Multienzyme-assisted fluorescent biosensor for logic detection of exosome miRNAs

Abstract

The invention discloses a multienzyme-assisted fluorescent biosensor for logic detection of exosome miRNAs. The multienzyme-assisted fluorescent biosensor comprises a CRISPR / Cas13a protein system, a primer exchange reaction system driven by DNA polymerase and an exonuclease reaction system, according to the invention, the characteristics of three biological enzymes, namely Cas13a, DNA polymerase and exonuclease, are fully utilized, multiple amplification is carried out on a low-abundance exosome miRNAs target, ultra-sensitive and specific detection of multiple markers is realized, and a brand-new reference method is provided for early diagnosis and prognosis evaluation of diseases.

Description

Technical Field

[0001] The present invention relates to the field of biomedical detection, and in particular to a multi-enzyme-assisted fluorescent biosensor for logically detecting exosome miRNAs. Background Art

[0002] Exosomal microRNAs (miRNAs) are a class of small noncoding RNAs that are widely involved in regulating gene expression and are closely related to the occurrence and progression of diseases. Compared with peripheral blood miRNAs, exosomal miRNAs show greater application potential in early tumor diagnosis due to their good circulation stability. However, the complex cancer conditions lead to the phenotypic heterogeneity of exosomes, making it challenging to rely on a single exosomal miRNA for accurate diagnosis and monitoring of diseases. By improving the accessibility of targets, the logical spectrum analysis of various exosomal miRNAs can detect tiny concentration changes, reveal more unknown information than single signal sensing, and can effectively improve the detection sensitivity and reduce false positive / negative results, thereby improving its clinical diagnostic value. At present, the most important method for detecting exosomal miRNAs is real-time fluorescence quantitative PCR, but this method heavily relies on complex and precise instruments, expensive reagents and skilled technical operations, which brings great challenges to the widespread application of detection. Therefore, it is urgent to develop a multiplex platform for analyzing exosomal miRNAs to achieve simple and rapid detection of exosomal miRNAs. Summary of the invention

[0003] In view of this, the object of the present invention is to provide a multi-enzyme-assisted fluorescent biosensor for logical detection of exosomal miRNAs.

[0004] In order to achieve the above object, the present invention provides the following technical solutions: A multi-enzyme-assisted fluorescent biosensor for logical detection of exosomal miRNAs The fluorescent biosensor includes a CRISPR / Cas13a protein system, a DNA polymerase-driven primer exchange reaction system, and an exonuclease reaction system; The CRISPR / Cas13a protein system includes Cas13a protein and its corresponding crRNA, and hairpin H1; the crRNA is complementary to the target miRNA to be detected to form a hybrid double-stranded binding Cas13a protein and activate its RNase activity, trans-cutting the hairpin H1 containing the RNA loop, and releasing the single-stranded DNA primer P1 enclosed in H1; The DNA polymerase-driven primer exchange reaction system includes Bst3.0 DNA polymerase and its buffer, hairpin H2 and dNTP; the 3' end of the hairpin H2 protrudes a single-stranded DNA of eight bases in length, which serves as a complementary recognition region of the DNA primer P1 that triggers the primer exchange reaction; the 3' end of the hairpin H2 is modified with an inverted T base to prevent non-specific extension, and the GC base pair at the end of the stem of the hairpin H2 is hydroxymethylated to prevent the extension of the polymerase; with the help of Bst3.0 DNA polymerase, the primer P1 uses the stem of the hairpin H2 as a template, replicates and extends forward, and terminates at the hydroxymethylated site to generate a primer extension sequence P2, and the complementary sequence on the hairpin H2 replaces the primer extension sequence P2 from H2 through competition, thereby participating in the next reaction; The exonuclease reaction system includes a hairpin H3, an exonuclease III and a buffer thereof; the 5' end of the hairpin H3 is modified with a fluorescent group, and the 3' end base complementary to the base is modified with a fluorescent quenching group; the 3' end of the hairpin H3 protrudes with multiple bases in the form of a single-stranded DNA, which not only serves as a recognition region for the primer extension sequence P2 generated in the previous step reaction, but also prevents non-specific digestion by the exonuclease III; the primer extension sequence P2 generated from the primer exchange reaction in the previous step is complementary to the single-stranded portion of H3 to form a double-stranded DNA, triggering the cutting of the exonuclease III, cutting forward from the 3' end of the double-stranded DNA until the cutting is terminated at the single-stranded portion, ultimately resulting in the release of P2 to participate in the next cutting cycle, the hairpin structure of H3 is destroyed, the fluorescent group is away from the quenching group, and a fluorescent signal is generated; The nucleotide sequence of hairpin H1 is TCTACACGUUUUUCGTGTAGA; The nucleotide sequence of primer P1 is GTGTAGA; The nucleotide sequence of hairpin H2 is GAGGACAGTGGCGCTCmGmGGCCTTTTGGCmCmCGAGCGCCACTGTCCTCTCTACACdT; The nucleotide sequence of primer extension sequence P2 is GTGTAGAGAGGACAGTGGCGCTC; The nucleotide sequence of hairpin H3 is FAM-ATCTCTTATTGGGCCTTTTTGGCCCAATAAGAGAT-(BHQ1)-CCACTGTCCTCTCTACAC.

[0005] In some embodiments of the present invention, when the target miRNA to be detected is miRNA-21 or / and miRNA-375, the corresponding crRNAs are GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACUCAACA UCAGUCUGAUAAGCUAU or / and GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAA CUCACGCGAGCCGAACGAACAA A, respectively.

[0006] In some embodiments of the present invention, the detection method includes the following steps: first, a sample containing the target miRNA to be detected is mixed with the CRISPR / Cas13a protein system and the primer exchange reaction system driven by the DNA polymerase, and then incubated for the first time, and the DNA polymerase activity is inactivated after the reaction is completed; then, it is added to the nuclease reaction system for a second incubation, and the nuclease activity is inactivated after the reaction is completed; finally, the fluorescence value is detected.

[0007] In some embodiments of the present invention, the final concentration of each component in the reaction system of the fluorescent biosensor is: each 20 μL reaction system contains Cas13a protein 35 nM, crRNA 25 nM, hairpin H1 200 nM, hairpin H2 100 nM, dNTP 10 mM, Bst3.0 DNA polymerase 16 U / 20 μL, hairpin H3 200 nM, and exonuclease III 1 U / μL.

[0008] In some embodiments of the present invention, the reaction condition for the first incubation is incubation at 37° C. for 2 h, and the reaction condition for inactivating the activity of the DNA polymerase is inactivation at 80° C. for 5 min.

[0009] In some embodiments of the present invention, the reaction condition for the second incubation is 40 min at 37° C., and the reaction condition for inactivating the exonuclease activity is heating at 70° C. for 20 min.

[0010] In some embodiments of the present invention, the parameters for detecting the fluorescence value are set as follows: the excitation wavelength is 480 nm, the emission wavelength is 500-600 nm, and the slits of the excitation peak and the emission peak are both 5 nm.

[0011] The beneficial effects of the present invention are as follows: the properties of three biological enzymes, Cas13a, DNA polymerase and exonuclease, are fully utilized to perform multiple amplification of low-abundance exosomal miRNAs targets, and ultra-sensitive and specific detection of multiple markers is achieved, providing a new reference method for early diagnosis and prognosis evaluation of the disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] In order to make the purpose, technical solution and beneficial effects of the present invention clearer, the present invention provides the following drawings for illustration: Figure 1 This is a schematic diagram of the principle of the present invention.

[0013] Figure 2 The fluorescence amplification efficiency of the method of the present invention was verified by fluorescence spectroscopy.

[0014] Figure 3 This is a sensitivity analysis of the method.

[0015] Figure 4 To analyze the specificity of the method.

[0016] Figure 5 Provides logical analysis capabilities for fluorescence spectroscopy validation methods.

[0017] Figure 6 This method is used as a comparison with the RT-PCR method.

[0018] Figure 7 Characterization of exosomes. DETAILED DESCRIPTION

[0019] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0020] The principle design of the present invention is as follows Figure 1 As shown, the specific steps include: 1. Cultivate cells and extract exosomes and their exosome-derived miRNAs.

[0021] 2. Construct a reaction system containing different concentrations of exosomal miRNAs, CRISPR / Cas13a protein and its corresponding crRNA, hairpins H1, H2 and H3, Bst3.0 DNA polymerase, exonuclease III and its buffer, and incubate at room temperature.

[0022] 3. After the reaction system is completed, use a fluorescence spectrophotometer to detect the fluorescence intensity. The intensity of the fluorescence signal is positively correlated with the concentration of target miRNAs, thereby quantitatively detecting exosome-derived miRNAs.

[0023] The sequence information of the hairpin and the intermediate product mentioned in the present invention is shown in Table 1. The present invention designs two crRNAs with miRNA-21 (miR-21) and miRNA-375 (miR-375) as targets, and obtains crR-21 and crR-375 complementary to miR-21 and miR-375 bases respectively by changing the base composition of the spacer region, and forms a completely complementary hybrid double-stranded product with the target, and then binds to the CRISPR / Cas13a protein and activates its RNase activity, and trans-cuts the RNA-containing hairpin H1.

[0024] The stem of the hairpin H1 (TCTACACGUUUUUCGTGTAGA) is the DNA primer sequence P1 (GTGTAGA) that triggers the primer exchange reaction (PER); the circular part is the RNA substrate (UUUUU) cut by the CRISPR / Cas13a protein, which tightly seals the DNA primer by forming a tight hairpin structure. The CRISPR / Cas13a protein activated by target miRNAs trans-cuts the RNA in the circular part of H1, destroying the hairpin structure of H1 and releasing the single-stranded DNA primer P1 that triggers the polymerase-driven primer exchange reaction.

[0025] The 3' end of hairpin H2 protrudes an eight-base-long single-stranded DNA, which serves as the complementary recognition region of the DNA primer sequence P1 that triggers the primer exchange reaction; the 3' end of the hairpin is modified with an inverted T base to prevent nonspecific extension, and the GC base pair at the end of the hairpin stem is hydroxymethylated to prevent polymerase extension; with the help of Bst3.0 DNA polymerase, primer P1 uses H2 as a template and replicates and extends forward until it stops replicating and extending at the hydroxymethylated termination site. The complementary sequence on hairpin H2 and the primer extension sequence compete to displace the primer extension sequence P2 (GTGTAGAGAGGACAGTGGCGCTC) from H2, thereby participating in the next reaction.

[0026] The 5' end of the hairpin H3 is modified with a FAM fluorescent group, and the 3' end base complementary to it is modified with a BHQ1 fluorescent quenching group. The 3' end of H3 protrudes with multiple bases (CCACTGTCCTCTCTACAC) and exists in the form of a single-stranded DNA, which not only serves as the recognition region of the DNA primer P2 produced in the previous step, but also prevents non-specific digestion by exonuclease III. P2 produced from the primer exchange reaction in the previous step binds complementary to the single-stranded part of H3, triggering the cleavage of exonuclease III, cutting forward from the 3' end of the double-stranded DNA until the cutting is terminated in the single-stranded part, eventually causing P2 to be released to participate in the next cutting cycle, the hairpin structure of H3 is destroyed, and the fluorescent group is away from the quenching group, generating a fluorescent signal.

[0027] Table 1 Sequence information Name Nucleotide sequence (5'→3') H1 TCT ACA CGU UUU UCG TGT AGA (SEQ ID NO.1) H2 GAG GAG GAC AGT GGC GCT CmGmG GCC TTT TGG CmCmC GAG CGC CAC TGT CCT CTC TAC AC dT (SEQ ID NO. 2) H3 FAM-ATC TCT TAT TGG GCC TTT TTG GCC CAA TAA GAG AT-(BHQ1)-C CAC TGT CCT CTC TAC AC (SEQ ID NO.3) miR-21 UAG CUU AUC AGA CUG AUG UUG A (SEQ ID NO.4) crR-21 GAU UUA GAC UAC CCC AAA AAC GAA GGG GAC UAA AAC UCA ACA UCA GUC UGA UAA GCU AU (SEQ ID NO.5) miR-375 UUU GUU CGU UCG GCU CGC GUG A (SEQ ID NO.6) crR-375 GAU UUA GAC UAC CCC AAA AAC GAA GGG GAC UAA AAC UCA CGC GAG CCG AAC GAA CAA A (SEQ ID NO.7) miR-429 UAA UAC UGU CUG GUA AAA CCG U (SEQ ID NO.8) miR-210 CUG UGC GUG UGA CAG CGG CUG A (SEQ ID NO.9) miR-203 GUG AAA UGU UUA GGA CCA CUA G (SEQ ID NO.10) miR-200b UAA UAC UGC CUG GUA AUG AUG AC (SEQ ID NO.11) miR-143 UGA GAU GAA GCA CUG UAG CUC A (SEQ ID NO.12) miR-141 UAA CAC UGU CUG GUA AAG AUG G (SEQ ID NO.13) miR-25-3p CAU UGC ACU UGU CUC GGU CUG A (SEQ ID NO.14) let-7a UGA GGU AGU AGG UUG UAU AGU U (SEQ ID NO.15) Note: m represents hydroxymethylation modification, FAM represents carboxyfluorescein, and BHQ1 represents fluorescence quenching group.

[0028] All DNA and RNA oligonucleotides in the present invention were synthesized by Shanghai Shenggong Biotechnology Co., Ltd. and purified by high-performance liquid chromatography. LwaCa1s3a protein was purchased from Shanghai Jiying Biotechnology Co., Ltd., China. Bst 3.0 DNA polymerase, exonuclease III, 10 × rCutSmart buffer and buffer 1 were purchased from New England Biolabs (Beijing). 0.22 μm filter device and 100 KD ultrafiltration tube were purchased from Merck Millpore, Ireland. Cell exosome and miRNA extraction kits were purchased from Qiagen, China. miRNA first-strand cDNA synthesis kit (stem-loop method) was purchased from Shanghai Shenggong Biotechnology Co., Ltd. TB Green premixed Ex Taq II kit was purchased from TakaRa Biotechnology Co., Ltd., USA. Fluorescence spectra were obtained on F-7000 fluorescence spectrophotometer (Hitachi, Japan). Non-denaturing polyacrylamide gel electrophoresis (nPAGE) was performed on a Bio-Rad electrophoresis analyzer (Bio-Rad, USA), and the results were visualized on a Bio-rad ChemDoc XRS (Bio-Rad, USA). Ultracentrifugation was performed on a Beckman Optima XPN-100 (Beckman, USA). Transmission electron microscopy (TEM, FEITecnai G2 12) was used to characterize the morphology of exosomes. Nanoparticle tracking analysis (NTA, ZetaView PMX 110) was used to detect the concentration and size distribution of exosomes. RT-PCR was performed on a CFX96 real-time system (Bio-rad, USA).

[0029] Example 1 Using multiple biological enzymes to construct enzyme circuits to achieve ultrasensitive detection of multiple exosomal miRNAs The basic principle is as follows Figure 1As shown, the description is as follows: We selected miR-21 and miR-375 as targets because they are highly expressed in breast cancer-derived exosomes and have important diagnostic and staging value for these diseases. The present invention is divided into three modules, each of which plays a different role. In module A, two crRNAs targeting different miRNAs are assembled with LwaCas13a protein to establish a CRISPR / Cas13a-based logic element. We designed these crRNAs to target miR-21 and miR-375 based on the programmable spacer of crRNA. When miR-21 or miR-375 is present, the bases that are fully complementary to the crRNA verify its identity and successfully unlock the ribonuclease activity of the CRISPR / Cas13a system to trans-cut the hairpin H1, thereby releasing the DNA primer (P1) enclosed in H1. This carefully designed H1, composed of an RNA loop and a DNA stem, acts as a closed DNA primer, and significantly improves the trans-cutting efficiency of Cas13a compared with its linear counterpart due to its unique spatial structure. Module B has a DNA polymerase-assisted primer exchange reaction (PER) signal amplifier element. P1 generated in module A binds to the initiation binding domain on H2 through base complementarity, using the stem portion of H2 as a template and continuing to replicate until it reaches the hydroxymethylated termination site (red dot). Subsequently, the extended primer (P2) is displaced from H2 through a random walk process involving three-way branch migration. The recovered H2 binds to P1 again to participate in the next round of the PER circuit. Therefore, any sequence on H2 is added to the 3' end of P1 through the PER circuit. Module C acts as a signal output element, involving exonuclease III-mediated strand digestion. The P2 sequence obtained from the PER circuit binds to H3, prompting exonuclease III to gradually cleave bases from the 3'-OH end of H3 until the digestion of the single-stranded region stops. The destruction of the hairpin structure causes the fluorophore modified at the 5' end of H3 to move away from the quencher group, thereby releasing the fluorescent signal. At the same time, P2 is released, further triggering H3 digestion. After multiple cascade cycles, the logic meter achieved a 1:N or N:N signal output, making ultrasensitive and specific detection of exosomal miRNAs possible.

[0030] The specific steps are as follows: By mixing the synthesized single strand with TE-Mg 2+The buffer was mixed and annealed in a T100 thermal cycler to assemble hairpins H1, H2, and H3. The initial temperature was 95°C for 5 min, then decreased to 25°C at a rate of 0.1°C / s and maintained for at least 1 h. In the analysis of single biomarkers, we took miR-21 as an example. First, a 20 μL reaction system was constructed, containing different concentrations of exosomal miR-21, 35 nM Cas13a, 25 nM crR-21, 200 nM H1, 100 nM H2, 10 mM dNTP, 16 UBst3.0 DNA polymerase, and 1× rCutSmart buffer (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 100 μg / ml recombinant albumin, pH 7.9@25°C), to achieve targeted triggering of CRISPR / Cas13a activation and primer exchange reaction signal amplification in one step. Incubate at 37℃ for 2 h, inactivate at 80℃ for 5 min, take 5 μL and add to the reaction solution of 200 nM H3, 1 U / μL exonuclease III, 1×NEBuffer 1 (10 mM Bis-Tris-Propane-HCl, 10 mM MgCl2, 1mM DTT, pH 7 @ 25°C), add 9 μL enzyme-free water, and make up to 20 μL. The reaction was carried out at 37℃ for 40 min and heated at 70℃ for 20 min. The fluorescence spectrum of 200 μL mixed solution (add 180 μL enzyme-free water) was measured by fluorescence spectrophotometer. The detection parameters were set as follows: excitation wavelength of 480 nm, emission wavelength of 500~600 nm, and slits of excitation peak and emission peak were both 5 nm.

[0031] Example 2 uses a fluorescence spectrophotometer to detect fluorescence signals and collect fluorescence spectra. The specific steps are as follows: First, different reaction systems were constructed according to experimental requirements. Curves a to h represent reaction systems with different experimental conditions. a: Target miR-21 (10 nM), containing 35 nM Cas13a, 25 nM crR-21, 200 nM H1, 100 nM H2, 10 mM dNTP, 16 U Bst3.0 DNA polymerase, 1× rCutSmart buffer, 200 nM H3, 1 U / μL exonuclease III and 1× NEBuffer 1.

[0032] b: Without Cas13a / crRNA, containing 10 nM miR-21, 200 nM H1, 100 nM H2, 10 mM dNTPs, 16 UBst3.0 DNA polymerase, 1× rCutSmart buffer, 200 nM H3, 1 U / μL exonuclease III and 1× NEBuffer 1.

[0033] c: without H1, containing 10 nM miR-21, 35 nM Cas13a, 25 nM crR-21, 100 nM H2, 10 mM dNTPs, 16 U Bst3.0 DNA polymerase, 1× rCutSmart buffer, 200 nM H3, 1 U / μL exonuclease III and 1× NEBuffer 1.

[0034] d: without H2, containing 10 nM miR-21, 35 nM Cas13a, 25 nM crR-21, 100 nM H1, 10 mM dNTP, 16 U Bst3.0 DNA polymerase, 1× rCutSmart buffer, 200 nM H3, 1 U / μL exonuclease III and 1× NEBuffer 1.

[0035] e: Without Bst3.0 DNA polymerase, containing 10 nM miR-21, 35 nM Cas13a, 25 nM crR-21, 100 nM H1, 100 nM H2, 10 mM dNTPs, 1× rCutSmart buffer, 200 nM H3, 1 U / μL exonuclease III and 1× NEBuffer 1.

[0036] f: without H3, containing 10 nM miR-21, 35 nM Cas13a, 25 nM crR-21, 100 nM H1, 100 nM H2, 10 mM dNTPs, 16 U Bst3.0 DNA polymerase, 1× rCutSmart buffer, 1 U / μL exonuclease III and 1× NEBuffer 1.

[0037] g: Without exonuclease III, containing 10 nM miR-21, 35 nM Cas13a, 25 nM crR-21, 100 nM H1, 100 nM H2, 10 mM dNTP, 16 U Bst3.0 DNA polymerase, 200 nM H3, 1× rCutSmart buffer, 1× NEBuffer 1.

[0038] h: Negative control (no target miR-21), containing 35 nM Cas13a, 25 nM crR-21, 200 nM H1, 100 nM H2, 10 mM dNTPs, 16 U Bst3.0 DNA polymerase, 1× rCutSmart buffer, 200 nM H3, 1 U / μL exonuclease III and 1× NEBuffer 1. The reaction system was divided into two steps according to the method of Example 1. 10 nM miR-21, 35 nM Cas13a, 25 nM crR-21, 200 nM H1, 100 nM H2, 10 mM dNTP, 16 U Bst3.0 DNA polymerase, and 1× rCutSmart buffer were first reacted at room temperature to achieve targeted triggering of CRISPR / Cas13a activation and primer exchange reaction signal amplification and inactivation, and then 200 nM H3, 1 U / μL exonuclease III and 1× NEBuffer 1 were added. After reaction and inactivation at room temperature, 180 μL enzyme-free water was added and mixed, and the mixture was detected on a fluorescence spectrophotometer. The results are shown in FIG. Figure 2 As shown, it can be seen that the logic detector shows the strongest fluorescence signal when the target miR-21 is present, and the fluorescence intensity shows a significant difference from the negative control, which proves the feasibility of the present invention. At the same time, none of the key conditions will lead to amplification failure. Compared with the negative control, the lack of key conditions leads to negligible fluorescence increment. Therefore, each element involved in the present invention is very important.

[0039] Example 3 The target miR-21 was diluted according to a predetermined concentration gradient and added to the reaction system, and the following concentration gradient was finally obtained: 100 nM, 50 nM, 10 nM, 1 nM, 100 pM, 10 pM, 1 pM, 100 fM, 10 fM. Finally, the fluorescence signal was detected by a fluorescence spectrophotometer to evaluate the detection sensitivity of the present invention. Figure 3 As shown in the figure, as the concentration of miR-21 decreases, the fluorescence signal of the present invention also decreases. In the range of 10 fM ~ 1 nM, the logarithm of the miR-21 concentration and the fluorescence intensity show a good linear relationship, which is fitted to FI = 79.36 lgC miR-21 + 277.02, correlation coefficient (R 2 ) is 0.9960. According to the 3σ / S rule, the detection limit of the present invention is 2.1 fM, which shows better sensitivity compared with the sensing performance of other reported methods.

[0040] Example 4 We selected different miRNAs and added them to the reaction system, detected the fluorescence signal, and evaluated the specificity of the present invention. These miRNAs were kept at a concentration ten times higher than our target miR-21 to challenge the anti-interference ability of the logic detector.

[0041] Sample 1: does not contain any miRNA; Sample 2: contains 100 nM let-7a; Sample 3: containing 100 nM miR-25-3P; Sample 4: contains 100 nM miR-141; Sample 5: contains 100 nM miR-143; Sample 6: contains 100 nM miR-200b; Sample 7: contains 100 nM miR-203; Sample 8: contains 100 nM miR-210; Sample 9: contains 100 nM miR-429; Sample 10: contains 10 nM miR-21; Sample 11: contains 10 nM miR-375; Sample 12: Contains 10 nM miR-21 and miR-375; A reaction system was established according to Example 1, comprising 35 nM Cas13a, 25 nM crR-21, 25 nM crR-375, 200 nM H1, 100 nM H2, 10 mM dNTP, 16 U Bst3.0 DNA polymerase, 1× rCutSmart buffer, 200 nM H3, 1 U / μL exonuclease III and 1× NEBuffer 1. The incubation time was 2 hours followed by inactivation and then 40 minutes of reaction. The fluorescence signal was detected by a fluorescence spectrophotometer.

[0042] The results are as follows Figure 4 As shown, compared with samples 10-12, all interfering miRNAs showed fluorescence intensities similar to the blank control (sample 1), and only the target miR-21, miR-375 or a mixture of the two showed obvious signal enhancement and showed statistically significant differences with other controls, demonstrating the good specificity of the present invention.

[0043] Example 5 In the present invention, we target miR-375 associated with malignant breast cancer by modifying the spacer sequence of crRNA, expanding the scope of application of our method. Two crRNAs targeting miR-21 (input 1: crR-21) and miR-375 (input 2: crR-375) are used as recognition elements of the OR logic gate. The presence of one or both inputs activates the nuclease activity of Cas13a to cut the same substrate, thereby producing the same output signal.

[0044] Sample 1: target miR-21 (10 nM), containing 35 nM Cas13a, 25 nM crR-21, 200 nM H1, 100 nM H2, 10 mM dNTP, 16 U Bst3.0 DNA polymerase, 1× rCutSmart buffer, 200 nM H3, 1 U / μL exonuclease III and 1× NEBuffer 1. Other reaction conditions were the same as in Example 1.

[0045] Sample 2: target miR-375 (10 nM), containing 35 nM Cas13a, 25 nM crR-375, 200 nM H1, 100 nM H2, 10 mM dNTP, 16 U Bst3.0 DNA polymerase, 1× rCutSmart buffer, 200 nM H3, 1 U / μL exonuclease III and 1× NEBuffer 1. Other reaction conditions were the same as in Example 1.

[0046] Sample 3: target miR-21 (10 nM) and target miR-375 (10 nM), including 35 nM Cas13a, 25 nM crR-21, 25 nM crR-375, 200 nM H1, 100 nM H2, 10 mM dNTP, 16 U Bst3.0 DNA polymerase, 1× rCutSmart buffer, 200 nM H3, 1 U / μL exonuclease III and 1× NEBuffer 1. Other reaction conditions were the same as in Example 1.

[0047] Sample 4: Negative control The results are as follows Figure 5 As shown, it was demonstrated that the presence of these two miRNAs alone or in combination could lead to significant fluorescence enhancement compared with the negative control, thereby proving that the present invention has the ability of multiplex detection and analysis, showing a high versatility potential.

[0048] Example 6 The extracted RNA was subjected to fluorescence detection by the present invention and compared with the traditional gold standard method RT-PCR. The operating steps of RT-PCR are as follows: Total RNA was extracted from exosomes of two cancer cells MCF-7 and MDA-MB-231. The quality and quantity of total RNA were detected by NanoDrop and stored at -80°C for use. cDNA was synthesized using a miRNA first-strand cDNA synthesis kit. Reverse transcription was performed at 16°C for 30 min, 37°C for 30 min, and 85°C for 5 min. The relative expression of exosomal miRNA was calculated using U6 snRNA as an internal reference. 2 μL of cDNA product was mixed with 1 × TB Green Premix Ex Taq II solution, 0.4 μM forward and reverse primers, and enzyme-free water to a final volume of 25 μL. The reaction was performed on a CFX96 Real-Time system with a program of 95°C for 30 s; denaturation (95°C for 5 s) and annealing (60°C for 30 s) for 40 cycles. The primers used for fluorescence quantification are as follows: miR-21 RT: 5'-GTC GTA TCC AGT GCA GGG TCC GAG GTA TTC GCA CTG GAT ACGACT CAA CA-3' (SEQ ID NO.16); miR-21 Forward: 5'-GCG CGT AGC TTA TCA GAC TGA-3' (SEQ ID NO. 17); miR-21 Reverse: 5'-ATC CAG TGC AGG GTC CGA GG-3' (SEQ ID NO.18); U6 RT: 5'-GTC GTA TCC AGT GCA GGG TCC GAG GTA-3' (SEQ ID NO. 19); U6 Forward: 5'-AGA GAA GAT TAG CAT GGC CCC TG-3' (SEQ ID NO. 20); U6 Reverse: 5'-ATC CAG TGC AGG GTC CGA GG-3' (SEQ ID NO. 21).

[0049] The results are as follows Figure 6 As shown, the results of the present invention are highly consistent with those of RT-PCR, proving that the present invention has comparable analytical capabilities and reliable results compared to the gold standard detection method.

[0050] Example 7: Collect exosomes from breast cancer cells by ultracentrifugation, and identify their morphology and surface markers. Figure 7 As shown, transmission electron microscopy showed that the extracted exosomes exhibited a typical teacup structure and a partially collapsed structure. NTA results showed that the average diameter of the exosomes was 133nm, which is consistent with the standard exosome size (30-150nm). The specific experimental steps are as follows: MCF-7 and MDA-MB-231 cells were cultured in complete DMEM supplemented with 10% bovine serum and 1% penicillin-streptomycin. MCF-10A cells were cultured in DMEM supplemented with 5% horse serum, 20 ng / mL EGF, 0.5 μg / mL hydrocortisone, 10 μg / mL insulin, 1% non-essential amino acids, and 1% penicillin / streptomycin. All cells were cultured in a humidified atmosphere of 5% CO2 at 37°C. When the cell density reached 70%, the cells were cultured in a serum-free environment for 48 h, and then exosomes were isolated. The cell supernatant was collected and centrifuged at 800 × g for 10 min and 2000 × g for 20 min. The supernatant was filtered through a 0.22 μm filter. Afterwards, it was concentrated using a 100 KD ultrafiltration tube at 3000 rpm for 5 min. Finally, the supernatant was centrifuged at 100,000 × g for 2 h to collect the exosomes. The collected exosomes were resuspended in PBS and stored at -80°C. The extracted exosomes were subjected to transmission electron microscopy and nanoparticle size tracing analysis.

[0051] The above-described embodiments are only preferred embodiments for fully illustrating the present invention, and the protection scope of the present invention is not limited thereto. Equivalent substitutions or changes made by those skilled in the art based on the present invention are within the protection scope of the present invention. The protection scope of the present invention shall be subject to the claims.

Claims

1. A multi-enzyme-assisted fluorescent biosensor for logical detection of exosomal miRNAs, characterized in that: The fluorescent biosensor includes a CRISPR / Cas13a protein system, a DNA polymerase-driven primer exchange reaction system, and an exonuclease reaction system; The CRISPR / Cas13a protein system includes Cas13a protein and its corresponding crRNA, and hairpin H1; the crRNA can complement the target miRNA to be detected to form a hybrid double-stranded binding Cas13a protein and activate its RNase activity, trans-cut the hairpin H1 containing the RNA loop, and release the single-stranded DNA primer P1 enclosed in H1; The DNA polymerase-driven primer exchange reaction system includes Bst3.0 DNA polymerase and its buffer, hairpin H2 and dNTP; the 3' end of the hairpin H2 protrudes a single-stranded DNA of eight bases in length, which serves as a complementary recognition region of the DNA primer P1 that triggers the primer exchange reaction; the 3' end of the hairpin H2 is modified with an inverted T base to prevent non-specific extension, and the GC base pair at the end of the stem of the hairpin H2 is hydroxymethylated to prevent the extension of the polymerase; with the help of Bst3.0 DNA polymerase, the primer P1 uses the stem of the hairpin H2 as a template, replicates and extends forward, and terminates at the hydroxymethylated site to generate a primer extension sequence P2, and the complementary sequence on the hairpin H2 replaces the primer extension sequence P2 from H2 through competition, thereby participating in the next reaction; The exonuclease reaction system includes a hairpin H3, an exonuclease III and a buffer thereof; the 5' end of the hairpin H3 is modified with a fluorescent group, and the 3' end base complementary to the base is modified with a fluorescent quenching group; the 3' end of the hairpin H3 protrudes with multiple bases in the form of a single-stranded DNA, which not only serves as a recognition region for the primer extension sequence P2 generated in the previous step reaction, but also prevents non-specific digestion by the exonuclease III; the primer extension sequence P2 generated from the primer exchange reaction in the previous step is complementary to the single-stranded portion of H3 to form a double-stranded DNA, triggering the cutting of the exonuclease III, cutting forward from the 3' end of the double-stranded DNA until the cutting is terminated at the single-stranded portion, ultimately resulting in the release of P2 to participate in the next cutting cycle, the hairpin structure of H3 is destroyed, the fluorescent group is away from the quenching group, and a fluorescent signal is generated; The nucleotide sequence of hairpin H1 is TCTACACGUUUUUCGTGTAGA; The nucleotide sequence of primer P1 is GTGTAGA; The nucleotide sequence of hairpin H2 is GAGGACAGTGGCGCTCmGmGGCCTTTTGGCmCmCGAGCGCCACTGTCCTCTCTACACdT; The nucleotide sequence of primer extension sequence P2 is GTGTAGAGAGGACAGTGGCGCTC; The nucleotide sequence of hairpin H3 is FAM-ATCTCTTATTGGGCCTTTTTGGCCCAATAAGAGAT-(BHQ1)-CCACTGTCCTCTCTACAC.

2. The fluorescent biosensor according to claim 1, characterized in that: When the target miRNA to be detected is miRNA-21 or / and miRNA-375, the corresponding crRNAs are GAUUUAGAC UACCCCAAAAACGAAGGGGACUAAAACUCAACAUCAGUCUGAUAAGCUAU or / and GAU UUAGACUACCCCAAAAACGAAGGGGACUAAAACUCACGCGAGCCGAACGAACAA A respectively.

3. The fluorescent biosensor according to claim 1, characterized in that: The detection method includes the following steps: first, a sample containing the target miRNA to be detected is mixed with the CRISPR / Cas13a protein system and the primer exchange reaction system driven by DNA polymerase for the first incubation, and the DNA polymerase activity is inactivated after the reaction is completed; then, it is added to the nuclease exonuclease reaction system for a second incubation, and the nuclease exonuclease activity is inactivated after the reaction is completed; finally, the fluorescence value is detected.

4. The fluorescent biosensor according to claim 3, characterized in that: The final concentrations of the components in the reaction system of the fluorescent biosensor are: Cas13a protein 35 nM, crRNA 25 nM, hairpin H1 200 nM, hairpin H2 100 nM, dNTP 10 mM, Bst3.0 DNA polymerase 16 U / 20 μL, hairpin H3 200 nM, and exonuclease III 1 U / μL.

5. The fluorescent biosensor according to claim 3, characterized in that: The reaction condition for the first incubation was 37°C for 2 h, and the reaction condition for inactivating DNA polymerase activity was 80°C for 5 min.

6. The fluorescent biosensor according to claim 3, characterized in that: The reaction conditions for the second incubation were 37°C for 40 min, and the reaction conditions for inactivating the exonuclease activity were heating at 70°C for 20 min.

7. The fluorescent biosensor according to claim 3, characterized in that: When detecting the fluorescence value, the parameters were set as follows: the excitation wavelength was 480 nm, the emission wavelength was 500-600 nm, and the slits of the excitation peak and emission peak were both 5 nm.

Images