Engineered cell membrane vesicles that trigger extracellular vesicle cascade permeation and methods of construction and use thereof

By modifying cell membrane vesicles with VSVG and A23187, engineered cell membrane vesicles were prepared, which solved the problem of low tumor penetration efficiency of extracellular vesicles, achieved efficient delivery and deep penetration of tumor necrosis factor α, enhanced the tumor immune response, and inhibited tumor growth.

CN119280412BActive Publication Date: 2025-12-12SHENYANG PHARMA UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411331025.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-24
Publication Date
2025-12-12
Estimated Expiration
2044-09-24

AI Technical Summary

Technical Problem

In existing technologies, the secretion efficiency of extracellular vesicles during tumor penetration is not high, which limits their potential in tumor treatment, especially in the immunotherapy of triple-negative breast cancer.

Method used

Engineered cell membrane vesicles were prepared by modifying the surface glycoprotein of vesicular stomatitis virus (VSVG), a membrane fusion promoter, and the calcium ion carrier (A23187), a compound that promotes extracellular vesicle secretion, on the surface of cell membrane vesicles, and loading the TNF-α-Lamp2b plasmid into the vesicles, thereby achieving efficient penetration into the tumor microenvironment.

Benefits of technology

This study achieved efficient delivery and deep penetration of tumor necrosis factor-α, enhanced the tumor's immune response, effectively inhibited tumor growth, and provided a new strategy to overcome the bottleneck of nanomedicine penetration in tumors.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119280412B_ABST
    Figure CN119280412B_ABST
Patent Text Reader

Abstract

The application belongs to the field of new excipients and new dosage forms of pharmaceutical preparations, and designs an engineered cell membrane vesicle loaded with TNF-alpha-Lamp2b plasmid and modified with calcium ion carrier A23187 and membrane fusion promoter VSVG on the membrane. The engineered cell membrane vesicle can mediate membrane fusion under acidic conditions with the help of VSVG protein, and A23187 can increase the intracellular calcium level, thereby stimulating the release of extracellular vesicles. Through the enhanced permeation of A23187, we successfully improved the transmission efficiency of TNF-alpha between cells, and then realized its penetration in deep tissues of tumors, effectively inhibited the growth of tumors. The prepared engineered cell membrane vesicle can improve the efficiency of extracellular vesicle hitchhiking penetration into tumors, and enhance the immune response of cancer. It provides new strategies and more choices for the development of intelligent response type drug delivery system in tumor microenvironment.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of new excipients and new dosage forms of pharmaceutical preparations, and relates to a preparation method and application of an engineered cell membrane vesicle triggering an in situ storm of extracellular vesicles. In particular, the present application relates to an engineered cell membrane vesicle triggering a cascade penetration of extracellular vesicles and a construction method and application thereof. BACKGROUND

[0002] Cancer is one of the malignant tumors that poses a significant threat to women's health worldwide. Among numerous cancer subtypes, triple-negative breast cancer is particularly deadly due to its high invasiveness and is sometimes referred to as the "most toxic cancer". In recent years, with the deepening of medical research, immunotherapy has gradually shown its potential in treating triple-negative breast cancer. However, one of the notable features of triple-negative breast cancer is its "cold tumor" characteristic, which means that the tumor has low immunogenicity, and the tumor microenvironment has immunosuppressive effects, which limits the effectiveness of traditional immunotherapy in dealing with triple-negative breast cancer. Currently, one of the pressing challenges facing the medical community is how to effectively transform "cold tumors" into "hot tumors" and reshape the immune microenvironment of tumors to improve the efficacy of immunotherapy. This transformation is of great significance for the treatment of triple-negative breast cancer and is expected to bring new treatment options and hope to patients.

[0003] Tumor necrosis factor alpha (TNF-α) is a cytokine mainly produced by immune cells and plays a key role in anti-tumor immune responses. TNF-α can directly act on tumor cells, activate intracellular apoptosis pathways, and induce tumor cell death. The dense accumulation of cells in the tumor microenvironment, thick extracellular matrix, and increased interstitial fluid pressure together form a barrier that limits the penetration and distribution of TNF-α, resulting in insufficient accumulation of TNF-α within the tumor and thus reducing the therapeutic effect.

[0004] Extracellular vesicles (EVs) are extracellular structures composed of lipid bilayers with various transmembrane proteins on their surfaces. These vesicles can transfer bioactive molecules between cells, regulating gene expression and function in recipient cells. Through membrane protein transfer mediated by extracellular vesicles, we can modify tumor cells to enhance their immunogenicity and thus improve the tumor microenvironment for cancer immunotherapy. However, the performance of extracellular vesicles in tumor penetration is not ideal, mainly limited by their low secretion efficiency, which limits their potential in tumor therapy. SUMMARY

[0005] The purpose of the present application is to overcome the deficiencies of the prior art, and to provide an engineered cell membrane vesicle triggering a cascade penetration of extracellular vesicles and a construction method and application thereof.

[0006] To achieve the above object, the application adopts the following technical solutions:

[0007] An engineered cell membrane vesicle triggering extracellular vesicle cascade penetration, the engineered cell membrane vesicle is a cell membrane vesicle (NV) surface modified with a membrane fusion promoter and an extracellular vesicle secretion promoting compound, and the inside of the vesicle carries a drug.

[0008] The membrane fusion promoter is a vesicular stomatitis virus surface glycoprotein (VSVG), the extracellular vesicle secretion promoting compound is a calcium ion carrier (A23187), and the drug is a TNF-alpha-Lamp2b plasmid; wherein the mass ratio of protein to TNF-alpha-Lamp2b in the cell membrane vesicle is 2:1, and the mass ratio of protein to A23187 in the cell membrane vesicle is 2:1.

[0009] The TNF-alpha-Lamp2b plasmid is a fusion of a TNF-alpha protein sequence and a Lamp2b protein sequence to generate a TNF-alpha-Lamp2b plasmid.

[0010] A method for constructing the engineered cell membrane vesicle, the cell membrane vesicle (NV) surface is modified with a membrane fusion promoter and an extracellular vesicle promoting compound, and the inside of the vesicle carries a drug to obtain the engineered cell membrane vesicle.

[0011] Specifically, a plasmid containing a membrane fusion promoter is transfected into cells, and then cell membrane vesicles carrying the membrane fusion promoter are extracted, and then the expressed TNF-alpha protein is sorted into extracellular vesicles by Lamp2b, and then the engineered cell membrane vesicles are obtained by incubating with an extracellular vesicle secretion promoting compound.

[0012] The cells are tumor cells such as 4T1, CT26, B16, etc.

[0013] Further, the cells are mixed and cultured with a transfection reagent and a VSVG plasmid, and then cell membrane vesicles carrying the membrane fusion promoter (V-NVs) are obtained by ultrasonic crushing and centrifugation after culture; V-NVs and TNF-alpha-Lamp2b plasmids are mixed in a certain proportion for electroporation, and then incubated; and then A23187 is added for further incubation to obtain the engineered cell membrane vesicles.

[0014] The cell membrane vesicles carrying membrane fusion promoters (V-NVs) are mixed with transfection reagent (PEI) and VSVG plasmid after 12 hours of culture; then the cells are cultured in Opti-MEM medium for 48 hours, after culture, the cells are resuspended in PBS, after resuspension, the final precipitate is collected by crushing and centrifugation, and the cell membrane vesicles carrying VSVG are collected by filtration. Among them, the centrifugal conditions are 2000 r.p.m for 10 minutes, 5000 r.p.m for 10 minutes, and 15000 r.p.m for 60 minutes. After the first two centrifugations, the supernatant is taken and the precipitate is discarded, and the precipitate is resuspended with PBS after the last centrifugation.

[0015] The V-NVs and TNF-α-Lamp2b plasmid are mixed in a 4°C electrophoresis tank, and an electroporator is used at 400V, 25μF capacitance and 50Ω resistance, with a pulse duration of 10-15ms. After electroporation, incubate at 37°C for 30 minutes, then add A23187, and incubate at 37°C for another 30 minutes to obtain engineered cell membrane vesicles.

[0016] Further said:

[0017] 4T1 cells are inoculated in culture dishes, and after 12 hours, VSVG plasmid and transfection reagent (PEI) are diluted with Opti-MEM medium, and the two are mixed in a mass ratio of 3:1. The cell culture medium is replaced with serum-free culture medium, and the VSVG plasmid is transfected into 4T1 tumor cells. After 48 hours of culture, the cells are collected. Resuspend the cells in PBS and use an ultrasonic crusher to treat them in a sterile EP tube at 22w, 4°C for 60s. Remove cell debris by continuous centrifugation (2000 r.p.m for 10 minutes, 5000 r.p.m for 10 minutes, and 15000 r.p.m for 60 minutes). After the first two centrifugations, the supernatant is taken and the precipitate is discarded, and after the last centrifugation, the precipitate is resuspended and filtered through a 0.22μm filter to collect cell membrane vesicles (V-NVs). The protein concentration of the cell membrane vesicles is quantified by a BCA protein assay kit. Mix the cell membrane vesicle protein mass and the TNF-α-Lamp2b plasmid in a predetermined ratio NVs:TNF-α-Lamp2b=2:1 in a cooled 0.4cm cuvette, and perform electroporation at 400V, 25μF capacitance and 50Ω resistance, with a pulse duration of 10-15ms. After electroporation, incubate in a 37°C incubator for 30 minutes to allow the vesicle membrane to recover. Add A23187 at a predetermined ratio NVs protein mass:A23187=2:1, and incubate in a 37°C incubator for 30 minutes.

[0018] The use of the engineered cell membrane vesicles in the preparation of an antitumor drug.

[0019] The drug is used in the form of injection or topical administration.

[0020] The present application has the following beneficial effects:

[0021] (1) The present application prepares engineered cell membrane vesicles with uniform particle size, and the preparation method is simple, efficient, and stable, realizes efficient delivery and deep penetration of tumor necrosis factor alpha.

[0022] (2) The engineered cell membrane vesicles prepared by the present application have uniform particle size and good stability, and can respond to the acidic conditions in the tumor microenvironment, improve the transmission efficiency of tumor necrosis factor alpha between cells through A23187 enhanced penetration, and realize the penetration of deep tissues of the tumor, and effectively inhibit the growth of the tumor. This finding provides a new strategy for overcoming the bottleneck of nanomedicine in tumor penetration, and provides more choices for the urgent need for efficient chemotherapy preparations in clinical treatment. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 Figure 1 is a schematic diagram of the TNF-alpha-Lamp2b plasmid structure of Example 1 of the present application.

[0024] Figure 2 Figure 2 is the size distribution and electron microscope image of NVs and V-NVs / T+A of Example 2 of the present application; wherein A is NVs, and B is V-NVs / T+A.

[0025] Figure 3 Figure 3 is the stability experiment graph of NVs and V-NVs / T+A of Example 3 of the present application; wherein A is the 12-hour stability experiment graph, and B is the 7-day stability experiment graph.

[0026] Figure 4 Figure 4 is the FRET effect curve graph of liposomes and V-NVs / T+A at pH = 6.3 ± 0.1 of Example 4 of the present application.

[0027] Figure 5 Figure 5 is the real-time fluorescent quantitative PCR analysis of the expression of TNF-alpha mRNA of 4T1 cells incubated with NVs or V-NVs / T+A of Example 5 of the present application.

[0028] Figure 6 Figure 6 is a co-localization experiment graph of exosomes extracted from cells incubated with V-NVs / T+A, which are labeled with green fluorescent GFP and red fluorescent RFP of Example 6 of the present application.

[0029] Figure 7Figure for cell uptake experiment of NVs / T+A and V-NVs / T+A in 4T1 and 3T3 cells of Example 7 of the present application, wherein A is a confocal image, and B is a flow cytometry quantification figure.

[0030] Figure 8 Figure for expression experiment of VSVG protein in cells incubated with V-NVs / T+A of Example 8 of the present application.

[0031] Figure 9 Figure for cytotoxicity experiment of V-NVs / T+A on 4T1 cells of Example 9 of the present application.

[0032] Figure 10 Figure for flow cytometry experiment of immune effect of V-NVs / T+A on triggering dendritic cells and macrophages of Example 10 of the present application; wherein A is a quantification figure of triggering dendritic cells, B is a quantification figure of triggering macrophages, C is a flow cytometry figure of triggering dendritic cells, and D is a flow cytometry figure of triggering macrophages.

[0033] Figure 11 Figure for flow cytometry experiment of V-NVs / T+A triggering apoptosis of 4T1 cells of Example 11 of the present application.

[0034] Figure 12 Figure for experiment of A23187 solution and V-NVs / T+A promoting EVs secretion in cells of Example 12 of the present application; wherein A is the effect of solution on promoting EVs secretion, and B is the effect of each group of preparation on promoting EVs secretion.

[0035] Figure 13 Figure for detecting Ca 2+ level of V-NVs / T+A treated cells of Example 12 of the present application.

[0036] Figure 14 Figure for detecting Ca 2+ level of V-NVs / T+A treated cells of Example 12 of the present application.

[0037] Figure 15 Figure for confocal experiment of V-NVs / T+A transferring between cells in transwell experiment of Example 13 of the present application.

[0038] Figure 16 Figure for flow cytometry quantification of TNF-α content in supernatant or extracted exosomes of Example 13 of the present application.

[0039] Figure 17 Figure for confocal image and quantification of V-NVs / T+A penetrating tumor spheroids of Example 14 of the present application; wherein A is a confocal image of tumor spheroids, and B is a penetration quantification figure.

[0040] Figure 18 Confocal images of V-NVs / T+A cytotoxicity to tumor spheroids quantified by cell toxicity for Example 14 of the present invention.

[0041] Figure 19 Confocal images of V-NVs / T+A cytotoxicity to tumor spheroids for Example 14 of the present invention.

[0042] Figure 20 In vivo fluorescence images of 4T1 tumor-bearing mice after intravenous injection of V-NVs / T+A for Example 15 of the present invention.

[0043] Figure 21 Quantification of in vivo fluorescence of 4T1 tumor-bearing mice after intravenous injection of V-NVs / T+A for Example 15 of the present invention.

[0044] Figure 22 Quantification of fluorescence of major organs and tumors in vivo of 4T1 tumor-bearing mice after intravenous injection of V-NVs / T+A for Example 15 of the present invention.

[0045] Figure 23 Confocal microscopy images of V-NVs / T+A penetration in 4T1 mouse tumors for Example 15 of the present invention.

[0046] Figure 24 Bioluminescence imaging images of 4T1-Luc lung metastasis mice at different time points after treatment for Example 16 of the present invention.

[0047] Figure 25 Photos of lung metastasis foci stained and fixed with Bouin’s fixative for Example 16 of the present invention.

[0048] Figure 26 In vitro IVIS fluorescence imaging images of excised lung tissue after treatment for Example 16 of the present invention.

[0049] Figure 27 Tumor growth curve after treatment for Example 16 of the present invention.

[0050] Figure 28 Tumor images after treatment for Example 16 of the present invention.

[0051] Figure 29 Flow cytometry analysis images of DC cells, tumor CD8 + T cells and M1 macrophages after treatment for Example 16 of the present invention.

[0052] Figure 30 H&E staining images of liver sections after different treatments for Example 16 of the present invention.

[0053] Figure 31 These are H&E staining images of lung sections after different treatments in Example 16 of the present invention.

[0054] Figure 32 This is a tumor growth curve after V-NVs / T+A treatment in Example 17 of the present invention.

[0055] Figure 33 This is a photograph of an anatomically removed 4T1 tumor after V-NVs / T+A treatment in Example 17 of this invention.

[0056] Figure 34 This is a graph showing the changes in liver and kidney function indicators in 4T1 tumor-bearing mice after V-NVs / T+A treatment in Example 17 of this invention.

[0057] Figure 35 This is a graph showing the cytokine levels after V-NVs / T+A treatment in Example 17 of the present invention.

[0058] Figure 36 The images show H&E staining of organs in 4T1 tumor-bearing mice after V-NVs / T+A treatment in Example 17 of this invention.

[0059] Figure 37 This is a systemic antitumor immunocytogram of V-NVs / T+A in Example 18 of the present invention. Detailed Implementation

[0060] The following examples further illustrate specific embodiments of the present invention. It should be noted that the specific embodiments described herein are merely for illustration and explanation and are not intended to limit the scope of the present invention.

[0061] An engineered cell membrane vesicle is developed for cascading deep tumor penetration and TNF-α cytokine therapy to enhance tumor immunotherapy. The engineered cell membrane vesicle can mediate membrane fusion under acidic pH, improving the efficiency of exosomes hitching a ride on tumors and enhancing the immune response to cancer.

[0062] Specifically, various types of cells were transfected with VSVG, and the cell membrane vesicles isolated from them were loaded with TNF-α-Lamp2b plasmid via electroporation into the VSVG cell membrane vesicles. A23187 was then loaded into the VSVG cell membrane vesicles via incubation.

[0063] Example 1: Preparation of TNF-α-Lamp2b plasmid:

[0064] Use I-5 TM 2×High-Fidelity Master Mix high-guarantee polymerase for PCR amplification (F1: CTTGGTAC CGAGCTCGGATCCGCCACCATGTGCCTCTCTCCGGTTAAAG; R1: AACGGGCCCTCTAGACTCGAGTCACAGGTCCTCCTCTGAGATCAGC). After the PCR amplification of the target fragment, 1% agarose gel electrophoresis was used for detection, and the DNA target fragment was recovered according to the instructions of the rapid agarose gel DNA recovery kit. The enzyme-digested vector pCDNA3.1(+) was added with Xho I and Bam HI restriction endonuclease, and enzyme-digested for 30 min at 37°C. ClonExpress Mix was added to the system with a vector fragment: target fragment ratio of 3:1 for ligation to obtain the target plasmid TNF-a-Lamp2b. (Specifically, see Interleukin 3-receptor targeted exosomes inhibit in vitro and in vivo Chronic Myelogenous Leukemia cell growth) for the obtained plasmid as the replacement of IL-3 in the article, and the specific protein replaced is TNF-a: https: / / www.ncbi.nlm.nih.gov / gene / 21926. The plasmid structure is as shown in Figure 1

[0065] Example 2: Preparation of engineered NVs

[0066] 1) Obtaining NVs: After 4T1 cells were initially placed in culture dishes for 12 hours, the cells were resuspended in PBS and subjected to 60 seconds of sonication using an ultrasonic disrupter in sterile EP tubes (22w, 4°C). Cell debris and microvesicles were removed by successive centrifugations (10 minutes at 2000 r.p.m, 10 minutes at 5000 r.p.m, and 60 minutes at 15000 r.p.m), taking the supernatant after the first two centrifugations and discarding the pellet, and taking the pellet after the last centrifugation and respinning it with PBS. The supernatant was filtered through a 0.22 pm filter to collect the NVs.

[0067] 2) Obtaining NVs / T: The NVs obtained in 1) and the TNF-a-Lamp2b plasmid were mixed in a predetermined ratio of NVs protein mass: TNF-a-Lamp2b mass = 2:1 in a cooled 0.4 cm cuvette, and electroporation was performed using an electroporator (BioRad, USA) at 400 V, 25 pF capacitance and 50 W resistance, with a pulse duration of 10-15 milliseconds. After electroporation, incubation was performed in a 37°C incubator for 30 minutes, and the vesicle membrane was allowed to recover, i.e., NVs / T were obtained.

[0068] ​3) Obtaining of NVs / A: Add A23187 to the NVs obtained in 1), with the predetermined ratio of NVs protein mass:A23187 mass = 2:1, incubate in a 37°C incubator for 30 minutes, and obtain NVs / A.

[0069] 4) Obtaining of V-NVs: 4T1 cells were initially placed in a culture dish for 12 hours, and then the cell culture medium was replaced with Opti-MEM medium, ready for use. The transfection reagent (PEI) and the VSVG plasmid (purchased from Wuhan Moli Biological Technology Co., Ltd.) were diluted in Opti-MEM medium and mixed for 15 minutes, with a mass ratio of transfection reagent to VSVG plasmid of 3:1; the above mixed solution was added to the cultured cells, and after 48 hours, the cells were resuspended in PBS and subjected to 60 seconds of sonic disruption in a sterile EP tube (22w, 4°C) using an ultrasonic disrupter. Cell debris and microvesicles were removed by continuous centrifugation (10 minutes at 2000 r.p.m, 10 minutes at 5000 r.p.m, and 60 minutes at 15000 r.p.m), and the supernatant was taken after the first two centrifugations, and the precipitate was discarded. The precipitate was resuspended with PBS after the last centrifugation. The supernatant was filtered through a 0.22 μm filter to collect the V-NVs.

[0070] 5) Obtaining of V-NVs / A: Add A23187 to the V-NVs obtained in 4), with the predetermined ratio of V-NVs protein mass:A23187 mass = 2:1, incubate in a 37°C incubator for 30 minutes, and obtain V-NVs / A.

[0071] 6) Obtaining of V-NVs / T: Mix the V-NVs obtained in 4) and the TNF-α-Lamp2b plasmid in a cooled 0.4 cm cuvette, with the predetermined ratio of V-NVs protein mass:TNF-α-Lamp2b mass = 2:1, and use an electroporator (BioRad, USA) at 400V, 25 μF capacitance and 50Ω resistance for electroporation, with a pulse duration of 10-15 milliseconds. Incubate in a 37°C incubator for 30 minutes after electroporation, and wait for the vesicle membrane to recover, and obtain V-NVs / T.

[0072] 7) Obtaining of NVs / T+A: Add A23187 to the NVs / T obtained in 2), with the predetermined ratio of V-NVs protein mass:A23187 mass = 2:1, incubate in a 37°C incubator for 30 minutes, and obtain NVs / T+A.

[0073] 8) Obtaining of V-NVs / T+A: Add A23187 to the V-NVs / T obtained in 6), with the predetermined ratio of V-NVs protein mass:A23187 mass = 2:1, incubate in a 37°C incubator for 30 minutes, and obtain V-NVs / T+A.

[0074] The same protein amount of NVs and V-NVs / T+A prepared in Example 1 step 1) and step 8) were characterized using Hitachi TEM H-7000 transmission electron microscope and Nanoparticle Size Potential Instrument. The experimental results are shown in Figure 2 Figure 1, the cell membrane vesicles (NVs) obtained in step 1) have a particle size of about 110 nm. The engineered cell membrane vesicles (V-NVs / T+A) obtained in step 8) have a particle size of about 120 nm, and both of them are tea tray-shaped under transmission electron microscope.

[0075] Example 3: Colloidal stability test of engineered NVs

[0076] 1) The same protein amount of NVs and V-NVs / T+A prepared in Example 1 step 1) and step 8) were respectively taken out 1 mL, added into 20 mL of phosphate buffer (PBS, pH 7.4), incubated at 4°C for 7 days, and the particle size change thereof was determined by dynamic light scattering method every day (see Figure 3 B).

[0077] 2) The same protein amount of NVs and V-NVs / T+A prepared in Example 1 step 1) and step 8) were respectively taken out 1 mL, added into 20 mL of phosphate buffer (PBS, pH 7.4), incubated at 37°C for 24 h, and the particle size change thereof was determined by dynamic light scattering method at predetermined time points (0 h, 2 h, 4 h, 6 h, 8 h, 12 h and 24 h) (see Figure 3 A)

[0078] The results are shown in Figure 3 Figure 2, the colloidal stability of NVs and V-NVs / T+A is good, and the particle size of both of them does not change significantly under the two test conditions, which is conducive to more drugs circulating in the blood to accumulate in the tumor site, achieving better therapeutic effect.

[0079] Example 4: Membrane fusion property test of V-NVs / T+A

[0080] To determine the membrane fusion efficiency by FRET effect, FRET liposomes were prepared using DiL and DiD as fluorescent donor and acceptor in a molar ratio of 1 :7 (for details, see Bioinspired engineering of fusogen and targeting moiety equipped nanovesicles). Briefly, the lipid mixture was initially dried under vacuum and then rehydrated in PBS. After five freeze-thaw cycles, large unilamellar vesicles were prepared by 200 nm polycarbonate filter extrusion. These liposomes were labeled with DiD and DiL and then immobilized on the PEG-coated surface by streptavidin-biotin lipid conjugation. Subsequently, the LDLR was attached to the liposomes using the Ni-NTA system. The V-NVs / T+A prepared in Example 1, step 8) above were introduced and incubated at 37 °C at pH = 6.3 ± 0.1. The fluorescence spectrum in the range of 550 nm to 750 nm was measured to assess fusion (see Figure 4 ). As Figure 4 shown in Figure 8, the fluorescence change before and after membrane fusion at pH = 6.3 ± 0.1 revealed that VSVG not only successfully hitchhiked on V-NVs / T+A, but also exhibited their membrane fusion ability. When pH = 7, no FRET effect was observed, revealing the acid-responsive property of V-NVs / T+A at pH = 6.3 ± 0.1.

[0081] Example 5: Expression of TNF-a-Lamp2b plasmid

[0082] The mRNA level of TNF-a was evaluated by real-time quantitative PCR. Quantitative detection of mRNA expression was performed using reverse transcription polymerase chain reaction (RT-PCR). 4T1 cells were treated with the same amount of NVs and V-NVs / T+A prepared in Example 1, step 1) and step 8), respectively, incubated for 48 hours and washed with PBS. RNA was extracted from the cells using an RNA extraction kit and the RNA concentration was measured. The RNA was then reverse transcribed into cDNA and subjected to quantitative analysis. RT-PCR was performed using cDNA primers (forward: 5'-caggcggtgcctatgtctc-3', reverse: 5'-cgatcaccccgaagttcagtag-3') under the following conditions: activation of Taq at 95 °C for 30 seconds, followed by 30 cycles of 95 °C for 10 seconds and 60 °C for 30 seconds. Gene expression data were normalized to the GAPDH mRNA level for each sample. The relative expression level was determined by performing three replicate experiments using 2 -ΔΔct Methods.

[0083] As Figure 5As shown, the TNF-a plasmid delivered by V-NVs / T+A was efficiently transcribed in cells, with a seven-fold increase in mRNA levels compared to cells treated with blank NVs.

[0084] Example 6: Fluorescence co-localization experiment

[0085] The VSVG protein was labeled with green fluorescent protein (GFP) and the TNF-a-Lamp2b protein was labeled with red fluorescent protein (RFP). 4T1 cells were treated with V-NVs / T+A prepared in Example 1 step 8) after being labeled with fluorescent labels and incubated for 48 hours. Exosomes secreted by the cells were extracted using an exosome extraction kit (Biyunchun). The exosomes treated with V-NVs / T+A were observed using a confocal laser scanning microscope (CLSM, C2, Nikon, Japan) (see Figure 6 ).

[0086] As shown in Figure 6 , the red fluorescence and green fluorescence in the extracted exosomes were co-localized, indicating the presence of VSVG protein and TNF-a-Lamp2b protein in the exosomes.

[0087] Example 7: Cell uptake

[0088] 4T1 cells were seeded in 24-well plates containing 1640 medium at a density of 5 x 10 4 cells per well and incubated for 12 hours. 3T3 cells were seeded in 24-well plates containing DMEM / F-12 medium at a density of 5 x 10 4 cells per well and incubated for 12 hours.

[0089] To study the membrane fusion properties of the VSVG protein, the above 4T1 cells were treated with the same amount of NVs / T+A and V-NVs / T+A prepared in Example 1 steps 7) and 8) after being labeled with fluorescent labels, respectively, and incubated for 24 hours or 48 hours. The medium was removed, the cells were washed, collected, stained with Hoechst, and observed under a confocal laser scanning microscope (CLSM, C2, Nikon, Japan) (see Figure 7 A).

[0090] To quantitatively analyze the cell uptake efficiency, 4T1 and 3T3 cells (5 x 10 5 cells per well) were plated in 12-well plates. Similar to the previous description, the cells were washed and resuspended after being collected, and the cells were analyzed using a flow cytometer (see Figure 7 B).

[0091] As shown in Figure 7As shown, V-NVs / T+A was successfully taken up, and the fluorescence intensity of the V-NVs / T+A group was significantly higher than that of the NVs / T+A group, demonstrating the membrane fusion properties and enhanced uptake capacity of VSVG protein. At the same time, the uptake of V-NVs / T+A showed a time-dependent effect.

[0092] Example 8: Immunoblot assay

[0093] 4T1 with 1×10 per hole 6 Cells were seeded at a density of 1000 μg / mL in 6-well plates containing 1640 μL of medium. Cells were treated with the same amounts of NVs, V-NVs, and V-NVs / T+A prepared in steps 1), 4), and 8) of Example 1, and incubated for 48 hours. Cells were collected into EP tubes using a cell scraper, and lysis buffer was added and the cells were lysed on ice for 15 minutes. After lysis, the sample was centrifuged at 12000 g, and the supernatant was collected. Protein concentration was quantified using a BCA kit. An equal amount of protein was added to loading buffer and boiled in water for 5 minutes. An equal amount of protein (40 μg) was added to each well and separated by SDS-PAGE. The protein was then transferred to a PVDF membrane and blocked with 5% skim milk. The membrane was then incubated overnight at 4°C with primary antibodies, including VSVG and β-actin. The PVDF membrane was then incubated with HRP-labeled goat anti-rabbit IgG for 2 hours. Finally, chemiluminescence detection was performed using an ECL reagent to visualize the protein bands. The expression of VSVG protein in cells was confirmed by Western blot experiments.

[0094] Experimental results are as follows Figure 8 As shown, VSVG protein is present in cells treated with V-NVs and V-NVs / T+A.

[0095] Example 9 Cytotoxicity Experiment

[0096] The antiproliferative activity of NVs, NVs / T, V-NVs / A, V-NVs / T, and V-NVs / T+A with the same protein content prepared in steps 1), 2), 5), 6), and 8) of Example 1 was evaluated using the MTT assay. First, 4T1 cells were cultured at 1 × 10⁻⁶ cells per well. 3 Cells were seeded at a density of 1640 g / L in 96-well plates and incubated for 12 hours to ensure cell adhesion. The medium was then removed, and the cells were treated with the different formulations described above and incubated for another 48 hours. Next, MTT solution was added to each well, and the cells were incubated for an additional 4 hours to allow the MTT to fully react with the cells and form purple formazan crystals. The MTT solution was then carefully removed, and the formed crystals were dissolved with dimethyl sulfoxide (DMSO). Finally, cell viability was measured at 490 nm using a microplate reader.

[0097] The experimental results, as shown in FIG. 6, show that the group containing VSVG significantly enhances the anti-tumor ability of TNF-a. In addition, the addition of A23187 promotes the secretion of extracellular vesicles (EVs), enhances the transmission of TNF-a between cells, and further enhances the anti-tumor activity. Figure 9

[0098] Example 10: Cellular immunity

[0099] Bone marrow cells were obtained from the tibia and femur of BALB / c mice. The mice were first euthanized under sterile conditions. Then the leg skin was incised, the tibia and femur were exposed and separated, and the surface muscle and soft tissue were removed. Then the joint parts at both ends of the bone were cut off, and the bone marrow cells were flushed out into a sterile centrifuge tube by injecting culture medium. Finally, the bone marrow cell suspension was centrifuged, and after removing the culture medium, the cells were resuspended with fresh culture medium. These cells were cultured in RPMI 1640 medium supplemented with 1% penicillin-streptomycin and 10% bovine serum. In order to promote the differentiation of bone marrow-derived dendritic cells (BMDCs) and bone marrow-derived macrophages (BMDMs), the cultures were treated with 1640 medium containing recombinant mouse granulocyte-macrophage colony-stimulating factor (GM-CSF), recombinant mouse interleukin-4 (IL-4), and granulocyte-macrophage colony-stimulating factor (M-CSF), respectively. The culture medium was replaced every other day, and the cells were cultured for a total of 4 days to differentiate into BMDCs and BMDMs. The same amount of NVs, NVs / A, V-NVs, V-NVs / T, V-NVs / T+A prepared in steps 1), 3), 4), 6), and 8) of Example 1 were used to treat 4T1 tumor cells for 48 hours. Then the immature BMDCs and BMDMs were co-cultured with the above treated tumor cells for 24 hours. Subsequently, flow cytometry analysis was performed using CD45, CD11c, and CD80 antibodies for BMDCs and CD45, CD11b, and F4 / 80 antibodies for BMDMs.

[0100] As shown in FIG. 8, compared with other control groups, the expression of CD80 and CD86 in V-NVs / T+A was significantly up-regulated, indicating that tumor cells incubated with V-NVs / T+A can stimulate BMDMs to polarize to M1 phenotype and stimulate BMDCs to mature. Therefore, engineered NVs can systematically regulate immune cells from multiple aspects, including DC maturation and macrophage polarization, which is crucial for remodeling the tumor microenvironment in immunotherapy. Figure 10

[0101] Example 11: Apoptosis

[0102] 4T1 cells were plated at 5 x 105cells per well in a 6-well plate and incubated for 24 hours. The cells were then treated with the same amount of NVs, NVs / A, V-NVs, V-NVs / T, and V-NVs / T+A prepared in steps 1), 3), 4), 6), and 8) of Example 1, respectively, for 48 hours. The cells were then stained with Annexin V and PI and analyzed by flow cytometry. 5 ​​Cells were seeded at a density of 1000 mg / L in 12-well culture plates containing 1640 mg / L medium and incubated for 12 hours to ensure cell adhesion. After incubation, cells were treated with the same amounts of NVs / T, V-NVs / A, V-NVs / T, V-NVs / T+A prepared in steps 2), 5), 6), and 8) of Example 1, and with the addition of the TNF-α inhibitor Z-VAD-FMK (20 μmol / L) to V-NVs / T+A, and incubated for another 48 hours. The cell culture medium was then collected in centrifuge tubes for later use. Next, cells were digested with trypsin, with the previously collected culture medium added to terminate the digestion reaction. The digested cell suspension was then centrifuged, the supernatant was removed, and the cells were resuspended in PBS. Finally, the treated cells and supernatant were collected and stored for subsequent analysis. Cells were stained using the Annexin V-FITC apoptosis detection kit and then analyzed immediately by flow cytometry.

[0103] like Figure 11 As shown, apoptosis was significantly reduced after the addition of a TNF-α inhibitor, consistent with the observed cytotoxicity results. These results indicate that V-NVs / T+A exhibit potent antitumor activity, with TNF-α playing a key role in this effect.

[0104] Example 12: Verification of the A23187 mechanism

[0105] 4T1 cells were loaded at a rate of 1×10⁴ cells per well. 6 4T1 cells were seeded at a density of 1640 g / mL in 6-well culture plates and incubated for 12 hours to ensure full cell adhesion. After incubation, 4T1 cells were treated with A23187 solution, and EVs were extracted using an EV extraction kit. The collected EVs were quantitatively analyzed using the BCA assay to determine their protein content. Figure 12 A).

[0106] Subsequently, 4T1 cells were treated with NVs / T, V-NVs / A, V-NVs / T, V-NVs / T+A, and V-NVs / T+A with the same protein content prepared according to steps 2), 6), 7), and 8) of Example 1, respectively. V-NVs / T+A was treated with the addition of the calcium chelating agent BAPTA (molar ratio BAPTA:A23187 = 1:1). EVs were extracted using an EVs extraction kit to verify the role of A23187 in promoting EVs release. Figure 12 B).

[0107] like Figure 12As shown in Figure A, at an equivalent dose of 3 μM, A23187 significantly enhanced the release of EVs. The introduction of the calcium ion chelator BAPTA further supports the role of A23187 in EV release. Figure 12 As shown in B, V-NVs / T+A can significantly enhance the release of EVs.

[0108] To further investigate the mechanism by which A23187 promotes EV release, we used Ca... 2+ Sensitive probe Fura-2AM labeled Ca 2+ Ions, detecting Ca in 4T1 cells after the above treatment 2+ Changes in ion levels were measured using flow cytometry to quantify calcium ion levels, and the findings were validated using confocal laser scanning microscopy (CLSM) (see [link]). Figure 13 and 14 ).

[0109] like Figure 13 , 14 As shown, intracellular Ca2+ after A23187 treatment 2+ The level increases significantly, and A23187 in V-NVs / T+A can be improved by increasing Ca 2+ This enhances the release of EVs at higher levels, thereby promoting deeper intercellular communication.

[0110] Example 13: Verification of intercellular transport mechanisms

[0111] The intercellular transfer capability of NVs was verified using cell migration assays. First, 4T1 cells were seeded at an appropriate density in the upper and lower chambers of a transwell plate and cultured for 12 hours to ensure complete cell adhesion. Cells were treated with fluorescently labeled NVs / T, V-NVs / T, V-NVs / T+A, and V-NVs / T+A vesicles with the same protein content prepared in steps 2), 5), and 8) of Example 1 above, and with the addition of the calcium chelating agent BAPTA (molar ratio BAPTA:A23187 = 1:1) to V-NVs / T+A. Cells in the upper chamber were incubated for 2 hours. Subsequently, unbound or free NVs in the upper chamber were thoroughly washed away with PBS, and incubation continued for 48 hours to allow intercellular EV transfer.

[0112] Next, the cells in the lower chamber were digested, resuspended, and seeded into a new upper chamber, while new 4T1 cells were seeded into the lower chamber. Finally, confocal laser scanning microscopy (CLSM) was used to observe intercellular EV transport and assess the efficiency and distribution of EVs between cells.

[0113] like Figure 15As shown, the persistence of relevant fluorescence in the third layer of cells demonstrated the efficient intercellular transfer of TNF-a and VSVG of V-NVs / T+A. The group lacking VSVG and A23187 did not show intercellular transfer.

[0114] Next, the mechanism of intercellular transfer was verified. 4T1 cells were seeded in 12-well plates and incubated for 12 hours. Initially, the same amount of NVs / T, V-NVs / T, V-NVs / T+A and V-NVs / T+A with calcium chelator BAPTA (molar ratio BAPTA:A23187 = 1:1) were used to treat the cells, which were prepared as described in Example 1, step 2), step 6) and step 8) above. EVs and supernatants were extracted using EVs extraction kit, respectively. The fluorescence of EVs and supernatants was measured using a microplate reader. Next, the extracted EVs and supernatants were incubated with fresh cells, respectively, and further analyzed by flow cytometry and CLSM.

[0115] Figure 16 It was shown that the cells treated with V-NVs / T+A were significantly higher in TNF-a level than the cells treated with supernatant, indicating that the transfer of TNF-a was mainly mediated by EVs.

[0116] Example 14: Tumor spheroid penetration efficiency

[0117] To study the drug penetration and tumor inhibition effect of engineered NVs, a tumor spheroid model was established. Briefly, first, 1 x 10 4 4T1 cells were seeded in 1640 medium containing 0.24% methyl cellulose, and the mixture was distributed onto the lid of a round-bottom 96-well plate. The lid was placed in a cell culture incubator for 24 hours to facilitate cell attachment and spheroid formation. After incubation, 200 μl of complete medium was added to each well to provide the required nutrients and support. Then, the cell spheroids were centrifuged at 2800 rpm for 3 minutes to help the cell spheroids transfer from the lid to the bottom of the well.

[0118] During the following culturing process, the medium was changed every 48 hours to maintain a good cell growth environment. On the fourth day, the old medium was removed and the same protein amount of NVs / T, V-NVs / T, V-NVs / T+A and V-NVs / T+A prepared in Example 1, Step 2), Step 6) and Step 8) above were added with the calcium ion chelator BAPTA (molar ratio BAPTA:A23187 = 1:1) with fluorescent labeling. The incubation of the spheroids was continued for 72 hours to allow the NVs to interact with the cells sufficiently. After the incubation was completed, the medium was removed and the spheroids were rinsed thoroughly with PBS to remove the unbound NVs. Finally, the spheroids were observed using a confocal laser scanning microscope (CLSM) to evaluate the penetration of the engineered NVs inside the tumor spheroids.

[0119] Figure 17 It was shown that there were significant differences in the penetration of the engineered NVs in the core of the spheroids treated with different formulations. Among them, the engineered cell membrane vesicle group containing VSVG and A23187 showed the most efficient membrane fusion and penetration.

[0120] The same as the above preparation of tumor spheroids, after the fourth day, the old medium was removed and the same protein amount of NVs / T, V-NVs / T, V-NVs / T+A and V-NVs / T+A prepared in Example 1, Step 2), Step 6) and Step 8) above were added with the calcium ion chelator BAPTA (molar ratio BAPTA:A23187 = 1:1). The incubation of the spheroids was continued for 72 hours to allow the NVs to interact with the cells sufficiently. The spheroids were stained with Calcein-AM (4.5 mM) and PI (2 mM) for 30 minutes, and the live and dead cells inside the spheroids were observed using confocal imaging.

[0121] As shown in Figure 18 , V-NVs / T+A had the best penetration cytotoxicity on 4T1 tumor spheroids

[0122] The same as the above preparation of tumor spheroids, after the fourth day, the old medium was removed and the same protein amount of NVs / T, V-NVs / T, V-NVs / T+A and V-NVs / T+A prepared in Example 1, Step 2), Step 6) and Step 8) above were added with the calcium ion chelator BAPTA (molar ratio BAPTA:A23187 = 1:1). The incubation of the spheroids was continued for 72 hours to allow the NVs to interact with the cells sufficiently. The tumor spheroids were collected by centrifugation and the single cells were dissociated using five-fold diluted trypsin, followed by another round of centrifugation. 20 μL of MTT solution was added to each well and the cells were incubated at 37°C for 4 hours. After the incubation, the supernatant was removed by centrifugation and 200 μL of DMSO was added. After mixing, the absorbance at 490 nm was measured using a microplate reader to calculate the cell viability.

[0123] Figure 19 It is shown that V-NVs / T+A exhibits strong cytotoxicity, which is consistent with the cytotoxicity results observed in tumor spheroids using confocal microscopy.

[0124] Example 15: In vivo distribution and penetration experiments

[0125] 4T1 cells were injected subcutaneously into female BALB / c mice to establish a mouse model carrying 4T1 tumors. To evaluate the biodistribution of engineered cell membrane vesicles in real time, NVs / T+A and V-NVs / T+A prepared in Example 1, step 7) and step 8) were incubated with DiR for 1 hour to obtain DiR-NVs / T+A and DiR-V-NVs / T+A. When the 4T1 tumor volume grew to about 200 mm 3 , these labeled vesicles were injected into mice at an equivalent dose of 1 mg / kg DiR and 100 μg of NVs per mouse by intravenous injection.

[0126] At predetermined time points (2 hours, 4 hours, 8 hours, 12 hours, and 24 hours), the mice were anesthetized. Fluorescence imaging of the mice was performed using an IVIS imaging system to monitor the distribution of labeled extracellular vesicles in vivo. This process helps to understand the localization of engineered cell membrane vesicles in tumor tissue and their biodistribution characteristics.

[0127] The results, as shown in Figure 20 , show that V-NVs / T+A has the advantage of long accumulation time at the tumor site compared to the solution. The mice were sacrificed at 2, 12, and 12 hours after administration, and the main organs and tumors were collected for analysis using an IVIS imaging system. Figure 21 and Figure 22 show that the peak accumulation of V-NVs / T+A at the tumor site is significantly better than that of DiR solution, indicating excellent tumor accumulation ability

[0128] To verify the tumor penetration ability mediated by NVs, NVs / T and V-NVs / T and V-NVs / T+A prepared in Example 1, step 2), step 6), and step 8) were incubated with DiR for 1 hour to obtain DiR-NVs / T, DiR-V-NVs / T, and DiR-V-NVs / T+A. BALB / c mice carrying 4T1 tumors were injected with an equivalent dose of 100 μg of NVs by intravenous injection. Twenty-four hours after injection, the tumor tissue of the mice was removed and prepared into tissue sections for subsequent analysis.

[0129] Sections were stained with CD31 and DAPI to label tumor vessels, and the penetration of DiR-labeled vesicles into tumor tissue was observed using confocal laser scanning microscopy (CLSM). Quantitative analysis of the fluorescence images was performed using ImageJ software to assess the distribution and penetration ability of different types of NVs in tumor tissue. This experiment will help determine the actual performance of different types of engineered cell membrane vesicles in the tumor microenvironment. Figure 23 This indicates that V-NVs / T+A exhibited abundant DiR fluorescence in the deep regions of the tumor, consistent with our previous spherical experiments. In contrast, the tumor penetration depth of the remaining control groups was significantly less than that of V-NVs / T+A, suggesting that VSVG and A23187 enhanced the tumor penetration of EVs.

[0130] Example 16: Anti-tumor effect in a mouse lung metastasis model

[0131] To create a mouse tumor model, 4T1 cells (1×10⁻⁶) were used. 6 4T1-Luc cells (2 × 10⁶ cells / 100 μl) were injected orally into female BALB / c mice. Six days later, the mice were injected via the tail vein with 4T1-Luc cells (2 × 10⁶ cells / 100 μl). 5 (1 cell / 100 μl). Two days later, the tumor volume increased to 100 mm. 3 Mice were randomly divided into six experimental groups, with five mice in each group. The groups included: G1: control group (Saline) and mice prepared in each group in Example 1, G2: NVs / T, G3: V-NVs, G4: V-NVs / A, G5: V-NVs / T and G6: V-NVs / T+A.

[0132] During treatment, mice were administered 100 μg of an equivalent dose of NVs every three days. One day after each administration, mice were intraperitoneally injected with d-fluorescein solution (15 mg / mL). Bioluminescence was detected immediately 10 minutes later, and in vivo bioluminescence imaging analysis was used to assess cancer metastasis. After the final treatment, mice were euthanized, and their lungs were immediately harvested for in vitro bioluminescence imaging to assess cancer metastasis. The harvested lungs were incubated with d-fluorescein solution (15 mg / mL) for 10 minutes before imaging. Subsequently, the lung tissue was fixed in Bouin's solution, and lung and liver sections were stained with H&E to assess the efficacy of anti-metastatic therapy. Tumor size was recorded, and H&E staining was performed for further histological analysis. To assess the immune response in the anti-tumor model mice, tumors were minced, homogenized in enzyme buffer to form a single-cell suspension, stained with fluorescent antibodies, and analyzed by flow cytometry using FlowJo software. Lymph nodes were similarly processed, suspended in PBS, filtered, stained, and then analyzed for cell analysis.

[0133] Figure 24Results show that the lung fluorescence intensity of V-NVs / A and V-NVs / T groups decreased, indicating reduced metastatic growth, and V-NVs / T+A treatment further enhanced this effect, almost eliminating autofluorescence. Figure 26 In vivo, ex vivo autofluorescence imaging of excised lung tissue confirmed these findings. As shown in FIG. 6, the lung tissue of the V-NVs / T+A treated group showed significantly reduced autofluorescence compared to the other groups. Figure 25 Results show that after Bouin’s solution fixation, the normal lung area appeared tan, while the metastatic nodules appeared bright yellow, consistent with the bioluminescence data. Figure 30 and Figure 31 H&E staining of the liver and lung metastatic nodules after V-NVs / T+A treatment in vivo showed significantly reduced metastatic nodules, with minimal metastatic foci. Figure 27 and Figure 28 Results show that the V-NVs / T+A strategy not only inhibited tumor metastasis but also reduced tumor volume compared to saline. We further explored the link between the anti-metastatic effect and immune modulation, as shown in FIG. 7. Figure 29 Results show that CD86 signals were found to increase after treatment, indicating an increase in mature DCs, tumor-infiltrating CD8 + T cells, and Ml -like macrophages, confirming the activation of anti-tumor immunity.

[0134] Example 17: Anti-tumor effect in vivo in mice

[0135] To create a tumor model, 4T1 cells were injected orthotopically into female BALB / c mice. When the tumor volume grew to 100 mm 3 The mice were randomly divided into six experimental groups, each containing five mice. The groups included: G1 : control (saline) and the groups prepared in Example 1, G2: NVs / T, G3: V-NVs, G4: V-NVs / A, G5: V-NVs / T, and G6: V-NVs / T+A.

[0136] During the treatment period, the mice were dosed every two days with an equivalent dose of 100 pg of NVs. The entire treatment lasted for five cycles. During the treatment, the tumor volume and body weight of the mice were monitored daily to assess the treatment effect and observe possible side effects. By regularly recording and analyzing the data, the inhibitory effect of different treatment groups on tumor growth and their impact on the overall health of the mice were evaluated.

[0137] After the last treatment, blood was collected, and the mice were sacrificed to collect organ and tumor tissue. The tissues were fixed in 4% paraformaldehyde for subsequent H&E staining, TUNEL, and Ki67 analysis. As shown in FIG. 8, the results show that the V-NVs / T+A treated group had significantly reduced tumor volume and metastatic nodules compared to the other groups. Figure 32 and Figure 33As shown, the VSVG-free group showed poor anti-tumor effect due to the failure of membrane fusion. Notably, V-NVs / T+A loaded with VSVG, A23187 and TNF-a showed great potential in penetration and immune activation, exhibiting the best anti-tumor effect, with tumor inhibition rate exceeding 70%. Finally, the safety of V-NVs / T+A treatment was preliminarily explored. As shown in FIG. 9A and FIG. 9B, no liver and kidney function damage and other organ damage were caused in mice after the end of drug administration, indicating good safety during treatment. The levels of TNF-a, IFN-g, IL-6 immune factors in tumor tissues were determined, Figure 34 and Figure 36 as shown in FIG. 10A and FIG. 10B, the levels of TNF-a and IFN-g in the tumor tissues of mice in the V-NVs / T+A treatment group loaded with VSVG, A23187 and TNF-a were increased, and the level of IL-6 was decreased, thereby enhancing the immune response of mice. Figure 35

[0138] Example 18: Immunological detection

[0139] After collecting the tumor tissues, the tumors of the mice were cut into small pieces, and these small pieces were put into a staining buffer containing enzymes for homogenization to obtain a single cell suspension. Subsequently, the cells were stained with fluorescein-labeled antibodies to label specific cell populations. After staining, the labeled cells were analyzed using a flow cytometer, and the data were processed and analyzed using FlowJo software to evaluate the phenotype and distribution of the cells.

[0140] In addition, after extracting the lymph nodes from the mice, they were crushed, and the obtained cells were suspended in PBS. To remove cell clumps and debris, the cell suspension was filtered through a 70-μm mesh to prepare a single cell suspension. Then, the cells were stained with fluorescein-labeled antibodies. Finally, the stained cells were analyzed using a flow cytometer, and the data were processed using FlowJo software to obtain the distribution and characteristics of various cells in the lymph nodes. Figure 37 As shown in FIG. 11A and FIG. 11B, compared with other groups, the increase in CD86 signal after V-NVs / T+A treatment indicated that the number of mature dendritic cells (DCs) was significantly increased. The number of tumor-infiltrating CD8 + T cells (CD3 + CD8 + ) increased by 2.04 times after V-NVs / T+A treatment, while the number of immunosuppressive regulatory T cells (Tregs, CD4 + Foxp3 + ​The number of CD8+CD44+CD62L- T cells in the V-NVs / T+A group was reduced by 0.54 times compared with the control group, indicating that V-NVs / T+A triggered a strong T cell-mediated immune response. Similar synergistic effects were observed in macrophages, further confirming the activation of anti-tumor immunity.

[0141] All the above results show that the engineered cell membrane vesicles of the application are used for cascade tumor deep penetration and TNF-alpha cytokine treatment to enhance tumor immunotherapy. The prepared engineered cell membrane vesicles can mediate membrane fusion at acidic pH, improve the efficiency of extracellular vesicle hitchhiking penetration into tumors, and enhance the immune response of cancer.

[0142] The above examples only express several embodiments of the application, and the description is more specific and detailed, but it cannot be understood as limiting the scope of the patent application. It should be noted that for ordinary skilled persons in the art, several modifications and improvements can be made without departing from the concept of the application, which are all within the protection scope of the application. Therefore, the protection scope of the patent of the application should be subject to the appended claims.

Claims

1. An engineered cell membrane vesicle that triggers extracellular vesicle cascade permeation, characterized in that, Engineered cell membrane vesicles are cell membrane vesicles (NVs) with surface-modified membrane fusion promoters and extracellular vesicle secretion-promoting compounds, and the vesicles contain drugs. The membrane fusion promoter is the surface glycoprotein VSVG of vesicular stomatitis virus, the extracellular vesicle secretion-promoting compound is the calcium ion carrier A23187, and the drug is the TNF-α-Lamp2b plasmid; wherein, the mass ratio of protein in cell membrane vesicles to TNF-α-Lamp2b is 2:1, and the mass ratio of protein in cell membrane vesicles to A23187 is 2:

1. The TNF-α-Lamp2b plasmid is generated by fusing the TNF-α protein sequence with the Lamp2b protein sequence.

2. A method for constructing engineered cell membrane vesicles that trigger extracellular vesicle cascade permeation as described in claim 1, characterized in that, Cells were cultured with transfection reagent and VSVG plasmid. After culture, the cells were sonicated and centrifuged to obtain cell membrane vesicles (V-NVs) carrying membrane fusion promoters. V-NVs were mixed with TNF-α-Lamp2b plasmid in a certain proportion for electroporation and then incubated. After incubation, A23187 was added for further incubation to obtain engineered cell membrane vesicles.

3. The method for constructing engineered cell membrane vesicles that trigger extracellular vesicle cascade permeation according to claim 2, characterized in that, The cell membrane vesicles (V-NVs) carrying the membrane fusion promoter were obtained by adding transfection reagent and VSVG plasmid to cells after 12 hours of culture and mixing thoroughly; then the cells were cultured in Opti-MEM medium for 48 hours, and after culture, the cells were resuspended in PBS, then broken up, centrifuged, filtered and collected to collect the cell membrane vesicles carrying VSVG.

4. The method for constructing engineered cell membrane vesicles that trigger extracellular vesicle cascade permeation according to claim 3, characterized in that, The collected cells were resuspended, lysed, and centrifuged to collect the final precipitate. The precipitate was then filtered through a 0.22 μm filter to collect cell membrane vesicles carrying VSVG. The centrifugation conditions were 10 minutes at 2000 rpm, 10 minutes at 5000 rpm, and 60 minutes at 15000 rpm. The supernatant was collected after the first two centrifugations, and the precipitate was discarded. After the last centrifugation, the precipitate was collected and resuspended in PBS.

5. The method for constructing engineered cell membrane vesicles according to claim 2, characterized in that, V-NVs and TNF-α-Lamp2b plasmids were mixed in a 4°C electrophoresis tank and electroporated using an electroporator at 400 V, 25 μF capacitor and 50 Ω resistor with a pulse duration of 10-15 ms. The mixture was then incubated at 37°C for 30 minutes. After incubation, A23187 was added in a specific ratio, and the mixture was incubated at 37°C for another 30 minutes to obtain engineered cell membrane vesicles.

6. The use of the engineered cell membrane vesicles of claim 1 in the preparation of antitumor drugs.

7. The application according to claim 6, characterized in that: The medication is administered via injection or topical application.