different developmental stages. The fruit transverse diameter, fruit longitudinal diameter and fruit shape index at different fruit developmental stages (flowering day, commercial melon stage, and mature melon stage) were measured and the data were statistically analyzed. The results are as follows: Figure 5 The results showed that: on the day of flowering, there was no significant difference in the fruit transverse and longitudinal diameters and fruit shape index between CSSL6-3 and RNS7 ( Figure 5 (a to c parts). During the commercial melon period, the longitudinal diameters of the fruits of CSSL6-3 and RNS7 were 56.13±4.77mm and 53.29±4.62mm, respectively. CSSL6-3 was slightly taller than RNS7 but there was no significant difference. The transverse diameter of the fruits of CSSL6-3 was significantly lower than that of RNS7, at 46.75±3.72mm and 53.27±4.88mm, respectively. The fruit shape index of CSSL6-3 (1.21) was significantly higher than that of RNS7 (1.00). This indicates that there is a significant difference in the transverse diameters of CSSL6-3 and RNS7 during the commercial melon period ( Figure 5 It was also found that the changes in fruit diameter, fruit diameter, and fruit shape index during the ripe melon period were similar to those during the commercial melon period ( Figure 5During the ripening period, there was no significant difference in the longitudinal diameters of the fruits of CSSL6-3 and RNS7. However, the transverse diameter of the fruits of CSSL6-3 was significantly smaller than that of RNS7, at 77.49±6.78 mm and 88.58±7.73 mm, respectively. The fruit shape index of CSSL6-3 (1.02) was significantly higher than that of RNS7 (0.92).

[0049] (3) Compared with RNS7, the fruit growth changes of CSSL6-3 throughout the growth period. The vertical and horizontal diameters of the fruits of CSSL6-3 and RNS7 were measured from the day of flowering (0 DAA) to the ripening period (22 DAA), and the fruit shape index was calculated to draw a growth curve. The results are shown in Figure 2. Figure 6 As shown: Throughout the entire fruit development period, the longitudinal diameter of the fruit of CSSL6-3 was slightly larger than that of RNS7, but the difference did not reach a significant level ( Figure 6 From the first day of flowering to the ninth day, there was no significant difference in fruit diameter between CSSL6-3 and RNS7. However, from the commercial fruit stage, the fruit diameters of CSSL6-3 and RNS7 began to differ significantly. Figure 6 (b), the fruit diameter of CSSL6-3 was significantly smaller than that of RNS7, and its fruit shape index was significantly greater than that of RNS7 during the commercial melon period, with the largest difference in fruit shape index at 12 DAA ( Figure 6 (part c of the ).

[0050] Example 3

[0051] The fragment interval determined in Example 2 was further narrowed, and the relevant strain characteristics were examined, as follows:

[0052] By screening and exchanging individuals, the interval was further narrowed and the Csfd6.3-NIL strain was obtained. The fruit phenotypes of Csfd6.3-NIL and RNS7 at different stages were identified and analyzed. The results are as follows Figure 7 As shown, similar to the results of the replacement line CSSL6-3, possibly due to the combined effects of genotype and environment, Csfd6.3-NIL exhibited a more slender phenotype and shorter fruit transverse diameter than RNS7 in the commercial and mature melon stages.

[0053] The results of comparing the fruit transverse diameter, longitudinal diameter and fruit shape index of Csfd6.3-NIL and RNS7 at different stages of fruit development are as follows: Figure 8 The results were similar to those of CSSL6-3. On the day of flowering, there were no significant differences in the fruit diameter, vertical diameter, and fruit shape index between Csfd6.3-NIL and RNS7 ( Figure 8During the commercial melon period, the vertical diameter of the fruit of Csfd6.3-NIL was 65.5±5.4 mm, which was similar to that of RNS7 (65.2±7.4 mm). The transverse diameters of the fruit of Csfd6.3-NIL and RNS7 were significantly different, being 55.2±7.9 mm and 65.3±6 mm, respectively. The fruit shape index of Csfd6.3-NIL (1.2±0.1) was significantly higher than that of RNS7 (1.0±0.03). Figure 8 During the ripening period, the longitudinal diameters of the fruits of Csfd6.3-NIL and RNS7 were 76.8±7.35 mm and 72.8±9.6 mm, respectively, which did not reach significant differences. The transverse diameter of the fruits of Csfd6.3-NIL was 65.4±8.71 mm, which was significantly lower than that of RNS7 (78.7±9.37 mm). The fruit shape index of Csfd6.3-NIL (1.1±0.02) was significantly higher than that of RNS7 (0.98±0.03) ( Figure 8 g~i part).

[0054] The fruit growth of Csfd6.3-NIL and RNS7 was measured throughout the whole period. Figure 9 As shown in Figure 2, the growth trend of the fruit's transverse and longitudinal diameters showed an "S" shape; there was no significant difference in the longitudinal diameter of the fruit between Csfd6.3-NIL and RNS7 during the entire growth and development period ( Figure 9 Part a). There was no significant difference in the transverse diameter of fruits between Csfd6.3-NIL and RNS7 at 0-8 DAA. After 9 DAA, the transverse diameter of fruits of RNS7 was significantly larger than that of Csfd6.3-NIL ( Figure 9 Part b). At 10 DAA, the fruit shape index of Csfd6.3-NIL was significantly higher than that of RNS7. At 10-14 DAA, the fruit shape index of Csfd6.3-NIL and RNS7 reached an extremely significant difference ( Figure 9 (part c of the ).

[0055] Example 4

[0056] The specific steps for determining molecular markers that are closely linked to the transverse diameter of cucumber fruit during the commercial fruiting period are as follows:

[0057] Fifty cucumber seedlings with good growth were randomly selected from the BC4F2 generation population for planting. The fruit phenotypes of their commercial fruit were identified. Fruits with a fruit shape index greater than 1.10 were recorded as thin in diameter, and fruits with a fruit shape index less than 1.10 were recorded as thick in diameter. The results are shown in Table 1. Among the 50 plants, 39 plants had thick fruits and 11 plants had thin fruits. According to the chi-square test results, χ 2 =0.10,χ 20.05 (1) = 3.84, χ 2 < 2 0.05 (1), which is consistent with Mendel's 3:1 segregation law, indicating that the transverse diameter is controlled by a single recessive gene.

[0058] Table 1

[0059]

[0060] The replacement line CSSL6-3 (BC4F3) population of 1000 plants and 600 plants in its self-pollinated progeny population were used for positioning, and the original M6-4 (upstream primer sequence is shown in SEQ ID NO.1, and the downstream primer sequence is shown in SEQ ID NO.2), M6-5 (upstream primer sequence is shown in SEQ ID NO.3, and the downstream primer sequence is shown in SEQ ID NO.4) and M6-6 (upstream primer sequence is shown in SEQ ID NO.5, and the downstream primer sequence is shown in SEQ ID NO.6) and the newly developed W6-1 (upstream primer sequence is shown in SEQ ID NO.7, and the downstream primer sequence is shown in SEQ ID NO.8), W6-4 (upstream primer sequence is shown in SEQ ID NO.9, and the downstream primer sequence is shown in SEQ ID NO.10), W6-5 (upstream primer sequence is shown in SEQ ID NO.11, and the downstream primer sequence is shown in SEQ ID NO.12) and T6-1 (upstream primer sequence is shown in SEQ ID NO.13, and the downstream primer sequence is shown in SEQ ID NO.14) were used. Seven Indel markers (shown in NO. 14) were used to determine the genotype of each plant by the size of the PCR-amplified bands. The band with the same size as the dominant parent CNS21 was designated A, the band with the same size as the recessive parent RNS7 was designated B, and the band with the same size as both the dominant parent CNS21 and the recessive parent RNS7 was designated H.

[0061] SEQ ID NO.1:GGGTGAATCTGAGCAAGA

[0062] SEQ ID NO.2:AACCATCTAAGCCTCTCG

[0063] SEQ ID NO.3:AAGATGTCAGACGGTGTG

[0064] SEQ ID NO.4:CACATGGTTTGGTGAAGG

[0065] SEQ ID NO.5:GGAAGTCTTCTGCGTTTG

[0066] SEQ ID NO.6:TGCGTGGTTAGGGTAAAG

[0067] SEQ ID NO.7: GAAACGCTTCTGGACTTT

[0068] SEQ ID NO.8:CGGTCCATAGACCAAACTCT

[0069] SEQ ID NO.9:TAATACCTTGGTAGCACTTT

[0070] SEQ ID NO.10:AAGCAAACAGACATTAGAAT

[0071] SEQ ID NO.11:GAACTATTGCCTCTTACGATAA

[0072] SEQ ID NO.12:AAAATGCGTGGCAACACTAATT

[0073] SEQ ID NO.13:CCCTTTCCTAACTCACATCT

[0074] SEQ ID NO.14:CAACCTTTATCCCATGCATGC

[0075] At the same time, the fruit phenotypes of the commercial melons were identified, and the fruit shape index of the fruit on each plant was analyzed and calculated. Through statistics, fruit shape indexes greater than 1.10 were recorded as thin transverse diameter fruits, and those less than 1.10 were recorded as thick transverse diameter fruits. It was found that the fruit shape indexes of the strains with genotypes of BBBBBHH and BBBBBAA were 0.99 and 1.20, respectively. Therefore, it was believed that there was a gene controlling the transverse diameter of the fruit between markers T6-1 and W6-4, and there was no conflict with other genotypes and fruit shape indices. The statistical results of genotypes, fruit shape indices and phenotypes are shown in Table 2. The final analysis of the phenotypic results combined with the individual genotypes located the gene controlling the transverse diameter of the fruit between markers T6-1 and W6-4, with a physical distance of 141.89kb ( Figure 10 ), the electrophoretic patterns of molecular markers W6-4 (A) and T6-1 (B) are shown in Figure 11 The phenotype of the strains is shown in Figure 12 shown.

[0076] Table 2

[0077]

[0078]

[0079] Therefore, the present invention provides two molecular markers closely linked to the transverse diameter of cucumber fruits, namely T6-1 and W6-4, which are located on chromosome 6 with a physical distance of 141.89 kb. Fruits with small transverse diameters exchange between the molecular markers T6-1 and W6-4, and the genotypes of the molecular markers T6-1 and W6-4 in the long-fruit inbred line are set to AA, and the genotypes of the round-fruit inbred line are set to BB. The bands of the molecular markers T6-1 and W6-4 in fruits with small transverse diameters are AB or BA, and in fruits with large transverse diameters they are BB. By adopting the molecular markers and identification method provided by the present invention, the transverse diameter of cucumber fruits in the commercial melon period can be quickly detected at the seedling stage, which greatly reduces the identification time and saves the identification cost. In addition, the identification results are not affected by environmental factors and are stable and reliable. The present invention has important significance for simplifying the cucumber fruit shape breeding work and promoting the cucumber fruit shape breeding process.

[0080] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the same. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solutions of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. A method for quickly identifying the transverse diameter of cucumber fruits, characterized in that, The steps are as follows: S1. Extract the genomic DNA of the cucumber plant to be tested; the cucumber is the hybrid offspring of the long-fruit inbred line CNS21 and the round-fruit inbred line RNS7; S2. Using the DNA solution obtained in step S1 as a template, and the primers being the upstream and downstream primers of the molecular markers T6-1 and W6-4, prepare a reaction system and perform PCR amplification; The upstream primer sequence of the molecular marker W6-4 is as shown in SEQ ID NO.9, and the downstream primer sequence is as shown in SEQ ID NO.10; the upstream primer sequence of the molecular marker T6-1 is as shown in SEQ ID NO.13, and the downstream primer sequence is as shown in SEQ ID NO.14; S3. Electrophorese the amplification product, read the electrophoretic band information, and determine whether the fruit of the cucumber plant to be tested at the commercial fruit stage is a fruit with a thin transverse diameter or a fruit with a thick transverse diameter; Exchange occurs between the molecular markers T6-1 and W6-4 in the fruit with a thin transverse diameter. Assume that the genotypes of the molecular markers T6-1 and W6-4 in the long-fruit inbred line are AA, and the genotypes in the round-fruit inbred line are BB. The bands of the molecular markers T6-1 and W6-4 in the fruit with a thin transverse diameter are AB or BA, and those in the fruit with a thick transverse diameter are BB; The fruit with a thin transverse diameter refers to a fruit with a fruit shape index greater than 1.10, and the fruit with a thick transverse diameter refers to a fruit with a fruit shape index less than 1.10; The fruit shape index = fruit longitudinal diameter / fruit transverse diameter. The fruit longitudinal diameter is the numerical value of the length from the connection between the cucumber fruit stalk and the fruit to the top of the fruit, and the fruit transverse diameter is the diameter value at the middle position of the cucumber fruit.

2. The method for quickly identifying the transverse diameter of cucumber fruits according to claim 1, wherein: The reaction system in step S2 is prepared according to the instructions attached to the Taq enzyme.

3. A method for quickly identifying the transverse diameter of cucumber fruits according to claim 1, characterized in that: The PCR amplification program in step S2 is 94°C for 5 min; 94°C for 30 s, Tm for 30 s, 72°C for 10 s, 35 cycles; 72°C for 10 s; 72°C for 10 min, and Tm is 50 - 60°C.

4. Application of a method for quickly identifying the transverse diameter of cucumber fruits as described in claim 1 in the breeding of cucumber fruit shape varieties.

Images