Precursor sequence for preparing circular RNA, RNA cyclization method, circular RNA and application

Abstract

The invention belongs to the technical field of molecular biology, and discloses a precursor sequence for preparing circular RNA, an RNA cyclization method, circular RNA and application. The precursor sequence provided by the invention sequentially comprises a 3 '-intron, a to-be-cyclized sequence and a 5'-intron along the direction from 5'to 3 ', and the to-be-cyclized sequence sequentially comprises an IRES sequence and a coding sequence along the direction from 5' to 3 '; the nucleotide sequence of the 3 '-intron is as shown in SEQ ID NO: 1, and the nucleotide sequence of the 5'-intron is as shown in SEQ ID NO: 4. The precursor sequence provided by the invention has excellent cyclization efficiency, and no or only a very small amount of exogenous nucleotide is left in the cyclic RNA obtained by cyclization, so that the cyclic RNA has a good application prospect.

Description

Technical Field

[0001] The invention belongs to the field of molecular biotechnology, and in particular relates to a precursor sequence for preparing circular RNA, an RNA cyclization method, circular RNA and applications. Background Art

[0002] Type I intron is a ribozyme with self-splicing catalytic activity. The self-splicing reaction catalyzed by type I intron utilizes two consecutive steps of phosphate bond transfer reaction to cut itself from the transcription product and simultaneously complete the splicing of the exons on both sides. Among them, the PIE strategy is a method for synthesizing circular RNA in vitro by utilizing the self-cleavage catalytic activity of type I introns. The type I intron is split into 3'-introns and 5'-introns that still have catalytic activity based on the structural domain of the catalytic reaction, and the resulting 3'-introns and 5'-introns are assembled with the sequence to be circularized (including coding sequences for protein or RNA synthesis and optional non-coding sequences with special functions such as Kozak sequences and IRES sequences), and in order to improve the circularization efficiency, additional exon fragments adjacent to both ends of the type I intron are introduced, and finally a precursor sequence with a structure of 3'-intron-E2-sequence to be circularized-E1-5'-intron is obtained. After the precursor sequence undergoes in vitro transcription and in vitro circularization reactions, the 3'-intron and 5'-intron are cut out, and the exon fragments located at both ends of the sequence to be circularized are spliced ​​to achieve the circularization of the sequence to be circularized.

[0003] However, the circular RNA obtained by the existing PIE strategy has residual exogenous nucleotide sequences, which may change the folding conformation of the circular RNA, or pair with other circular RNAs or residual precursor sequences to form a more complex complex. This may lead to unexpected cellular immune responses, and may affect the stability and translation efficiency of RNA, resulting in reduced expression of the target protein, limiting the further application of the PIE strategy and the circular RNA obtained.

[0004] Therefore, it is of great significance to obtain a precursor sequence that has no or only a very small amount of exogenous nucleotides remaining after cyclization and has excellent cyclization efficiency. Summary of the invention

[0005] The first purpose of the present invention is to provide a precursor sequence for preparing circular RNA. The precursor sequence provided by the present invention has excellent cyclization efficiency, and no or only a very small amount of exogenous nucleotides remain in the circular RNA obtained by cyclization, and has good application prospects.

[0006] The second object of the present invention is to provide a method for RNA cyclization.

[0007] The third object of the present invention is to provide a circular RNA.

[0008] The fourth object of the present invention is to provide the above-mentioned precursor sequence for preparing circular RNA, RNA cyclization method and / or use of circular RNA in preparing drugs, vaccines and / or cells with high expression of target genes.

[0009] Specifically, the precursor sequence for preparing circular RNA provided by the present invention includes, in sequence from 5' to 3', a 3'-intron, a sequence to be cyclized and a 5'-intron; the sequence to be cyclized includes, in sequence from 5' to 3', an IRES sequence and a coding sequence; and the nucleotide sequence of the 3'-intron is as shown in SEQ ID NO: 1, and the nucleotide sequence of the 5'-intron is as shown in SEQ ID NO: 4.

[0010] Furthermore, the precursor sequence includes, in order from 5' to 3' direction: a cyclization-promoting sequence, a 3'-intron, a sequence to be cyclized and a 5'-intron, and the cyclization-promoting sequence is positively complementary to a partial sequence of the sequence to be cyclized near the 3' end.

[0011] Furthermore, the precursor sequence includes, in order from 5' to 3', a 3'-intron, a sequence to be cyclized, a 5'-intron and a cyclization-promoting sequence, and the cyclization-promoting sequence is positively complementary to a partial sequence of the sequence to be cyclized near the 5' end.

[0012] Furthermore, the precursor sequence includes, in order from 5' to 3' direction: a cyclization-promoting sequence I, a 3'-intron, a sequence to be cyclized, a 5'-intron and a cyclization-promoting sequence II, and the cyclization-promoting sequence I is positively complementary to a partial sequence of the sequence to be cyclized near the 3' end, and the cyclization-promoting sequence II is positively complementary to a partial sequence of the sequence to be cyclized near the 5' end.

[0013] Furthermore, the IRES sequence is selected from one or more of a CVB3 IRES sequence, an EV71 IRES sequence and an EMCV IRES sequence.

[0014] The RNA cyclization method provided by the present invention comprises: taking the above-mentioned precursor sequence to perform an in vitro transcription reaction to obtain an in vitro transcription product; taking the in vitro transcription product to perform an in vitro cyclization reaction to obtain a circular RNA.

[0015] Furthermore, the in vitro cyclization reaction includes: the in vitro cyclization reaction includes: taking the in vitro transcription product and incubating it at 25-60° C. for 15-60 minutes to obtain the circular RNA.

[0016] Furthermore, the in vitro cyclization reaction includes: taking the in vitro transcription product and subjecting it to heat denaturation pretreatment at 60-70° C. for 5-20 min, and then incubating it at 25-60° C. for 15-60 min to obtain the circular RNA.

[0017] The circular RNA provided by the present invention is prepared by the above-mentioned RNA cyclization method.

[0018] The present invention also provides the above-mentioned precursor sequence for preparing circular RNA, RNA cyclization method and / or use of circular RNA in preparing drugs, vaccines and / or cells that highly express target genes. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 A schematic diagram of the structure and cyclization process of the precursor sequence for preparing circular RNA provided in Example 2 of the present invention;

[0020] Figure 2 A schematic diagram of the structure and cyclization process of the precursor sequence for preparing circular RNA provided in Example 3 of the present invention;

[0021] Figure 3 A schematic diagram of the structure and cyclization process of the precursor sequence for preparing circular RNA provided in Example 4 of the present invention;

[0022] Figure 4 The experimental result diagram of the precursor efficiency cyclization efficiency test provided by the test example of the present invention;

[0023] Figure 5 This is a graph showing the experimental results of the effect of the pretreatment conditions provided in Example 5 of the present invention on the cyclization efficiency of the precursor sequence;

[0024] Figure 6 This is a graph showing the experimental results of the effect of the amount of in vitro transcription product added on the precursor sequence cyclization efficiency provided in Example 6 of the present invention. DETAILED DESCRIPTION

[0025] The present invention provides a precursor sequence for preparing circular RNA, which includes: a 3'-intron, a sequence to be cyclized and a 5'-intron in sequence along the direction from 5' to 3'. The 3'-intron and the 5'-intron are obtained by creatively breaking and further transforming the inventors of the present invention based on their profound understanding of the structure of the type I intron of the CoB gene of Fusarium oxysporum and the changes in its spatial structure during the self-splicing catalytic reaction. The nucleotide sequence of the 3'-intron is specifically shown in SEQ ID NO: 1, and the nucleotide sequence of the 5'-intron is specifically shown in SEQ ID NO: 4.

[0026] In the present invention, the sequence to be cyclized includes an IRES sequence and a coding sequence in sequence from 5' to 3'. At this time, the arrangement order of the IRES sequence and the coding sequence in the sequence to be cyclized enables the precursor sequence to fold into a relatively ideal three-dimensional structure, which is conducive to improving the catalytic activity of the 3'-intron and the 5'-intron, thereby effectively improving the cyclization efficiency of the precursor sequence.

[0027] Based on the above-mentioned precursor sequence, the inventors conducted further in-depth research and found that by introducing a sequence that is positively complementary to the sequence to be cyclized into the precursor sequence, the 3'-intron and 5'-intron in the precursor sequence can be brought close to each other without the induction of external factors through the specific recognition and binding effect of the sequence with the sequence to be cyclized, and interact with each other to cause conformational changes in the corresponding domains, which is beneficial to the activation of the reaction site of the phosphate transfer reaction, promotes the phosphate transfer reaction, and can effectively reduce the reaction activation energy of the self-splicing reaction catalyzed by the type I intron, ultimately achieving the effect of improving the cyclization efficiency of the precursor sequence.

[0028] In the present invention, the precursor sequence structure preferably also includes a cyclization-promoting sequence, which is connected to the 5' end of the 3'-intron and / or the 3' end of the 5'-intron; the cyclization-promoting sequence is positively complementary to the sequence to be cyclized, so that the 3'-intron and the 5'-intron are close to each other. At this time, the cyclization-promoting sequence is complementary to the internal bases of the sequence to be cyclized, which can greatly shorten the spatial distance between the P9 domain in the 3'-intron and the P1 domain in the 5'-intron, forming a compact and orderly spatial conformation, and effectively promoting the cyclization of the precursor sequence.

[0029] In the present invention, the forward complementary pairing refers to the base complementary pairing between the cyclization-promoting sequence and the sequence to be cyclized along the same extension direction (such as 5' to 3'); at this time, the base complementary pairing method adopted makes the precursor sequence form a spiral loop, thereby achieving the proximity of the 3'-intron and the 5'-intron.

[0030] In the present invention, there is no particular limitation on the degree of complementary pairing between the cyclization-promoting sequence and the sequence to be cyclized, that is, the cyclization-promoting sequence may be positively complementary to part or all of the sequence to be cyclized.

[0031] In the present invention, the cyclization-promoting sequence is preferably positively complementary to a portion of the sequence to be cyclized, and the position of the portion of the sequence to be cyclized that is positively complementary to the cyclization-promoting sequence is adaptively adjusted according to the position of the cyclization-promoting sequence in the precursor sequence, so that the precursor sequence can be limited to a helical ring.

[0032] In some specific embodiments, the cyclization-promoting sequence may be connected to the 5' end of the 3'-intron; that is, the precursor sequence includes, in order from 5' to 3', the cyclization-promoting sequence, the 3'-intron, the sequence to be cyclized, and the 5'-intron. In some preferred embodiments, the cyclization-promoting sequence is preferably positively complementary to the partial sequence of the sequence to be cyclized close to the 3' end, so that the 3'-intron and the 5'-intron can be sufficiently close, which can further improve the cyclization efficiency of the precursor sequence.

[0033] In some specific embodiments, the cyclization-promoting sequence may be connected to the 3' end of the 5'-intron; that is, the precursor sequence includes, in order from 5' to 3', the 3'-intron, the sequence to be cyclized, the 5'-intron and the cyclization-promoting sequence. In some preferred embodiments, the cyclization-promoting sequence is preferably positively complementary to the partial sequence of the sequence to be cyclized close to the 5' end, so that the 3'-intron and the 5'-intron can be sufficiently close, which can further improve the cyclization efficiency of the precursor sequence.

[0034] In some specific embodiments, the precursor sequence includes two sections of cyclization-promoting sequences, and the cyclization-promoting sequences are respectively connected to the 5' end of the 3'-intron and the 3' end of the 5'-intron; that is, the precursor sequence includes: cyclization-promoting sequence I, 3'-intron, sequence to be cyclized, 5'-intron and cyclization-promoting sequence II in order along the 5' to 3' direction. In some preferred embodiments, the cyclization-promoting sequence I is preferably paired with a partial sequence of the sequence to be cyclized close to the 3' end in a positive complementary manner, and the cyclization-promoting sequence II is preferably paired with a partial sequence of the sequence to be cyclized close to the 5' end in a positive complementary manner, so that the 3'-intron and the 5'-intron can be sufficiently close to each other, which can further improve the cyclization efficiency of the precursor sequence.

[0035] In the present invention, "I" and "II" in the cyclization-promoting sequence I and the cyclization-promoting sequence II are only used for distinction to facilitate description and have no other special meaning.

[0036] In the present invention, specific examples of the IRES sequence include but are not limited to: one or more of the CVB3 IRES sequence, the EV71 IRES sequence and the EMCV IRES sequence. The CVB3 IRES sequence refers to the IRES sequence derived from Coxsackievirus B3 (CVB3); the EV71 IRES sequence refers to the IRES sequence derived from enterovirus 71 (EV71); and the EMCV IRES sequence refers to the IRES sequence derived from encephalomyocarditis virus (EMCV).

[0037] In some specific embodiments, the IRES sequence is preferably a CVB3 IRES sequence, the 5' end of the CVB3 IRES sequence is connected to the 3' end of the 3'-intron, the cyclization-promoting sequence is connected to the 5' end of the 3'-intron, and the cyclization-promoting sequence is positively complementary to the partial sequence of the coding sequence near the 3' end. At this time, the three-dimensional structure formed by the folding of the CVB3 IRES sequence is conducive to improving the catalytic activity of the 3'-intron and the 5'-intron, and the cyclization efficiency of the precursor sequence is effectively improved through the mutual cooperation between the two.

[0038] In the present invention, the sequence to be cyclized refers to the sequence retained in the circular RNA after cyclization. Those skilled in the art can design the specific fragments in the precursor sequence based on the scheme disclosed in the present invention. It can also include a non-coding sequence with a gene expression regulation function. Specific examples of the non-coding sequence include but are not limited to: one or more of a T7 promoter, a UTR sequence and a transcription factor binding site.

[0039] Based on the excellent circularization efficiency of the above precursor sequence, the present invention further provides an RNA circularization method. The RNA circularization method specifically comprises: taking the above precursor sequence for in vitro transcription reaction to obtain an in vitro transcription product; taking the in vitro transcription product for in vitro circularization reaction to obtain circular RNA.

[0040] In the present invention, the in vitro transcription reaction refers to the process of converting a DNA template into RNA in vitro (i.e., in an environment outside the organism). Those skilled in the art can make adaptive choices from the reagents and conditions disclosed in the prior art as needed, or directly use a commercial in vitro transcription kit to conduct experiments. The present invention does not particularly limit the specific steps, reagents and conditions of the in vitro transcription reaction.

[0041] In the present invention, the in vitro cyclization reaction refers to the process of RNA cyclizing in vitro (i.e., in an environment outside the organism) to form circular RNA. Those skilled in the art can make adaptive choices from the reagents and conditions disclosed in the prior art as needed, or directly use a commercial in vitro cyclization kit to conduct experiments. The present invention does not particularly limit the specific steps, reagents and conditions of the in vitro cyclization reaction.

[0042] In some specific embodiments, the in vitro cyclization reaction preferably includes: incubating the in vitro transcription product at 25-60° C. for 15-60 min to obtain the circular RNA.

[0043] In other specific embodiments, the in vitro cyclization reaction preferably includes: subjecting the in vitro transcription product to heat denaturation pretreatment at 60-70° C. for 5-20 min, followed by incubation at 25-60° C. for 15-60 min to obtain the circular RNA.

[0044] In some specific embodiments, the added concentration of the in vitro transcription product in the in vitro cyclization reaction is preferably 0.01-0.5 μg / μL, such as 0.01 μg / μL, 0.1 μg / μL, 0.15 μg / μL, 0.2 μg / μL, 0.3 μg / μL, 0.45 μg / μL, 0.5 μg / μL or any value therebetween.

[0045] The present invention also provides a circular RNA, which is prepared by the above-mentioned RNA cyclization method.

[0046] The present invention also provides the above-mentioned precursor sequence for preparing circular RNA, RNA cyclization method and / or use of circular RNA in preparing drugs, vaccines and / or cells that highly express target genes.

[0047] Embodiments of the present invention are described in detail below, and the examples of the embodiments are intended to be used to explain the present invention, but should not be construed as limiting the present invention. In the embodiments, if specific techniques or conditions are not specified, the techniques or conditions described in the literature in this area or the product specifications are used. If the manufacturer is not specified for reagents or instruments used, they are all conventional products that can be obtained commercially.

[0048] After the precursor sequences involved in the following examples were designed, they were commissioned to be synthesized by a chemical synthesis company.

[0049] Example 1

[0050] This example is used to illustrate a precursor fragment for RNA cyclization, which includes a 3'-intron, a CVB3 IRES sequence, a GFP sequence and a 5'-intron sequentially connected from 5' to 3'. The specific nucleotide sequence of each fragment is shown in Table 1.

[0051] Table 1.

[0052]

[0053]

[0054] Example 2

[0055] This example is used to illustrate a precursor sequence for preparing circular RNA. Figure 1The precursor sequence is based on the precursor sequence provided in Example 1, and a cyclization-promoting sequence 1 is introduced at the 3' end of the 5'-intron. The precursor sequence specifically includes a 3'-intron, a CVB3IRES sequence, a GFP sequence, a 5'-intron 1 and a cyclization-promoting sequence 1 sequentially connected along the 5' to 3' direction.

[0056] Among them, the cyclization-promoting sequence 1 is positively complementary to the partial sequence of the CVB3 IRES sequence near the 5' end, and its nucleotide sequence information is shown in Table 2.

[0057] Table 2.

[0058] name SEQ ID NO: Nucleotide sequence Cyclization-promoting sequence 1 5 GTGGGATCAACCCACAGGCTGTTTTAA

[0059] Example 3

[0060] This example is used to illustrate a precursor sequence for preparing circular RNA. Figure 2 The precursor sequence is based on the precursor sequence provided in Example 1, and a cyclization-promoting sequence 2 is introduced at the 5' end of the 3'-intron. The precursor sequence specifically includes a cyclization-promoting sequence 2, a 3'-intron, a CVB3 IRES sequence, a GFP sequence and a 5'-intron sequentially connected along the 5' to 3' direction.

[0061] The cyclization-promoting sequence 2 is positively complementary to a partial sequence of the GFP sequence near the 3' end, and its nucleotide sequence information is shown in Table 3.

[0062] Table 3.

[0063] name SEQ ID NO: Nucleotide sequence Cyclization-promoting sequence 2 6 TTATCATCGAGCTCGAGATCTGGCGAAGG

[0064] Example 4

[0065] This example is used to illustrate a precursor sequence for preparing circular RNA. Figure 3 The precursor sequence is based on the precursor sequence provided in Example 1, and while introducing the cyclization-promoting sequence 1 at the 3' end of the 5'-intron, the cyclization-promoting sequence 2 is also introduced at the 5' end of the 3'-intron. The precursor sequence specifically includes the cyclization-promoting sequence 2, the 3'-intron 1, the CVB3 IRES sequence, the GFP sequence, the 5'-intron 1 and the cyclization-promoting sequence 1 sequentially connected along the 5' to 3' direction.

[0066] The nucleotide sequence information of the cyclization-promoting sequence 1 is specifically shown in Table 2, and the nucleotide sequence information of the cyclization-promoting sequence 2 is specifically shown in Table 3.

[0067] Comparative Example

[0068] The RNA cyclization precursor fragment provided in this comparative example includes a 3'-intron, a GFP sequence, a CVB3 IRES sequence and a 5'-intron sequentially connected along the 5' to 3' direction. The specific nucleotide sequence of each fragment is shown in Table 1.

[0069] Test Case

[0070] This test example is used to illustrate the cyclization efficiency of the precursor sequences provided in the above embodiments and comparative examples. The test specifically includes:

[0071] (1) In vitro transcription reaction: The above precursor sequences were subjected to in vitro transcription reaction using T7 High-Efficiency RNA Synthesis Kit (NEB, catalog number E2040S) according to the instructions, and purified using 3M LiCl solution to obtain in vitro transcription products.

[0072] (2) In vitro cyclization reaction: The in vitro transcription product was added to a cyclization buffer (including 20 mM Tris-HCl, 2 mM MgCl2, and 25 mM NaCl) at a final concentration of 50 nM, and incubated at 50°C for 15 min. MgCl2 was added to a solution with a concentration of 10 mM, and GTP was added to a solution with a concentration of 0.2 mM. The in vitro cyclization reaction was carried out at 32°C for 15 min, and the cyclized product was obtained after purification using an RNA purification kit (NEB, catalog number T2040L) according to the instructions.

[0073] (3) The obtained in vitro transcription products and cyclization products were subjected to 4% urea-PAGE gel electrophoresis, and the amount of sample added and the conditions during the electrophoresis were the same. The cyclization efficiency (%) of the precursor sequence provided in each embodiment and comparative example in the in vitro transcription reaction and in vitro cyclization reaction was calculated according to the following formula. The results are shown in Figure 4 And as shown in Table 4.

[0074] Cyclization efficiency (%) = X1 / X2×100%

[0075] Wherein, X1 is the band intensity of the cyclization product in the gel electrophoresis diagram; X2 is the band intensity of the in vitro transcription product in the gel electrophoresis diagram.

[0076] Table 4.

[0077]

[0078]

[0079] Depend on Figure 4As shown in the test results in Table 4, compared with the comparative example, the precursor sequences provided in Examples 1 to 4 of the present invention have good cyclization effects, and the in vitro cyclization efficiency is more than 24.1%, and the highest can reach 39.3%, which has a relatively excellent cyclization efficiency.

[0080] Example 5

[0081] This example is used to illustrate the effect of the induction conditions before in vitro cyclization on the in vitro cyclization efficiency of the precursor sequence provided in Example 3, specifically including:

[0082] (1) In vitro transcription reaction: The precursor sequences provided in Example 2 were subjected to in vitro transcription reaction using T7 High-Efficiency RNA Synthesis Kit (NEB, catalog number E2040S) and according to the instructions, and purified using 3M LiCl solution to obtain in vitro transcription products.

[0083] (2) In vitro cyclization reaction: 1 μg of the in vitro transcription product was added to 10 μL of cyclization buffer (comprising 20 mM Tris-HCl, 2 mM MgCl2 and 25 mM NaCl), and treated according to the treatment method shown in Table 4; then, urea-PAGE electrophoresis analysis was performed.

[0084] The cyclization efficiency under each induction condition was calculated according to the method provided in the test example. Figure 5 And as shown in Table 5.

[0085] Table 5.

[0086]

[0087]

[0088] Depend on Figure 5 From the test results shown in Table 5, it can be seen that compared with treatment group 1, the addition of DTT as an inducing agent in treatment group 2 did not improve the cyclization efficiency; while the addition of PEG8000 as an inducing agent in treatment groups 3 and 4, when the concentration was 10%, could improve the cyclization efficiency to a certain extent, but the intensity of the circular RNA band was reduced at the same time, and the addition of a high concentration (20%) of PEG8000 would inhibit the in vitro cyclization reaction.

[0089] Comparison of the results of treatment groups 1 and 5 to 13 shows that, compared with pretreatment at multiple temperatures such as 50°C and 32°C, 55°C as the temperature for in vitro cyclization reaction can significantly improve the cyclization efficiency. The treatment steps of pretreatment with heat denaturation at 65°C and ice bath cooling, followed by addition of GTP and MgCl2, and finally incubation at 50°C or 32°C can also significantly improve the cyclization efficiency.

[0090] Example 6

[0091] This example is used to illustrate the effect of the amount of the precursor sequence provided in Example 2 on its in vitro cyclization efficiency during in vitro cyclization, specifically including:

[0092] (1) In vitro transcription reaction: The precursor sequences provided in Example 2 were subjected to in vitro transcription reaction using T7 High-Efficiency RNA Synthesis Kit (NEB, catalog number E2040S) and according to the instructions, and purified using 3M LiCl solution to obtain in vitro transcription products.

[0093] (2) In vitro cyclization reaction: The in vitro transcription product was added in the amount described in Table 7 to 10 μL of cyclization buffer (comprising 20 mM Tris-HCl, 2 mM MgCl2 and 25 mM NaCl), and incubated at 65°C for 10 min to induce cyclization pretreatment; then MgCl2 was added to the solution until the concentration of MgCl2 was 4 mM, and GTP was added to the solution until the concentration of GTP was 0.8 mM, and the in vitro cyclization reaction was carried out at 55°C for 15 min, followed by urea-PAGE electrophoresis analysis.

[0094] (3) Calculate the cyclization efficiency under each induction condition according to the method provided in the test example. The test results are as follows Figure 6 As shown and shown in Table 6.

[0095] Table 6.

[0096] Group Amount of in vitro transcription product added (μg / μL) Cyclization efficiency (%) In vitro transcription reaction - 34.9 Treatment Group 1 0.05 61.2 Treatment Group 2 0.1 58.9 Treatment Group 3 0.15 68.8 Treatment Group 4 0.2 61.5 Treatment Group 5 0.3 43.4 Treatment Group 6 0.45 51.7

[0097] Depend on Figure 6 As shown in the test results in Table 6, the amount of the in vitro transcription product added to the reaction object in the in vitro cyclization has an effect on the cyclization efficiency. When the amount added is 0.05-0.15 μg / μL, the cyclization efficiency increases with the increase in the amount of the in vitro transcription product added, and when the amount added is greater than 0.15 μg / μL, the cyclization efficiency decreases. When the amount of the in vitro transcription product added to the reaction object in the in vitro cyclization is 0.15 μg / μL, it has a relatively ideal cyclization efficiency.

[0098] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention without departing from the principles and intent of the present invention.

Claims

1. A precursor sequence for preparing circular RNA, the precursor sequence comprising, in order from 5' to 3', A 3'-intron, a sequence to be cyclized and a 5'-intron, characterized in that the sequence to be cyclized includes an IRES sequence and a coding sequence in sequence along the 5' to 3' direction; and the nucleotide sequence of the 3'-intron is shown in SEQ ID NO: 1, and the nucleotide sequence of the 5'-intron is shown in SEQ ID NO:

4.

2. The precursor sequence for preparing circular RNA according to claim 1, characterized in that The precursor sequence also includes a cyclization-promoting sequence, which is connected to the 5' end of the 3'-intron and / or the 3' end of the 5'-intron; the cyclization-promoting sequence and the sequence to be cyclized are positively complementary and paired to drive the 3'-intron and the 5'-intron to approach each other.

3. The precursor sequence for preparing circular RNA according to claim 2, characterized in that The precursor sequence includes: a cyclization-promoting sequence, a 3'-intron, a sequence to be cyclized and a 5'-intron in order from the 5' to 3' direction, and the cyclization-promoting sequence is positively complementary to a partial sequence of the sequence to be cyclized near the 3' end.

4. The precursor sequence for preparing circular RNA according to claim 2, characterized in that The precursor sequence includes: 3'-intron, sequence to be cyclized, 5'-intron and cyclization-promoting sequence in order from 5' to 3' direction, and the cyclization-promoting sequence is positively complementary to the partial sequence of the sequence to be cyclized near the 5' end.

5. The precursor sequence for preparing circular RNA according to claim 2, characterized in that The precursor sequence includes, in order from 5' to 3' direction: a cyclization-promoting sequence I, a 3'-intron, a sequence to be cyclized, a 5'-intron and a cyclization-promoting sequence II, and the cyclization-promoting sequence I is positively complementary to a partial sequence of the sequence to be cyclized close to the 3' end, and the cyclization-promoting sequence II is positively complementary to a partial sequence of the sequence to be cyclized close to the 5' end.

6. The precursor sequence for preparing circular RNA according to claim 1, characterized in that The IRES sequence is selected from one or more of a CVB3 IRES sequence, an EV71 IRES sequence and an EMCV IRES sequence.

7. A method for RNA cyclization, characterized in that: The RNA cyclization method comprises: performing an in vitro transcription reaction on the precursor sequence according to any one of claims 1 to 6 to obtain an in vitro transcription product; and performing an in vitro cyclization reaction on the in vitro transcription product to obtain a circular RNA.

8. The RNA cyclization method according to claim 7, characterized in that The in vitro cyclization reaction comprises: taking the in vitro transcription product and incubating it at 25-60° C. for 15-60 minutes to obtain the circular RNA; Optionally, the in vitro cyclization reaction comprises: taking the in vitro transcription product and subjecting it to heat denaturation pretreatment at 60-70° C. for 5-20 min, followed by incubation at 25-60° C. for 15-60 min to obtain the circular RNA; Optionally, the concentration of the in vitro transcription product added in the in vitro cyclization reaction is 0.01-0.5 μg / μL.

9. A circular RNA, characterized in that The circular RNA is prepared by the RNA cyclization method according to claim 7 or 8.

10. Use of the precursor sequence for preparing circular RNA according to any one of claims 1 to 6, the RNA cyclization method according to claim 7 or 8, and / or the circular RNA according to claim 9 in preparing drugs, vaccines and / or cells that highly express target genes.

Images