Application of gene recombinant of adenovirus vector and p53 gene

Abstract

The invention relates to the technical field of gene engineering, and particularly discloses application of a gene recombinant of an adenovirus vector and a p53 gene, and application of the recombinant constructed by utilizing the adenovirus vector and the human p35 gene in preparation of drugs for treating proliferative diseases. The recombinant adenovirus is packaged by adopting an AdMax packaging system framework, the E1 / E2-deleted replication-deficient adenovirus is obtained through intracellular homologous recombination, recombinant virus particles with relatively high titer can be obtained, and the recombinant virus particles can have relatively high expression in cells with proliferative diseases, so that the recombinant adenovirus can be used for treating proliferative diseases. By means of the method, in-vivo transfer of the exogenous p53 gene and efficient expression of the exogenous p53 gene in hyperplasia tissue of a patient are achieved, so that the purpose of treatment is achieved, and gene treatment of hyperplasia diseases is achieved.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to the application of a gene recombinant of an adenovirus vector and a p53 gene. Background Art

[0002] Proliferative diseases are genetic diseases characterized by cell proliferation and / or abnormal expression of metabolic products. They are benign hyperplasias that occur widely in various tissues and organs of the human body (such as skin, bone marrow, breast, etc.) and produce varying degrees of functional disorders. Scars are the inevitable product and final result of the human trauma repair process. The healing of any trauma will result in varying degrees of scar formation. Their clinical manifestations are excessive growth, exceeding the boundaries of the original wound, invading adjacent tissues, not degenerating from beginning to end, and easy recurrence after simple surgical excision. Numerous experiments have confirmed that keloids have mutations in the p53 gene. At present, there is still a lack of clear and effective treatment options for keloids. It is one of the most important problems facing plastic surgery.

[0003] Adenovirus packaging cells HEK293, as various vectors that can be used for gene therapy, do not have any significance for treating diseases and have no clinical application value. Only by combining genes with potential therapeutic effects with vectors that can transfer genes, and by the latter's mediation, can the target gene be introduced into the target cell and expressed, in order to achieve a true clinical therapeutic effect. Therefore, constructing the fusion sequence of the therapeutic gene and the gene vector is the key to achieving gene therapy.

[0004] The common method of fusing the expression of the target gene with the vector is to perform homologous recombination in eukaryotic cells, which is a complex, time-consuming and labor-intensive process. However, the new technology of achieving homologous recombination in prokaryotic cells (Escherichia coli) and constructing fusion expression vectors can effectively solve the above problems. Studies have shown that when the E1 or E3 deletion region of adenovirus vectors carries exogenous genes, the target gene can be expressed for a longer period of time and its immunogenicity can be reduced; retrovirus vectors can carry exogenous genes and integrate them into the target cell genome to achieve stable and long-lasting expression of the target gene, but the in vitro reproduction titer of retroviruses is low, the transfection efficiency is low, and they only infect dividing cells.

[0005] Therefore, it is necessary to propose the application of a gene recombinant of an adenovirus vector and a p53 gene to at least partially solve the problems existing in the prior art.

[0006] The above information disclosed in this background technology is only used to increase the understanding of the background technology of the present invention and therefore, it may include information that does not constitute the prior art known to ordinary technicians in this field. Summary of the invention

[0007] The purpose of the present invention is to provide an application of a gene recombinant of an adenovirus vector and a p53 gene to solve the problems raised in the above background technology.

[0008] To achieve the above object, the present invention provides the following technical solutions:

[0009] The application of gene recombinants of adenovirus vectors and p53 genes, and the application of recombinants constructed by using adenovirus vectors and human p35 genes in the preparation of drugs for treating proliferative diseases.

[0010] Preferably, the fusion sequence is:

[0011] The right side of the adenovirus genome sequence-ATGTTTACCGCCACACTCGCAGGGTCTGCACCTGGTGCGGGTCTCATCGTACCTCAGCACCTTCCAGATC,TCTGACATGCGATGTCGACTCGACTGCTTCGCGATGTACGGGCCAGATATA CGCGTATCTGAGGGGACTAGGGTGTGTTTAGGCGAAAAGCGGGGCTTCGGTTGTACGCGGTTAGGAGTCCCCTCAGGATATAGTAGTTTCGCTTTTGCATAGGGAGGGGGGAAATGTAGTCTTATGCAATACTCT TGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCCTTACAAGGAGAGAAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACA TGGATTGGACGAACCACTGAATTCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACAATAAACGCCATTTGACCATTCACCACATTGGTGTGCACCTCCAAGCTTGGTACCGAGCTCGGATCCCG s23 CTAGAGCCACCCTCCAGGGAGCAGGTAGCTGCTGGGCTCCGGGGACACTTTGCGTTCGGGCTGGGAGCGTCTTTCCACGACGGTGACACGCTTCCCTGGATTGGCAGCCAGACTGCTTTCCGGGTCACTGCC 6sg2848 - Adenovirus genome sequence on the left

[0012] Preferably, the identification of the p53 gene is as follows: the pMD18T-p53 plasmid is transformed into competent E. coli DH5ɑ, positive clones are picked, plasmids are extracted by bacterial liquid PCR, enzyme digestion identification is performed, and sequencing identification is performed.

[0013] Preferably, the shuttle plasmid pDC316-p53 is constructed as follows: Based on the multiple cloning site contained in the adenovirus shuttle plasmid pDC316, EcoRⅠ and HindⅢ restriction sites are introduced at both ends of the p53 gene by PCR, and the upstream primer P1 is designed: G.A.A.T.C. ATGGGATCTTCCTCTGAGG and downstream primer P2: AAAGCTT TCACTGCAACCTCAACGGT. The pMD18T-p53 plasmid with the correct base sequence confirmed by sequencing was used as a template, and P1 and P2 were used as primers to amplify the p53 gene. The amplified product was recovered after double digestion with EcoRⅠ and HindⅢ, and then the vector pDC316 was treated with the same endonuclease. The p53 gene fragment and the pDC316 digestion product were separated and purified by 10g / L agarose electrophoresis, and then 1μL of the vector pDC316 and 3μL of the p53 gene fragment were taken respectively, and ligated with 1μL T4 ligase at room temperature for 30min to obtain the recombinant plasmid.

[0014] Preferably, the screening and identification of the recombinant plasmid pDC316-p53: the ligation product was transformed into DH5ɑ Escherichia coli competent cells and then lysed with LB / Amp + The positive clones screened from the plate were dissolved in 5 mL LB medium and shaken at 37°C and 200 r / min overnight. The plasmid was extracted according to the instructions of the plasmid extraction kit, and 1 μL was taken as a template for PCR amplification. The upstream primers were:

[0015] 5′-ATGGGATCTTCCTCTGAGGGGA-3′, downstream primer:

[0016] 5′-TCACTGCAACCTCCAACGGTGCT-3′,

[0017] The reaction conditions were denaturation at 94°C for 30 s, annealing at 53°C for 30 s, and extension at 72°C for 30 s, for a total of 31 cycles. After the last cycle, the product was extended at 72°C for 10 min. 10 μL of the PCR reaction product was analyzed by 10 g / L agarose gel electrophoresis and identified by double enzyme digestion with EcoRⅠ and HindⅢ. After enzyme digestion identification of the recombinant product, the correctly identified plasmid was named pDC316-p53.

[0018] Preferably, the packaging and identification of the recombinant adenovirus Ad-p53: HEK293 cells (2×10 5 / each well), and after 24 hours, when the cells grow to a density of 60% to 70%, transfection is performed. The plasmid DNA in the virus packaging system is extracted using a plasmid extraction kit, and its concentration and purity are determined by ultraviolet absorption method before the plasmid transfection process is performed. The transfection process refers to Lipofectamine TM 2000 transfection reagent instructions, using the Cre-loxP recombinase system to transfer the shuttle plasmid pDC316-p53 and the auxiliary plasmid pBHGloxΔE1,3Cre, through Lipofectamine TM 2000 were co-transfected into HEK293 cells, and the cell growth was observed. After 12 days of transfection, when most of the cells showed cytopathic effects, the cells were collected and repeatedly frozen and thawed at -70℃ / 37℃. The viral supernatant was collected and stored at -70℃. Adenovirus DNA was extracted using a viral genomic DNA extraction kit, and PCR was used to amplify and identify p53 and the replication promoter region. The amplified products were subjected to 10g / L agarose gel electrophoresis. The appearance of a 375bp band and the lack of expression in the replication promoter region indicated the construction of a correct adenovirus vector. The correctly identified adenovirus was named Ad-p53, that is, a replication-defective adenovirus carrying the p53 gene.

[0019] Preferably, the amplification and purification of the recombinant adenovirus Ad-p53: 0.5 μL of the recombinant adenovirus pDC316-p53 virus storage solution amplified for the first time was taken, and 100 mL / L FBS culture medium was added to 1 mL and mixed well. HEK293 cells (5×10 6 ) culture medium, add the above virus mixture, culture for another 72 h at 37°C, 50 g / L FBS in MEM / EBSS medium, collect the cells, freeze and thaw three times, collect the supernatant, repeatedly use the above method to amplify the virus to the required amount, and purify the virus by cesium chloride density gradient ultracentrifugation.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The present invention uses the AdMax packaging system framework to package recombinant adenovirus, obtains E1 / E2-deficient replication-deficient adenovirus through intracellular homologous recombination, can obtain relatively high titer recombinant virus particles, and can have high expression in cells with proliferative diseases, so that the subject himself becomes a "source" for producing human tumor suppressor p53 protein. This method realizes the in vivo transfer of exogenous p53 gene and its efficient expression in the patient's proliferative tissue to achieve the treatment purpose, making gene therapy for proliferative diseases a reality.

[0022] The above summary is for illustrative purposes only and is not intended to be limiting in any way. In addition to the illustrative aspects, embodiments and features described above, further aspects, embodiments and features of the present invention will be readily apparent by reference to the accompanying drawings and the following detailed description. DETAILED DESCRIPTION

[0023] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0024] Example:

[0025] The application of gene recombinants of adenovirus vectors and p53 genes, and the application of recombinants constructed by using adenovirus vectors and human p35 genes in the preparation of drugs for treating proliferative diseases.

[0026] The recombinant adenovirus Ad-p53 was titered using the tissue culture half-dose infection method:

[0027] One day after extraction, HEK293 cells were inoculated into 96-well plates, with 1x10 4 cells, take 100 μL of adenovirus stock solution and dilute it 1:10, and then dilute it to 10 -8 , the virus solution was added to a 96-well plate, and the CPE phenomenon was observed after 10 days. The CPE wells were counted and the positive rate of each row was calculated.

[0028] Western blot was used to detect the expression of target gene p53 in infected cells:

[0029] HeLa cells were infected with Ad-p53 and Ad-null (MOI uniformly 100), respectively. After 24 hours, fresh DMEM culture medium containing 100 mL / L newborn calf serum was replaced. After 48 hours, the cells were collected and the total cell protein was extracted with an appropriate amount of Laemmli sample buffer cell lysis solution. After centrifugation, the supernatant was quantified and subjected to SDS-PAGE (50 g / L concentrate, 100 g / L separation gel) electrophoresis (constant voltage 80 V, 2 hours), and blocked with 50 g / L skim milk powder for 2 hours. The membranes were incubated with goat anti-human p53 polyclonal antibody (1:500 dilution) and mouse anti-β-actin mAb (1:2000 dilution) at 4°C overnight, and the membranes were fully washed 3 times with TBST. Finally, HRP-labeled goat anti-goat IgG antibody and HRP-labeled goat anti-mouse IgG antibody were added respectively, and the cells were incubated at room temperature for 2 hours. The membranes were fully washed 3 times with TBST, and the expression of the target protein was detected by ECL system development.

[0030] The killing effect of gene recombinants on primary cultured fibroblasts in vitro:

[0031] In vitro culture of scar fibroblasts: The scar skin removed during surgery was cut into 0.5-1 cm pieces under sterile conditions. 3 The tissue was washed twice with PBS (containing penicillin and streptomycin) to remove fat and connective tissue, and then washed several times with D-Hank solution until the liquid was free of oil droplets and turbidity, and then repeatedly cut into 1mm pieces. 3 Add a few drops of serum on the tissue blocks, then place the skin pieces on the wall of the culture bottle at appropriate intervals, turn the culture bottle over so that the side with the tissue blocks faces up, add DMEM culture medium containing 10% FBS (Note: do not allow the tissue to come into contact with the culture medium!), place the side with the tissue blocks face up in a 37°C, 5% CO2 incubator for static culture. After 6-8 hours, gently turn the culture bottle over and do not move it for 3-4 days. Thereafter, change the medium every 3-4 days. After about 10 days, cells will grow around the tissue blocks and gradually form a cell halo. After about a month, the cells will fill the bottle to form a single layer of cells.

[0032] SP staining and vacuum negative pressure method were used to identify cell types:

[0033] Sample preparation: After digesting the cells with trypsin, make a cell suspension of 10,000 cells / mL, put an 18×18 mm cover slip into a 55 mm culture dish, add two drops of cell suspension on each cover slip, incubate in a CO2 incubator for 6-8 hours, remove the cover slips one by one, wash them thoroughly 3 times with PBS, put them in pure acetone, fix them at room temperature for 15 minutes, and wash them 3 times with PBS; perform SP immunocytochemical staining using the vacuum negative pressure method: place the cover slip with the cells facing up on a slide, add 50 μL to each, and add an equal amount of PBS to the negative control group. Place in a vacuum negative pressure box, pump the negative pressure to 66.7KPa, take out after 10 minutes, wash 3 times with PBS, add 50μL of biotin-labeled second antibody to each section, place in a vacuum negative pressure box for 10 minutes, take out, and wash 3 times with PBS; add 50μL of streptavidin-peroxidase solution to each section, place in a negative pressure box for 10 minutes, take out, and wash 3 times with PBS; add 10μL of DAB solution to each section for color development, at room temperature for 10 minutes, wash 3 times with PBS, counterstain with hematoxylin for 1 minute, blue with 1% alcohol for a few seconds, dehydrate with alcohol, make transparent with xylene, seal with neutral gum, and observe under a microscope.

[0034] As can be seen from the above, the present invention uses the AdMax packaging system framework to package recombinant adenovirus, obtains E1 / E2-deficient replication-deficient adenovirus through intracellular homologous recombination, can obtain relatively high titer recombinant virus particles, and can have high expression in cells with proliferative diseases, so that the subject himself becomes a "source" for producing human tumor suppressor p53 protein. This method realizes the in vivo transfer of exogenous p53 gene and its efficient expression in the patient's proliferative tissue to achieve the therapeutic purpose, making gene therapy for proliferative diseases a reality.

[0035] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "examples", "specific examples" or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine different embodiments or examples described in this specification and the features of different embodiments or examples, unless they are contradictory.

[0036] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. Application of genetic recombinant of adenovirus vector and p53 gene, It is characterized by: The use of adenovirus vector and human p35 gene to construct recombinants for the preparation of drugs for the treatment of proliferative diseases.

2. Application of the genetic recombinant of adenovirus vector and p53 gene according to claim 1, Its characteristics are: The recombinant includes the following nucleotide sequence: -ATGTTTACCGCCACACTCGCAGGGTCTGCACCTGGTGCGG TCTCATCGTACCTCAGCACCTTCCAGATC70TCTGACATGCGATG TCGACTCGACTGCTTCGCGATGTACGGGCCAGATATACGCGTATCTGAGGGGACTAGGGTGTGTTTAGGCGAAAAGCGGGGCTTCGGTTGTACGCGGTTAGGAGTCCCCTCAGGATATAGTAGTTTCGCTTTTGCATAGGGAGGGGGGAAATGTAGTCTTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCCTTACAAGGAGAGAAAAAAGCACCGTGCATG CCGATTGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGACGAACCACTGAATTCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACAAACGCCATTTGACCATTCACCACATTGGTGTGCACCTCCAAGCTTGGTACCGAGCTCGGATCCCG523CTAGAGCCACCGTCCAGGGAGCAGGTAGCTGCTGGGCTCCG GGGACACTTTGCGTTCGGGCTGGGAGCGTCTTTCCACGACGGT GACACGCTTCCCTGGATTGGCAGCCAGACTGCTTTCCGGGTCA CTGCC655ATGGAGGAGCCGCAGTCAGATCCTAGCGTCGAGCCC CCTCTGAGTCAGGAAACATTTTCAGACCTATGGAAACTACTTCCTGAAAACAACGTTTCTGTCCCCCTTGCCGTCCCAAGCAATGGATGATTTGATGCTGTCCCCGGACGATATTGAACAATGGTTCACTG AAGACCCAGGTCCAGATGAAGCTCCCAGAATGCCAGAGGCTGCTCCCCCCGTGGCCCCTGCACCAGCAGCTCCTACACCGGCGGCCCCTGCACCAGCCCTCCTGGCCCCTGTCATCTTCTGTCCCTTCC CAGAAAACCTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCTTGCATTCTGGGACAGCCAAGTCTGTGACTTGCACGTACTCCCCTGCCCTCAACAAGATGTTTTGCCAACTGGCCAAGACCTGCCCTG TGCAGCTGTGGGTTGATTCCACACCCCCGCCCGGCACCCGCGTCCGCGCCATGGCCATCTACAAGCAGTCACAGCACATGACGGAGGTTGTGAGGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGAT GGTCTGGCCCCTCCTCAGCATCTTATCCGAGTGGAAGGAAATTTGCGTGTGGAGTATTTGGATGACAGAAACACTTTTCGACATAGTGTGGTGGTGCCCTATGAGCCGCCTGAGGTTGGCTCTGACTGTA CCACCATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATGAACCGGAGGCCCATCCTCACCATCATCACACTGGAAGACTCCAGTGGTAATCTACTGGGACGGAACAGCTTTGAGGTGCGT GTTTGTGCCTGTCCTGGGAGAGACCGGCGCACAGAGGAAGAGAATCCGCAAGAAAGGGGAGCCTCACCACGAGCTGCCCCCAGGGAGCACTAAGCGAGCACTGCCCAACAACACCAGCTCCTCTCCCCA GCCAAAGAAGAAAACCACTGGATGGAGAATATTTCACCCTTCAGATCCGTGGGCGTGAGCGCTTCGAGATGTTCCGAGAGCTGAATGAGGCCTTGGAACTCAAGGATGCCCAGGCTGGGAAGGAGCCAGGGG GGAGCAGGGCTCACTCCAGCCACCTGAAGTCCAAAAAGGGTCAGTCTACCTCCCGCCATAAAAACTCATGTTCAAGACAGAAGGGCCTGACTCAGACTGA1837CATTCTCCACTTCTTGTTCCCCACT GACAGCCTCCCACCCCCATCTCTCCCTCCCCTGCCATTTTGGGTTTTGGGTCTTTGAACCCTTGCTTGCAATAGGTGTGCGTCAGAAGCACCCAGGACTTCCATTTGCTTTGTCCCGGGGCTCCACTGAAC AAGTTGGCCTGCACTGGTGTTTTGTTGTGGGGAGGAGGATGGGGAGTAGGACATACCAGCTTAGATTTTAAGGTTTTTACTGTGAGGGATGTTTGGGAGATGTAAGAAATGTTCTTGCAGTTAAGGGTTAG TTTACAATCAGCCACATTCTAGGTAGGGGCCACTTCACCGTACTAACCAGGGAAGCTGTCCCTCACTGTTGAATTTTCTCTAACTTCAAGGCCCATATCTGTGAAATGCTGGATTTGCCCTACCTCGGAAT GCTGGCATTTGCACCTACCTCACAGAGTGCATTGTGAGGGTT2297AATGAAATAATGTACATCTGGCCTTGAAACCACCTTTTATTACATGGGGTCTAGCGGGATCCACTAGTAACGCCGCCAGTGTGC TGGAATTCTGCAGATATCCATCACACTGGCGGCCGCTCGAGCATGCATCTAGAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACC CTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAA TAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGCTTCTGAGGCGGAAAGAACCAGCTGGGGCTCGAGGGGGATCCCCACGCTAGAGCT2733GACTATAATAATAAAACGCCAACTTTGACCCGGAACG CGGAAAACACCTGAGAAAAACACCTGGGCGAGTCTCCACGTA AA CGGTCAAAGTCCCCGCGGCCCTAGACAAATATTA.

3. Application of the genetic recombinant of adenovirus vector and p53 gene according to claim 1, Its characteristics are: The proliferative disease is scar.

4. Application of the genetic recombinant of adenovirus vector and p53 gene according to claim 1, Its characteristics are: The scars are pathological scars.

5. Application of the genetic recombinant of adenovirus vector and p53 gene according to claim 1, Its characteristics are: The pathological scar is a keloid.

6. Application of the genetic recombinant of adenovirus vector and p53 gene according to claim 1, Its characteristics are: The recombinant is adenovirus packaging cell HEK293.