Application of PdAKR2A gene in improving photosynthetic rate and biomass of poplar

Abstract

The present invention discloses the application of the PdAKR2A gene in improving the photosynthetic rate and biomass of poplar, belonging to the technical field of poplar genetic engineering breeding. The present invention for the first time discloses that overexpression of the PdAKR2A gene can significantly increase the number of cambium cell layers and the width of xylem in poplar, thereby increasing the plant height and ground diameter of poplar, and thus improving the growth rate and biological yield of poplar; it can significantly increase the net photosynthetic rate, stomatal conductance, transpiration rate and chlorophyll content of poplar; it can significantly increase the lignin and cellulose contents of poplar; the provided PdAKR2A gene can be used as a candidate gene for cultivating new poplar varieties with faster growth rate and better quality, which is of great significance for promoting the sustainable development of forestry in China and alleviating the supply-demand tension in the wood market.

Description

Technical Field

[0001] The invention relates to the technical field of poplar genetic engineering breeding, in particular to the application of PdAKR2A gene in improving photosynthetic rate and biomass of poplar. Background Art

[0002] Wood is an important renewable resource with good strength, durability, plasticity and aesthetics. It plays an important role in our industrial production and life and has a wide range of uses. It not only occupies an important position in construction and furniture manufacturing, but is also an important raw material for making pulp, paper and liquid ethanol fuel. It can also be made into a variety of handicrafts and decorations to increase comfort and aesthetics. my country is the world's largest importer of wood and is highly dependent on imports. Although the transition of my country's forestry from traditional wood production to modern diversified forestry has alleviated the tension in the wood market to a certain extent, the market demand for high-quality wood is still huge. Therefore, it is still of great strategic significance for China to cultivate high-quality forest varieties of fast-growing and high-yield forests in a targeted manner and build high-quality artificial forests on a large scale to increase the output of high-quality wood.

[0003] Poplar is one of the main tree species in my country's artificial forests. It is also a fast-growing and high-yield tree species widely planted around the world. It has the following remarkable characteristics: 1) Short growth cycle. Poplar is one of the fast-growing tree species. It can reach a large height and diameter in a relatively short period of time, which is suitable for rapid greening and timber needs. 2) Strong adaptability and easy planting. Poplar is cold-resistant, drought-resistant, and salt-alkali-resistant. It can grow under a variety of soil conditions and has a strong ability to adapt to the environment. 3) High yield. Adult poplars can grow to more than 20 meters. In addition, poplars have straight trunks, broad crowns, and beautiful shapes. They are excellent street trees and afforestation tree species. Therefore, cultivating excellent poplar varieties and optimizing the quality of poplar wood have great research value and application prospects for promoting the sustainable development of my country's forestry industry and alleviating the tension between supply and demand in the timber market.

[0004] "84K Poplar" is a hybrid offspring of Populus alba and Populus glandularis. It is a hybrid clone of the white poplar faction bred in South Korea. It was introduced from South Korea by the Chinese Academy of Forestry in 1984. After its introduction, it has been introduced and tested in the three northern regions including the northwest for 14 years and has performed well. The promotion of the environmentally friendly white poplar faction male clone 84K Poplar, which has no flying catkins in spring, is a powerful guarantee for accelerating the construction of shelterbelts in the three northern regions, the greening of plains and the construction of farmland forest networks, and the rapid construction of the capital's green isolation belt and green barrier in the three northern regions where trunk-boring pests such as longhorn beetles are extremely serious and suitable for the development of white poplar faction poplar varieties. Summary of the invention

[0005] The object of the present invention is to provide the application of the PdAKR2A gene in improving the growth rate, photosynthetic rate, cell wall components of poplar and breeding, so as to provide valuable candidate genes for cultivating new poplar varieties with faster growth rate and better quality, and contribute to promoting the sustainable development of forestry in China and alleviating the supply-demand tension in the wood market.

[0006] To achieve the above object, the present invention provides the application of the PdAKR2A gene in improving the growth rate of poplar. The CDS sequence of the PdAKR2A gene is shown as SEQ ID NO.1; compared with the wild type, the plant height and ground diameter of poplar overexpressing the PdAKR2A gene are significantly increased.

[0007] Preferably, compared with the wild type, the number of cambium cell layers and the width of xylem of poplar overexpressing the PdAKR2A gene are significantly increased.

[0008] The above application of the PdAKR2A gene in improving the photosynthetic rate of poplar. Compared with the wild type, the net photosynthetic rate, stomatal conductance, transpiration rate and chlorophyll content of poplar overexpressing the PdAKR2A gene are significantly increased.

[0009] The above application of the PdAKR2A gene in changing the cell wall components of poplar. Compared with the wild type, the lignin and cellulose contents of poplar overexpressing the PdAKR2A gene are significantly increased.

[0010] The above application of the PdAKR2A gene in poplar breeding.

[0011] The application of the vector and / or strain containing the above PdAKR2A gene in poplar breeding. The vector includes overexpression vector, knockout vector, silencing vector, and the strain includes Escherichia coli and Agrobacterium.

[0012] Therefore, the application of the PdAKR2A gene provided by the present invention in improving the photosynthetic rate and biomass of poplar has the following specific technical effects:

[0013] (1) The present invention discloses for the first time that overexpressing the PdAKR2A gene can significantly increase the number of cambium cell layers and the width of xylem of poplar, thereby increasing the plant height and ground diameter of poplar, and thus improving the growth rate and biological yield of poplar;

[0014] (2) The present invention discloses for the first time that overexpressing the PdAKR2A gene can significantly increase the net photosynthetic rate, stomatal conductance, transpiration rate and chlorophyll content of poplar;

[0015] (3) The present invention discloses for the first time that overexpressing the PdAKR2A gene can significantly increase the lignin and cellulose contents of poplar;

[0016] (4) The PdAKR2A gene provided by the present invention can be used as a candidate gene for cultivating new poplar varieties with faster growth rate and better quality, which is of great significance for promoting the sustainable development of forestry in China and alleviating the supply-demand tension in the wood market.

[0017] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0019] Figure 1 It is the PCR electrophoresis result of transgenic positive seedlings in Example III of the present invention;

[0020] Figure 2 It is the fluorescence quantitative PCR result of WT and transgenic positive seedlings in Example III of the present invention;

[0021] Figure 3 It is the photograph (A), plant height (B), and stem diameter statistical result (C) of WT and OE-2-10 plants grown in the greenhouse for 60 days in Example IV of the present invention;

[0022] Figure 4 It is the intercellular CO2 concentration (A), net photosynthetic rate (B), stomatal conductance (C), transpiration rate (D), and chlorophyll content (E) of WT and transgenic positive seedlings grown in the greenhouse for 60 days in Example V of the present invention;

[0023] Figure 5 It is the photograph of the cambium (A) and xylem width (B) of the stem base cells of WT and transgenic positive seedlings grown in the greenhouse for 60 days in Example VI of the present invention, the xylem width statistical result (C), and the cambium cell layer number statistical result (D);

[0024] Figure 6 It is the determination result of lignin (A) and cellulose (B) contents of the stems of WT and transgenic positive seedlings grown in the greenhouse for 60 days in Example VII of the present invention. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0025] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0026] In order to make the objectives, technical solutions and advantages of the present application more clear, thorough and complete, the technical solutions of the present invention will be clearly and completely described below through the accompanying drawings and embodiments. The following detailed descriptions are all descriptions of embodiments, aiming to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms adopted by the present invention have the same meanings as those generally understood by those of ordinary skill in the technical field to which this application belongs.

[0027] The instrument equipment and reagent materials used in the embodiments are all obtained through commercial channels.

[0028] Example 1

[0029] The CDS sequence of the PdAKR2A gene (Potri.004G210100) is shown in SEQ ID NO.1: SEQ ID NO.1:

[0030]

[0031] Construct an overexpression vector of the PdAKR2A gene, and the specific steps are as follows:

[0032] S1.1. Use the SPARKeasy Improved Plant RNA Kit of Shandong Sikejie Biotechnology Co., Ltd. to extract the total RNA of the leaves of 2-month-old "84k poplar", and reverse transcribe the obtained RNA into cDNA through the One-Step gDNA Removaland cDNA Synthesis SuperMix reverse transcription kit (produced by Beijing TransGen Biotech Co., Ltd.), perform PCR amplification on the obtained cDNA, and the forward primer sequence is as shown in SEQ ID NO.2; the reverse primer sequence is as shown in SEQ ID NO.3, and the amplification system and amplification conditions are carried out according to the instructions attached to 2xTaq Master Mix (Nanjing Novoprotein Scientific Co., Ltd.).

[0033] SEQ ID NO.2:CGACTCTAGAAAGCTTATGGCGACCACGAACAAG

[0034] SEQ ID NO.3:CGGGCCCCTGCAGAAGCCAGGAAGGCATCCTTCTCGA

[0035] S1.2. Use the "HindIII-HF" restriction endonuclease (New England Biolabs (Beijing) Co., Ltd.) to digest the pCAMBIA1300 vector (containing the 35S promoter), and through homologous recombination, use ⅡOneStep Cloning Kit (Nanjing Novoprotein Scientific Co., Ltd.) to insert the amplified fragment of the PdAKR2A gene obtained in step S1.1 between the HindIII-HF digestion sites of the pCAMBIA1300 vector (for specific operations, see Tang et al., New Phytol., 2020).

[0036] S1.3. Transform the recombinant vector obtained in step S1.2 into competent Agrobacterium rhizogenes EHA105 through conventional operations such as ice bath and heat shock, coat the plate, pick single colonies, perform colony PCR identification, and pick the colonies with correct identification and shake the bacteria to OD 600 to 0.6 - 0.8, and store the bacterial liquid at -80°C. For the specific operation method, see the master's thesis of Xu Li (2022, Qingdao Agricultural University).

[0037] Example 2

[0038] Genetic transformation of poplar leaves, the specific steps are as follows:

[0039] S2.1. Take out the stored bacterial solution from the -80℃ refrigerator, add it to 1mL of liquid LB medium containing 50mg / L kanamycin and rifampicin resistance, incubate at 28℃ and 220rpm for 24h to activate the strain, then take 200μL of the bacterial solution and add it to 50mL of liquid LB medium containing 50mg / L kanamycin and rifampicin resistance and culture until OD 600 It is 0.6-0.8.

[0040] S2.2, 5000rpm, centrifuge for 10 min to collect the cells, and culture the cells in a co-culture liquid medium containing 100μM / L acetosyringone (AS) in an incubator at 28℃ and 220rpm until the OD 600 It is 0.3-0.4 as the infection solution.

[0041] S2.3. Take the 2nd to 5th tender leaves from the upper end of the sterile seedlings of "84k poplar", make 3 to 4 cuts on the main vein with a sterile blade, and soak them in the invasive dye solution for about 8 minutes. Place the leaves on sterile filter paper to absorb moisture, spread them flat on the co-cultivation solid culture medium, and treat them in the dark at 28°C for 2 days.

[0042] S2.4. Transfer the leaves to a selective culture medium and culture them in the dark. When the callus grows to the size of a rice grain, cut it with a sterile blade and transfer it to a screening culture medium for bud induction for culture. When buds grow from the callus, cut the buds and insert them into a rooting culture medium for culture.

[0043] Co-culture medium: WPM 2.14 g / L, Ca(NO3)2 0.56 g / L, MES 0.5 g / L, sucrose 20 g / L, adjust pH to 5.8-6.0, sterilize at 121°C for 15 min, then add acetosyringone (AS) at a concentration of 100 mM / L; add 8 g / L agar to the solid culture medium.

[0044] Select medium: WPM 2.14g / L, Ca(NO3)20.56g / L, MES 0.5g / L, sucrose 20g / L, 2,4-D1mg / L, Kinetin 0.5mg / L, adjust pH to 5.8-6.0, autoclave at 121℃ for 15min, then add hygromycin (Hyg) 3mg / L, timentin (TMT) 300mg / L, cefoperazone (cef) 300mg / L; solid medium added with 8g / L agar;

[0045] Screening medium: WPM 2.14 g / L, Ca(NO3)2 0.56 g / L, MES 0.5 g / L, sucrose 20 g / L, TDZ 0.02 mg / L, adjust the pH to 5.8 - 6.0, autoclave at 121 °C for 15 min, and then add hygromycin (Hyg) 3 mg / L, ticarcillin (TMT) 300 mg / L, cefotaxime (cef) 300 mg / L; add 8 g / L of agar to the solid medium.

[0046] Rooting medium: 1 / 2MS 2.203 g / L, MES 0.5 g / L, sucrose 20 g / L, adjust the pH to 5.8 - 6.0, autoclave at 121 °C for 15 min; add 8 g / L of agar to the solid medium.

[0047] Example 3

[0048] Identification and expression level analysis of transgenic positive plants were carried out as follows:

[0049] S3.1. Take the genetically transformed seedlings that have grown in the rooting medium for 2 months in Example 2, extract the DNA of poplar leaves by the CTAB method, and perform positive identification on the poplar leaf DNA using the GFP-tag primer fragment. A total of 5 transgenic positive seedlings, OE-2-3, OE2-10, OE2-11, OE2-12, and OE3-8, were obtained.

[0050] The forward primer sequence of the GFP tag is shown in SEQ ID NO.4, the reverse primer sequence is shown in SEQ ID NO.5, and the electrophoresis result of the PCR product is as Figure 1 shown.

[0051] SEQ ID NO.4: ATGGTGAGCAAGGGCGAGGA

[0052] SEQ ID NO.5: CTTGTACAGCTCGTCCATGCC.

[0053] S3.2. Use SPARKeasy Improved Plant RNAKit (Shandong Sikejie Biotechnology Co., Ltd.) to extract the RNA of wild-type plants (WT) and the leaves of the transgenic positive seedlings identified in step S3.1 respectively, and use Ⅲ1stStrand cDNA Synthesis Kit (Cuisheng Biotechnology (Shanghai) Co., Ltd.) to reverse transcribe it into cDNA. Using the PdUBQ gene as an internal reference, perform fluorescence quantitative PCR analysis to obtain the expression level of the transgenic positive plants relative to WT. Set 6 biological replicates for each sample, and the results are as Figure 2 shown.

[0054] The forward primer sequence of the specific primer for the PdUBQ gene is shown in SEQ ID NO.6, and the reverse primer sequence is shown in SEQ ID NO.7. The forward primer sequence of the specific primer for the fluorescence quantitative PCR analysis of the PdAKR2A gene is shown in SEQ ID NO.8, and the reverse primer sequence is shown in SEQ ID NO.9.

[0055] SEQ ID NO.6:AGACCTACACCAAGCCCAAGAAGAT

[0056] SEQ ID NO.7:CCAGCACCGCACTCAGCATTAG

[0057] SEQ ID NO.8:TTCTAAATCATCAGTAACCTCCTC

[0058] SEQ ID NO.9:TAACTCTTTGATGCTCGGGTC

[0059] It can be seen that Figure 2 the relative expression levels of the PdAKR2A gene in the transgenic positive plants were significantly higher than those in the WT. Among them, the highest relative expression level was in the OE2-10 plant, which was 19 times that of the WT.

[0060] Example 4

[0061] To investigate the phenotypes of the transgenic positive plants, the specific steps are as follows:

[0062] The wild type (WT, Populus alba × Populus glandulosa) with consistent growth conditions and the transgenic positive plant OE-2-10 with the highest relative expression level of the PdAKR2A gene compared with the WT plants were cuttaged and cultured in the nutrient soil in the greenhouse. The culture conditions were: a photoperiod of 16 h / 8 h, a light intensity of 80 μmol / m 2 / s, a temperature of 24 - 26 °C, and a humidity of 70%. On the 60th day of greenhouse cultivation, the plant heights and ground diameters of each plant were measured respectively. The results are shown in Figure 3 B and C respectively, and the plant photos of the 60th day of greenhouse cultivation are shown in Figure 3 A. The results showed that there were significant differences in the plant heights and ground diameters between the transgenic positive plants and the WT plants. Among them, the plant height of the transgenic line OE2-10 increased by 18% compared with the wild type; the stem diameter increased by 7%. The statistical results are shown in Figure 3 B and Figure 3 C respectively.

[0063] Example 5

[0064] To measure the photosynthetic indexes of the transgenic positive plants, the specific steps are as follows:

[0065] S5.1 Chlorophyll Content Determination

[0066] (1) Take the leaves of WT and OE2-10 cultured in the greenhouse on the 60th day of Example 4. Weigh two leaves of basically the same size from every three trees respectively, and select one leaf to record the fresh weight. After grinding in liquid nitrogen, put it into a 50 mL centrifuge tube and carry out a 24-hour shading treatment. Put the other leaf into an oven at 55 °C, dry it for 24 hours and then record the dry weight.

[0067] (2) Use the T6 New Century UV-Visible Spectrophotometer. After self-check is completed, measure the chlorophyll content of poplar leaves. After the leaves are shaded and ground in liquid nitrogen, then suck 1 mL of the supernatant into the machine cuvette. Adjust the wavelength to 649 nm and 665 nm respectively for measurement. After the measurement is completed, record the data. According to the formula, chlorophyll a content = 13.95×D 665 -6.88×D 649 Measure the chlorophyll a content; chlorophyll b content = 24.96×D 649 -7.32×D 665 Measure the chlorophyll b content. The sum of the chlorophyll a content and the chlorophyll b content is the total chlorophyll content. The results are as Figure 4 shown in E. The total chlorophyll content in the leaves of OE2-10 plants is 1.6 times that of the leaves of WT plants.

[0068] S5.2 Photosynthetic Rate Measurement

[0069] Select the newly fully expanded leaves without occlusion and with good light conditions on WT and OE2-10 plants respectively. From 9:00 to 10:30 in the morning on a sunny day, in a greenhouse with constant temperature and light, use the portable photosynthesis measurement system "Photosynthesis Meter LI-6800" to measure the photosynthetic efficiency of poplar. Ten leaves of WT and OE2-10 plants are repeated respectively. The specific steps are as follows:

[0070] Select the 6800-01F fluorescence leaf chamber (round, 6 cm) for the experiment. The environmental conditions of the leaf chamber are set according to the light and temperature conditions in the greenhouse. Use a CO₂ steel cylinder to control a stable and consistent CO₂ concentration, and connect a buffer bottle at the air inlet of the main unit to better ensure the cleanliness of the air path of the main unit. Click the Environment label to perform environmental settings (both Flow and Fan are selected as On).

[0071] (1) Set Flow:On:PumpSpeed:Auto:Flow:500 μmol m -2 s -1 :P:0.1 kPa;

[0072] (2) Set H0:On:RH-air:50%~75%;

[0073] (3) Set CO₂: If there is no CO₂ cylinder installed, set CO₂ here to Off. If there is a CO₂ cylinder installed: CO₂ injector; On:: CO₂ - s: 400 μmol·mol -1 ;

[0074] (4) Set Mixing fan; On; Fan Speed; 10,000 rpm;

[0075] (5) Set Temperature: Set a similar temperature of 26 °C according to the ambient temperature Tair;

[0076] (6) Set light intensity Light: For the photosynthetic characteristics comparison experiment in the treatment room, the influence of the changing external light on plant photosynthesis needs to be excluded. Therefore, a stable light intensity needs to be set. The setting method is as follows:

[0077] 6800 - 0IF yellow - light leaf chamber:

[0078] Set Light: Select Fuoromcter: Control Mode: Setpoint; Setpoint: 1500 μmol m -2 s -1 : Color Sepc: r90 (90% red light);

[0079] 6800 - 02 red - blue light case:

[0080] Set Light: Select Head Light Souree: Control Mode: Setpoint: Setpoint: 1500 μmol m -2 s -1 : ColorSepc: r90 (90% red light);

[0081] (7) Click on the Log Setup tab and set the recording file and recording options

[0082] Set Logging Options: Keep the default, check and ensure that Alsolog datato Excel fle is selected

[0083] (8) Start measurement: Clamp the leaf, click on the Measurement tab to enter the measurement interface. Observe the graph on the left. By pressing different letters, you can view the real-time graphs of the stability of multiple parameters. You can also view the stability parameters set in the Stabiliy function under the LogSetup tab. When it shows 4 / 4, the data is stable. Click the Log button in the upper right corner to record the data. Replace the leaf and repeat step (6) until the measurement of this group is completed. After the measurement is completed, click on the Logging to function under the LogSetup tab and click Close Log at the lower right corner to close the recording file.

[0084] The results are as Figure 4 shown in A - D of , the photosynthetic rate, stomatal conductance, and transpiration rate of the overexpressing plants were significantly increased compared to WT, and the intercellular carbon dioxide concentration was significantly decreased.

[0085] Example Six

[0086] Xylem development of transgenic positive plants

[0087] After the determination of the photosynthetic indexes of the plants in Example Five was completed, the basal stem segments of WT and OE2 - 10 plants were taken respectively for fixation, dehydration, clearing, infiltration with wax, and embedding processes to obtain wax blocks containing the stem segment materials. The wax blocks were sliced with a microtome and placed on glass slides, then spread and sealed with a spreading machine. After the dewaxing process with xylene and alcohol treatment, the sliced materials were stained with 1% toluidine blue (TBO). After 1 minute, rinse with water, and then observe and take pictures with a ZEISS microscope. For the specific steps, refer to the master's thesis of Xu Li (2022, Qingdao Agricultural University). The results are shown in Figure 5 , where part A is the photos of the cambium of the lower stems of OE2 - 10 plants and WT poplars, part B is the photos of the xylem of the lower stems of OE2 - 10 plants and WT poplars, part C is the statistical result of the number of cambium cell layers, and part D is the statistical result of the xylem width.

[0088] It was found that the number of cambium cell layers at the base of the stems of PdAKR2A overexpressing plants increased by about one layer compared to WT, and the xylem width increased significantly; after further statistics, it was found that the xylem width of PdAKR2A overexpressing plants increased by 10%.

[0089] Example Seven

[0090] Identification of cell wall components of transgenic positive plants

[0091] S7.1, AIR extraction

[0092] (1) After the determination of the photosynthetic indexes of the plants in Example Five was completed, the fifth internodes (counting from the bottom up) of the stems of WT and OE2 - 10 plants were taken as experimental materials respectively.

[0093] (2) The collected materials are quickly frozen in liquid nitrogen, ground into powder using a tissue disruptor, and placed into centrifuge tubes for the extraction of AIR.

[0094] (3) Take about 1 mL of the ground sample into a 2-mL centrifuge tube, add ethanol at 80% to 1.8 mL, centrifuge at 12000 rpm for 10 min. After centrifugation, gently aspirate the upper layer of liquid with a pipette, avoiding sucking up the precipitate.

[0095] (4) Add 1 mL of 80% ethanol to the above precipitate respectively, centrifuge at 12000 rpm for 10 min. After centrifugation, gently aspirate the upper layer of liquid with a pipette, then wash twice with 1 mL of absolute ethanol, centrifuge at 12000 rpm for 10 min and gently aspirate the upper layer of liquid with a pipette.

[0096] (5) Add 1 mL of a mixture of chloroform and methanol (volume ratio of chloroform: methanol is 1:1) to the above precipitate, heat in a water bath at 37 °C for 40 min, centrifuge at 12000 rpm for 10 min, discard the supernatant, and repeat the steps of adding the mixture, water bath, and centrifugation once.

[0097] (6) Place the obtained precipitate in a fume hood and dry the precipitate to obtain pure alcohol-insoluble residue (AIR) of the cell wall.

[0098] S7.2, Determination of total cellulose content:

[0099] ① Weigh 2 mg of the AIR sample obtained in step (1) into a glass tube, slowly add 0.5 mL of 2 M trifluoroacetic acid (TFA) along the wall, react in a metal bath at 121 °C for 90 min to dissolve hemicellulose.

[0100] ② Cool the reacted sample to room temperature, centrifuge at 5000 g for 5 min, and carefully remove the supernatant.

[0101] ③ Add 800 μL of ultrapure water to the obtained precipitate to wash the precipitate, centrifuge at 5000 g for 5 min, carefully remove the supernatant, and repeat the operations of adding ultrapure water and centrifugation once.

[0102] ④ Aspirate the supernatant completely, add 200 μL of 72% sulfuric acid and react at room temperature for 30 min to dissolve the cellulose in the precipitate.

[0103] ⑤ Add 800 μL of ultrapure water to the reacted sample, centrifuge at 12000 rpm for 5 min, and take 500 μL of the supernatant for standby.

[0104] ⑥ Preparation of glucose standard curve: Weigh 1 mg of glucose standard sample and dissolve it in 1 mL of ultrapure water to prepare the stock solution. Dilute it into solutions with concentrations of 0, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 1 mg / mL respectively. Add 150 μL of phenol (5%) and mix well, then add 750 μL of sulfuric acid (98%) and mix well. Measure the absorbance values of the above solutions at 490 nm. According to the diluted solution concentrations and the corresponding absorbance values, prepare the glucose standard curve, as Figure 5 shown in the standard curve.

[0105] ⑦ Take the supernatant obtained in step ⑤, add 150 μL of phenol (5%) and mix well, then add 750 μL of sulfuric acid (98%) and mix well.

[0106] ⑧ Pipette an equal amount of the mixed solution obtained in step ⑦ into the microplate, and measure the absorbance value at 490 nm. According to the glucose standard curve drawn in step ⑥, calculate the glucose content in the sample, which is the cellulose content.

[0107] S7.3 Determination of lignin content:

[0108] ① Weigh 1.5 mg of the AIR sample obtained in (1) into a 2 mL centrifuge tube (leave 1 empty tube as a control).

[0109] ② Gently and slowly add 100 μL of freshly prepared acetyl bromide solution (25% v / v acetyl bromide / acetic acid) along the tube wall.

[0110] ③ Cover the centrifuge tube lid and place it in a water bath at 50 °C for 2 h.

[0111] ④ Continue heating and reacting for 1 h, and shake and mix well every 15 min in the middle.

[0112] ⑤ Place the reacted material on ice and cool it to room temperature.

[0113] ⑥ Add 400 μL of 2 M NaOH and 70 μL of freshly prepared 0.5 M hydroxylamine hydrochloride to the cooled reaction sample, and vortex and mix well.

[0114] ⑦ Transfer the reacted sample to a 10 mL centrifuge tube, add glacial acetic acid to 2 mL, and mix well.

[0115] ⑧ Pipette 200 μL of the reacted solution into the microplate, measure the absorbance value at 280 nm, and calculate the lignin content according to the following formula:

[0116] Acetyl bromide soluble lignin (%ABSC) = abs(absorbance value) / coeff(coefficient) × 0.1 cm × 2 mL × 100% / weight (unit: mg).

[0117] The results are as Figure 6As shown, compared with WT, the lignin and cellulose contents in the stems of PdAKR2A overexpressing plants were significantly increased. Among them, the lignin content in the stems of the OE-2-10 transgenic positive line increased by 12%, and the cellulose content increased by 8%.

[0118] Therefore, the present invention for the first time discloses that overexpressing the PdAKR2A gene can significantly increase the number of cambial cell layers and the xylem width of poplar, thereby increasing the plant height and ground diameter of poplar, and thus improving the growth rate and biological yield of poplar; it can significantly increase the net photosynthetic rate, stomatal conductance, transpiration rate and chlorophyll content of poplar; it can significantly increase the lignin and cellulose contents of poplar; the provided PdAKR2A gene can be used as a candidate gene for cultivating new poplar varieties with faster growth rate and better quality, which is of great significance for promoting the sustainable development of forestry in China and alleviating the supply-demand tension in the wood market.

[0119] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that they can still modify or equivalently replace the technical solutions of the present invention, and these modifications or equivalent replacements cannot make the modified technical solutions deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. PdAKR2A The application of genes in increasing the number of cell layers in the cambium of poplars is characterized by: PdAKR2A The CDS sequence of the gene is shown in SEQ ID NO.1; overexpression PdAKR2A The number of cambium cell layers in poplar trees with the gene was significantly increased.

2. As claimed in claim 1 PdAKR2A The application of genes in improving stomatal conductance and transpiration rate of poplars is characterized by: Compared with wild type, overexpression PdAKR2A The stomatal conductance and transpiration rate of poplar trees with the gene were significantly improved.

3. The method according to claim 1 PdAKR2A The application of genes in changing the cell wall components of poplars is characterized by: Compared with wild type, overexpression PdAKR2A The lignin and cellulose content of the poplar with the gene was significantly increased.

4. The method according to claim 1 PdAKR2A The application of the gene in poplar breeding is characterized by: The breeding is to overexpress relative to the wild type. PdAKR2A Gene, breeding new poplar varieties with high lignin content and / or high cellulose content and / or high transpiration rate.

5. Containing the method described in claim 1 PdAKR2A The application of gene vector and / or strain in poplar breeding is characterized by: The vector includes an overexpression vector, and the strain includes Escherichia coli and Agrobacterium; the breeding is to cultivate new poplar varieties with high lignin and / or high cellulose content and / or high transpiration rate.

Images