Application of circBCO2 as liver cancer drug target and prognostic marker

Abstract

The present disclosure provides novel therapeutic targets and markers circBCO2 that inhibit the progression of liver cancer, particularly hepatocellular carcinoma. The circBCO2 can be used as a potential therapeutic target for inhibiting the progress of the liver cancer by inhibiting the expression of the circBCO2 or destroying a signal channel regulated by the circBCO2, and meanwhile, the circBCO2 can also be used as a marker of HCC (Hepatocellular Carcinoma), especially a prognostic marker.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to the application of circBCO2 as a liver cancer drug target and marker. Background Art

[0002] Hepatocellular carcinoma (HCC) is considered the third leading cause of cancer-related death worldwide. The asymptomatic nature of HCC often leads to late diagnosis, which greatly limits the options for curative treatment. Despite advances in surgical and systemic treatments, the overall survival (OS) of HCC patients remains dismally low. Therefore, discovering new therapeutic targets and understanding their molecular mechanisms are crucial to prolonging the overall survival of HCC patients.

[0003] Circular RNAs (circRNAs) are unique RNA structures formed by backsplicing of exons, introns, untranslated or antisense sequences. Compared with linear RNAs, circRNAs have a covalently closed loop structure, which confers them extraordinary stability and enables them to resist degradation by exoribonucleases. The inherent stability of circRNAs enables them to perform important functions in various biological processes, especially in the progression of cancer. CircRNAs can effectively regulate gene expression, and the most common way that circRNAs promote cancer development and progression is that they interact with key components of major signaling pathways. Emerging evidence highlights the involvement of circRNAs in the tumorigenesis of various cancers, including HCC. A large body of evidence supports that circRNAs are associated with the progression of human diseases through interactions with signaling pathways, and their potential as biomarkers has been demonstrated. In particular, circRNAs have been commonly shown to interfere with tumor proliferation, migration, invasion, and metastasis, suggesting their potential as diagnostic biomarkers and therapeutic targets. Therefore, the development of novel circRNAs as new therapeutic targets and prognostic markers in HCC is urgently needed. Summary of the invention

[0004] The present disclosure provides a new therapeutic target and marker circBCO2 for inhibiting the progression of liver cancer, especially hepatocellular carcinoma. CircBCO2 drives the progression of liver cancer by inhibiting the downstream miR-590-5p / LANCL1 / ROS signaling pathway. Inhibiting the expression of circBCO2 or disrupting the signaling pathway regulated by it can serve as a new potential therapeutic target for inhibiting the progression of HCC. At the same time, circBCO2 can also be used as a marker for HCC.

[0005] According to one aspect of the present disclosure, a drug target for preventing and / or treating liver cancer is provided, wherein the drug target comprises circBCO2.

[0006] In some embodiments, the circBCO2 drives the progression of liver cancer by inhibiting the downstream miR-590-5p, LANCL1 and / or ROS signaling pathways.

[0007] In some embodiments, the liver cancer includes hepatocellular carcinoma, cholangiocarcinoma, hepatic angiosarcoma and / or hepatoblastoma, preferably hepatocellular carcinoma.

[0008] According to another aspect of the present disclosure, a method for screening drugs for preventing and / or treating lung cancer is provided, wherein the method comprises screening the drugs using the drugs according to the present disclosure as targets.

[0009] In some embodiments, the liver cancer includes hepatocellular carcinoma, cholangiocarcinoma, hepatic angiosarcoma and / or hepatoblastoma, preferably hepatocellular carcinoma.

[0010] In some embodiments, the drug further comprises other active ingredients for preventing and / or treating liver cancer, including but not limited to multi-target tyrosine kinase inhibitors (such as lenvatinib, regorafenib, sorafenib, etc.), VEGFR antagonists (such as apatinib, axitinib, etc.), VEGF / VEGFR monoclonal antibodies (such as bevacizumab, ramucirumab, etc.).

[0011] In some embodiments, the medicament further comprises a pharmaceutically acceptable excipient.

[0012] In some embodiments, the pharmaceutically acceptable excipient includes at least one of a diluent, an excipient, a binder, a wetting agent, a surfactant, a lubricant, and a disintegrant.

[0013] In some embodiments, the dosage form is selected from a dosage form for enteral administration or a dosage form for parenteral administration.

[0014] In some embodiments, the dosage form for administration via the gastrointestinal tract comprises at least one of powders, tablets, granules, capsules, sustained-release agents, solutions, dry suspensions, effervescent tablets, emulsions, suspensions, syrups, drops, and chewable tablets.

[0015] In some embodiments, the non-gastrointestinal administration dosage form comprises at least one of an injection dosage form, a respiratory tract administration dosage form, a skin administration dosage form, a mucosal administration dosage form, and a cavity administration dosage form.

[0016] In some embodiments, the drug is administered to an animal.

[0017] According to another aspect of the present disclosure, a circBCO2 inhibitor is provided, comprising a substance that inhibits the expression of circBCO2, inhibits the activity of circBCO2, reduces the content of circBCO2, silences, knocks down or knocks out the circBCO2 gene, or destroys the signal pathway regulated by circBCO2.

[0018] In some embodiments, the signaling pathway regulated by circBCO2 includes miR-590-5p, LANCL1 and / or ROS signaling pathways.

[0019] In some embodiments, the circBCO2 inhibitor comprises at least one of a small molecule compound, a peptide, a peptide mimetic, a matrix analog, an aptamer, an antibody, a dsRNA, a shRNA, a microRNA, a siRNA, and a sgRNA.

[0020] In some embodiments, the circBCO2 inhibitor comprises shRNA, preferably the shRNA has a sequence as shown in SEQ ID NO:1.

[0021] According to another aspect of the present disclosure, provided is a use of the circBCO2 inhibitor described in the present disclosure in the preparation of a medicament for preventing and / or treating liver cancer.

[0022] In some embodiments, the liver cancer includes hepatocellular carcinoma, cholangiocarcinoma, hepatic angiosarcoma and / or hepatoblastoma, preferably hepatocellular carcinoma.

[0023] According to yet another aspect of the present disclosure, a marker for liver cancer is provided, wherein the marker comprises circBCO2.

[0024] In some embodiments, the liver cancer includes hepatocellular carcinoma, cholangiocarcinoma, hepatic angiosarcoma and / or hepatoblastoma, preferably hepatocellular carcinoma.

[0025] In some embodiments, the marker comprises a prognostic marker.

[0026] According to another aspect of the present disclosure, provided is the use of the marker described in the present disclosure in preparing a product for diagnosing and / or prognosing liver cancer.

[0027] In some embodiments, the liver cancer includes hepatocellular carcinoma, cholangiocarcinoma, hepatic angiosarcoma and / or hepatoblastoma, preferably hepatocellular carcinoma.

[0028] In some embodiments, the product includes a substance for detecting a marker described in the present disclosure at the gene level and / or protein level.

[0029] In some embodiments, the substance includes a substance for at least one detection technique or method selected from the group consisting of immunohistochemistry, Western blotting, Northern blotting, PCR, biochip, nucleic acid sequencing, amino acid sequencing, high performance liquid chromatography, capillary gel electrophoresis, near infrared spectroscopy, mass spectrometry, surface plasmon resonance technology, immuno-PCR technology, and biotin-avidin technology.

[0030] In some embodiments, the immunohistochemistry method includes at least one of enzyme-linked immunosorbent assay, immunofluorescence assay, radioimmunoassay, co-immunoprecipitation, immunochemiluminescence, colloidal gold immunoassay, fluorescent immunochromatography, complement fixation analysis, flow cytometry fluorescence resolution, and single molecule detection technology.

[0031] In some embodiments, the substance includes at least one of a substance specific to circBCO2, a probe that specifically recognizes circBCO2, a gene chip, a protein chip, and a primer that specifically amplifies circBCO2.

[0032] In some embodiments, the substance specific to circBCO2 includes at least one of an antibody that specifically binds to circBCO2, a ligand protein or polypeptide that specifically binds to circBCO2, a non-protein compound that specifically recognizes circBCO2, or a nucleic acid aptamer that specifically recognizes circBCO2; preferably, the product includes a reagent, a test plate, a test paper, a device, a system, a kit, a chip or a nucleic acid membrane strip.

[0033] In some embodiments, the product further comprises other substances for the diagnosis and / or prognostic assessment of liver cancer;

[0034] Preferably, the product further comprises auxiliary detection reagents for gene expression, and the auxiliary detection reagents for gene expression include: a reaction reagent for visualizing the amplicon corresponding to the primer, an RNA extraction reagent, a reverse transcription reagent, a cDNA amplification reagent, a standard substance used to prepare a standard curve, and at least one of a positive control substance.

[0035] In some embodiments, the product further comprises an auxiliary detection reagent for protein expression, and the auxiliary detection reagent for protein expression comprises at least one of a color developer, a blocking solution, an antibody diluent, a washing buffer, a color stop solution, a standard substance used to prepare a standard curve, and a positive control substance.

[0036] In some embodiments, the test sample of the product is selected from at least one of body fluids, tissues, cells, and excrement of the subject to be tested.

[0037] In some embodiments, the subject to be tested comprises an animal.

[0038] According to another aspect of the present disclosure, a product for diagnosing and / or prognosing liver cancer is provided, the product comprising a substance for detecting the markers described in the present disclosure at the gene level and / or protein level.

[0039] In some embodiments, the product includes a substance for detecting a marker described in the present disclosure at the gene level and / or protein level.

[0040] In some embodiments, the substance includes a substance for at least one detection technique or method selected from the group consisting of immunohistochemistry, Western blotting, Northern blotting, PCR, biochip, nucleic acid sequencing, amino acid sequencing, high performance liquid chromatography, capillary gel electrophoresis, near infrared spectroscopy, mass spectrometry, surface plasmon resonance technology, immuno-PCR technology, and biotin-avidin technology.

[0041] In some embodiments, the immunohistochemistry method includes at least one of enzyme-linked immunosorbent assay, immunofluorescence assay, radioimmunoassay, co-immunoprecipitation, immunochemiluminescence, colloidal gold immunoassay, fluorescent immunochromatography, complement fixation analysis, flow cytometry fluorescence resolution, and single molecule detection technology.

[0042] In some embodiments, the substance includes at least one of a substance specific to circBCO2, a probe that specifically recognizes circBCO2, a gene chip, a protein chip, and a primer that specifically amplifies circBCO2.

[0043] In some embodiments, the substance specific to circBCO2 includes at least one of an antibody that specifically binds to circBCO2, a ligand protein or polypeptide that specifically binds to circBCO2, a non-protein compound that specifically recognizes circBCO2, or a nucleic acid aptamer that specifically recognizes circBCO2; preferably, the product includes a reagent, a test plate, a test paper, a device, a system, a kit, a chip or a nucleic acid membrane strip.

[0044] In some embodiments, the product further comprises other substances for the diagnosis and / or prognostic assessment of liver cancer;

[0045] Preferably, the product further comprises auxiliary detection reagents for gene expression, and the auxiliary detection reagents for gene expression include: a reaction reagent for visualizing the amplicon corresponding to the primer, an RNA extraction reagent, a reverse transcription reagent, a cDNA amplification reagent, a standard substance used to prepare a standard curve, and at least one of a positive control substance.

[0046] In some embodiments, the product further comprises an auxiliary detection reagent for protein expression, and the auxiliary detection reagent for protein expression comprises at least one of a color developer, a blocking solution, an antibody diluent, a washing buffer, a color stop solution, a standard substance used to prepare a standard curve, and a positive control substance.

[0047] In some embodiments, the test sample of the product is selected from at least one of body fluids, tissues, cells, and excrement of the subject to be tested.

[0048] In some embodiments, the subject to be tested comprises an animal.

[0049] According to another aspect of the present disclosure, a system for diagnosing and / or prognosing liver cancer is provided, the system comprising:

[0050] Detection component: The detection component is used to detect the markers described in the present disclosure at the gene level and / or protein level;

[0051] Result judgment component: The result judgment component is used to output a diagnosis and / or prognosis result according to the result of the marker detected by the detection component.

[0052] The present disclosure first discovered that circular RNA circBCO2 is a new potential therapeutic target and marker, especially a prognostic marker, in liver cancer, especially hepatocellular carcinoma, as an inhibitor of the progression of hepatocellular carcinoma. Inhibiting the expression of circBCO2 or disrupting the signaling pathway regulated by it can be used as a therapeutic target for inhibiting the progression of liver cancer; at the same time, circBCO2 can also be used as a prognostic marker for diagnosing liver cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] Figure 1 The results of screening for differentially expressed circRNAs in hepatocellular carcinoma are shown. A, heat map showing differentially expressed circular RNAs in six HCC and adjacent non-tumor tissues, with circBCO2 indicated by red arrows. (adjacent tissues: adjacent tissues; tumor tissues: cancer tissues). B, volcano map showing 259 upregulated and 277 downregulated circular RNAs in HCC tissues compared with matched normal tissues, with circBCO2 indicated by blue arrows.

[0054] Figure 2The expression level of circBCO2 in HCC and its relationship with overall survival rate are shown. A, the expression of circBCO2 in clinical samples, low expression in adjacent tissues and high expression in cancer tissues (adjacent: adjacent tissues; tumor: cancer tissues). B, the expression of circBCO2 in different cell lines, low expression in normal cells and high expression in liver cancer cells (LO2: human normal liver cells; Huh7, Hep3B, HepG2, SK: liver cancer cell lines). C, the overall survival rate of patients with hepatocellular carcinoma constructed from clinical follow-up data, patients with high circBCO2 expression levels have a worse prognosis.

[0055] Figure 3 It shows that knocking down circBCO2 inhibits the progression of hepatocellular carcinoma. Among them, A, the proliferation ability of cells in shRNA circBCO2 was significantly reduced compared with the control group (sh-NC group). B, the cell scratch experiment showed that the migration ability of cells in shRNA circBCO2 was significantly reduced compared with the control group (sh-NC group). Scale bar: 50μm. C, the cell transwell experiment showed that the migration and invasion abilities of cells in shRNA circBCO2 were significantly reduced compared with the control group (sh-NC group). Scale bar: 50μm. D, H&E staining of mouse liver showed that tumor growth in orthotopic model mice was inhibited after circBCO2 knockdown treatment compared with the control group (sh-NC group). Scale bar: 100μm. E, mouse liver proliferation indicator (Ki67) staining showed that the number of cell proliferation in orthotopic model mice was significantly reduced after circBCO2 knockdown treatment compared with the control group (sh-NC group). Scale bar: 100μm.

[0056] Figure 4 The restoration of HCC progression using key gene inhibitors of the downstream signaling pathway regulated by circBCO2 or exogenous proteins is shown. Among them, AB, the proliferation and migration abilities of cells co-incubated with key gene inhibitors of the downstream pathway of circBCO2 and exogenous proteins were significantly higher than those of the control group (sh-circBCO2 group). C, the tumor growth curve of the subcutaneous mouse model showed that after stimulation with key gene inhibitors of the downstream pathway of circBCO2 and exogenous proteins, the proliferation ability of the tumor was reversed and significantly higher than that of the control group (sh-circBCO2 group). D, tumor growth size picture of the subcutaneous mouse model. E, statistical graph of tumor weight in the subcutaneous mouse model. After stimulation with key gene inhibitors of the downstream pathway of circBCO2 and exogenous proteins, the proliferation ability of the tumor was reversed and significantly higher than that of the control group (sh-circBCO2 group). DETAILED DESCRIPTION

[0057] The present disclosure provides a new potential therapeutic target and prognostic marker circBCO2 for inhibiting the progression of hepatocellular carcinoma, which drives the progression of HCC by inhibiting the downstream miR-590-5p / LANCL1 / ROS signaling pathway.

[0058] The present invention screened for differentially expressed circBCO2 through sequencing of HCC clinical samples, and analyzed the expression level of circBCO2 in HCC patients and its effect on survival rate.

[0059] The present invention discloses using shRNA circBCO2 to obtain a stably transfected liver cancer cell line in which circBCO2 is knocked down, and studies the development of HCC in the shRNA circBCO2 stably transfected cell line under in vivo and in vitro conditions.

[0060] The present disclosure also uses key gene inhibitors or exogenous proteins of the downstream signaling pathway regulated by circBCO2 to study the improvement of HCC by circBCO2 in vivo and in vitro.

[0061] Example 1 Sequencing and screening of differentially expressed circRNAs in hepatocellular carcinoma

[0062] In order to discover differentially expressed circRNAs in hepatocellular carcinoma (HCC), tissue samples were collected from 6 patients with hepatocellular carcinoma (4 males and 2 females), who also underwent primary HCC resection and had not received preoperative treatment before. The 6 human samples used in this example were all from the Sun Yat-sen University Cancer Center (SYSUCC), and all participants provided written informed consent. Total RNA was separated and purified by TRIzol reagent. In order to enrich circular RNA, DNA was removed by DNase I and linear RNA was removed by RNase r in this example. The library was constructed using the MGIEasy rRNA Removal Kit (1000005953, MGI) and the MGIEasy RNA Directional Library Preparation Reagent Kit (1000006386, MGI). Specifically, the RNA after linearization was captured by Poly A, and after fragmentation, random oligonucleotides were used as primers to synthesize the first chain of cDNA in the M-MuLV reverse transcriptase system. Subsequently, dUTP was used to replace dTTP when synthesizing the second chain. After the linker was connected, the synthesized second chain was degraded with UDG enzyme, leaving only the first chain of cDNA with different sequence linkers at both ends for subsequent PCR amplification, and finally the library was obtained.

[0063] Deep sequencing of circRNA was performed on the Illumina HiSeq4000 platform, and the raw data was processed by FastQC to ensure data quality. The sequences were mapped to the reference genome using BWA software. Then, circRNA identification was performed using CIRI software. Finally, bioinformatics analysis was performed to screen out the circRNA-circBCO2 with significantly upregulated differential expression.

[0064] The heat map results in the analysis results show the differentially expressed circular RNAs in six HCC samples and their adjacent non-tumor tissues. The red arrows represent the differentially expressed circRNA-circBCO2 ( Figure 1 A). At the same time, the volcano plot also shows the differentially expressed circular RNAs in HCC tissues, among which the blue arrow indicates circBCO2 ( Figure 1 B).

[0065] Example 2 Expression level of circBCO2 in HCC and its effect on overall survival rate

[0066] To verify the expression of circBCO2 in hepatocellular carcinoma and its effect on survival, HCC clinical tissue samples collected separately (the human samples used in this example were all from the Sun Yat-sen University Cancer Center (SYSUCC), and all participants provided written informed consent) and different hepatocellular carcinoma cell lines Huh7 cells, Hep3B cells, HepG2 cells and SK cells were quantitatively analyzed (human liver normal cell line LO2 was used as a control). First, total RNA was extracted from clinical tissues and HCC cells using TRIzol reagent. Subsequently, 1 μg of RNA was converted into cDNA using PrimeScript RT Reagent Kit (RR047A, TaKaRa). CircRNA PCR primers (F: CTTCACCAGTTCAGAATCCA (SEQ ID NO: 4); R: CTCAAACCTGGACATG (SEQ ID NO: 5)) were used for quantitative detection, and the clinical follow-up data of patients with HCC tissues collected in this example were plotted for survival curves.

[0067] In the quantitative results, it was found that the expression of circBCO2 in clinical tissue samples showed a trend of high expression compared with the control adjacent cancer tissues ( Figure 2 A), the expression in liver cancer cell lines also showed a trend of high expression compared with the control normal cell lines, indicating that circBCO2 is highly expressed in cancer ( Figure 2 B).

[0068] The effect of circBCO2 on overall survival was plotted using clinical follow-up data. The overall survival curve demonstrated that high expression of circBCO2 was associated with a poorer prognosis ( Figure 2 C) confirmed that circBCO2 plays a carcinogenic role in HCC, suggesting that circBCO2 can be used as a prognostic marker for HCC.

[0069] Example 3 Knockdown of circBCO2 inhibits HCC progression

[0070] 1. In vitro experiments

[0071] In order to study the effect of changes in circBCO2 on the progression of HCC, in vitro experiments were performed on liver cancer cells to knock down circBCO2 and construct a stable cell line. First, the corresponding RNA interference fragment (shRNA circBCO2: TTTATCAGGTACAATCATTGG (SEQ ID NO: 1) was designed according to the circBCO2 circular sequence (SEQ ID NO: 2), and the pHBLVCMVIE-Puro lentiviral vector was constructed. The lentivirus was then packaged and transfected into the Huh7 cell line. After 48 hours of transfection, the medium was replaced with DMEM medium (C11995500BT, Gibco) and cultured for 3 days. After one week, puromycin was used for screening to eliminate untransfected cells to obtain a stable cell line sh-circBCO2. At the same time, a control cell line sh-NC was constructed according to the same method, wherein the sh-NC sequence was UAAGGCUAUGAAGAGAUAC (SEQ ID NO: 3).

[0072] The sequence of circBCO2 (SEQ ID NO: 2) is:

[0073] GTACAATCATTGGTTTGATGGGATGGCGCTGCTTCACCAGTTCAGAATGGCAAAGGGCACAGTGACATACAGGAGCAAGTTTCTACAGAGTGATACATATAAGGCCAACAGTGCTAAAAACCGAATTGTGATCTCAGAATTTGGCACACTGGCTCTCCCGGATCCATGCAAGAATGTTTTTGAACGTTTCATGTCCAGGTTTGAGCTGCCTGGTAAAGCTGCAGCCATGACTGACAATACTAATGTCAACTATGTGCGGTACAAGGGTGATTACTACCTCTGCACTGAGACCAACTTTATGAATAAAGTGGACATTGAAACTCTGGAAAAAACAGAAAAGGTAGATTGGAGCAAATTTATTGCTGTGAATGGAGCAACTGCACATCCTCATTATGACCTGGATGGAACAGCATACAATATGGGGAACTCCTTTGGGCCATATGGTTTCTCCTATAAGGTTATTCGGGTTCCTCCAGAGAAGGTGGACCTTGGGGAGACAATCCATGGAGTCCAGGTGATATGTTCTATTGCTTCTACAGAGAAAGGGAAACCTTCTTACTACCATAGCTTTGGAATGACAAGGAACTATATAATTTTCATTGAACAACCTCTAAAGATGAACCTGTGGAAAATTGCCACTTCTAAAATTCGGGGAAAGGCCTTTTCAGATGGGATAAGCTGGGAACCCCAGTGTAATACGCGGTTTCATGTGGTGGAAAAACGCACTGGACAGCTCCTTCCAGGGAGATACTACAGCAAACCTTTTGTTACATTTCATCAAATCAATGCCTTTGAGGACCAGGGCTGTGTTATAATTGATTTGTGCTGTCAAGATAATGGAAGAACCCTAGAAGTTTACCAGTTACAGAATCTCAGGAAGGCTGGGGAAGGGCTTGATCAG。

[0074] Subsequently, the effects of circBCO2 on HCC were detected using CCK-8, scratch assay, and Transwell assay. The details are as follows:

[0075] cCK-8 was used to detect the proliferation of Huh7 and Hep3B cells. Huh7 and Hep3B cells were inoculated with 10 μL cCK-8 reagent (CK04, Dojindo) in a 96-well plate and incubated at 37°C for 1 hour. The absorbance (450 nm) was measured using an ELISA reader to evaluate cell proliferation. The results are shown in Figure 2. Figure 3 As shown in A.

[0076] The migration ability of Huh7 and Hep3B cells was determined by scratch assay. 5 After 48 hours of cell / well implantation in a six-well plate, uniform lesions were formed by scratching the pipette tip. Cells were cultured in DMEM and the wound surface was imaged at 0 and 24 hours. Figure 3 As shown in B.

[0077] Transwell assay was used to evaluate the invasion and migration ability of Huh7 and Hep3B cells. 100 μL Huh7 and Hep3B cell suspension (4×10 5 cells / mL), 500 μL DMEM medium was added to the lower chamber to keep the inner and outer liquid levels uniform. After 24 hours, the cells were stained with crystal violet. In the invasion experiment, 100 μL Matrigel was pre-coated in the lower chamber for 30 minutes and then medium was added. Then 100 μL Huh7 and Hep3B cell suspensions (4×10 5 cells / mL) and inserted into the lower chamber to keep the internal and external liquid levels uniform. After 24 hours, the cells were stained with crystal violet. An inverted fluorescence microscope (Leica, Germany) was used to capture and quantify the migrated cells. The results are shown in Figure 3 As shown in C.

[0078] Figure 3 The results of A-3C showed that compared with the control group, knocking down circBCO2 significantly inhibited tumor proliferation, migration and invasion.

[0079] 2. In vivo experiments

[0080] An orthotopic liver cancer model was constructed in mice, and 8-week-old female nude mice were randomly divided into two groups. 1) Orthotopic liver cancer model + sh-NC group, 2) Orthotopic liver cancer model + sh-circBCO2 group. In each group, 1.25% afodine solution was injected intraperitoneally before surgery, and the mice were anesthetized and fixed at a dose of 200 μL / 25 mg of mouse body weight. Huh7 cells (sh-circBCO2 cells and sh-NC cells prepared in the in vitro experiment in this example) were injected into the tail vein of the mice at an injection volume of 2.5×10 6 cells, thereby constructing an orthotopic liver cancer model.

[0081] Two weeks later, according to the results of in vivo imaging, mouse tissues were collected. Before surgery, 1.25% afodine solution was intraperitoneally injected, and the mice were anesthetized at a dose of 200 μL / 25 mg of mouse body weight. Then, the samples were collected and slices were prepared. H&E staining and proliferation-specific staining (Ki67) were performed on the mouse liver tissue slices, as follows:

[0082] In HE staining, the tissue sections were first dewaxed, then placed in hematoxylin for staining for 3 minutes, then rinsed in running water for 30 minutes, then dehydrated with alcohol, stained in eosin for 3 minutes, and finally dehydrated with alcohol and transparentized with xylene before sealing for imaging. Figure 3 As shown in D.

[0083] For proliferation-specific staining, the obtained tissue was fixed with formalin, embedded in paraffin and subjected to IHC. In brief, the embedded tissue was dewaxed and hydrated, and the samples were subjected to high-temperature antigen retrieval. Ki67 primary antibody (ab15580, Abcam) was incubated overnight at 4°C. The next day, after incubation with specific secondary antibody (provided with the DAB kit), the DAB peroxidase substrate kit (K5007, Dako) was used. DAPI (Invitrogen) was used for cell nucleus staining, and neutral resin was used for sealing and imaging. The results are shown in Figure 2. Figure 3 As shown in E.

[0084] Figure 3 The results of D and 3E showed that compared with the control group, knocking down circBCO2 significantly inhibited tumor proliferation, migration, and invasion. It was confirmed that circBCO2 plays a carcinogenic role in hepatocellular carcinoma, suggesting that it can be used as a new potential therapeutic target for hepatocellular carcinoma.

[0085] Example 4 Effects of key gene inhibitors or exogenous proteins in downstream signaling pathways regulated by circBCO2 on HCC progression

[0086] 1. In vitro experiments

[0087] In order to verify that circBCO2 can be used as a new therapeutic target for hepatocellular carcinoma, in this example, circBCO2 was knocked down in liver cancer cells and a stable cell line was constructed (same as Example 3). The hsa-miR-590-5p antagonist (miR30003258-4-5, purchased from RiboBio) (20 nM), recombinant LANCL1 protein (CSB-EP012742HU, purchased from CUSABIO) (4 μg / mL) and RAC1 inhibitor (HY-115376, purchased from MCE) (100 μM) were co-incubated with the circBCO2 knocked down stable cell line, and then the effect of circBCO2 on regulating HCC progression was confirmed by using cck-8 and transwell experiments (the experimental method is the same as Example 3).

[0088] cck-8( Figure 4 A) and transwell assay ( Figure 4 The results of B) confirmed that after the down-regulation of circBCO2 expression, the proliferation and migration abilities of cells co-incubated with circBCO2 downstream pathway key gene inhibitors or exogenous proteins were significantly higher than those of the control group ( Figure 4 A and 4B). sh-circBCO2 showed a good effect in inhibiting HCC progression.

[0089] 2. In vivo experiments

[0090] In this example, 8-week-old BALB / c mice were used to construct a subcutaneous tumor model. Before surgery, 1.25% afodine solution was injected intraperitoneally. The mice were anesthetized and fixed at a dose of 200 μL / 25 mg of mouse body weight. The needle was inserted into the axilla of the mouse, with the needle tip parallel to the subcutaneous tissue of the mouse. After the needle tip reached the axilla, Huh7 cells were injected at an injection volume of 1×10 6 cells to construct a subcutaneous tumor model.

[0091] The mice were randomly divided into 4 groups.

[0092] 1) sh-circBCO2 group: treated with the circBCO2 knockdown stable cell line constructed according to the method in Example 3,

[0093] 2) sh-circBCO2+hsa-miR-590-5p antagonist group: The stable cell line with circBCO2 knockdown was co-incubated with 20nM hsa-miR-590-5p antagonist and then treated.

[0094] 3) sh-circBCO2+recombinant LANCL1 protein group: The circBCO2 knockdown stable cell line was co-incubated with 4 μg / mL recombinant LANCL1 protein and then treated.

[0095] 4) sh-circBCO2+RAC1 inhibitor group: The circBCO2 knockdown stable cell line was co-incubated with 100 μM RAC1 inhibitor antagonist and then treated.

[0096] The subcutaneous tumor model is a model for rapid detection of in vivo tumor formation. In the established subcutaneous tumor model, 300 μL of cell suspension (1×106 cells) was subcutaneously injected into the armpit of the mouse, and the tumor size was measured at the same interval and a growth curve was drawn ( Figure 4 C), 28 days later, samples were taken according to the results of in vivo imaging, 1.25% afodine solution was injected intraperitoneally before surgery, and the mice were anesthetized at a dose of 200 μL / 25 mg of mouse body weight. The samples were then taken, and the formed tumor masses were removed and subjected to gross morphological examination ( Figure 4 D) and weighing ( Figure 4 E).

[0097] Figure 4 C- Figure 4 The experimental results of E showed that after the use of key gene inhibitors of the downstream pathway of circBCO2 and exogenous protein stimulation, the proliferation and migration ability of the tumor was reversed and significantly higher than that of the control group. The above results confirm that circBCO2 can be used as a new potential therapeutic target for hepatocellular carcinoma.

[0098] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. A drug target for preventing and / or treating liver cancer, the drug target comprising circBCO2.

2. The drug target according to claim 1, characterized in that The circBCO2 drives the progression of liver cancer by inhibiting downstream miR-590-5p, LANCL1 and / or ROS signaling pathways; and / or The liver cancer includes hepatocellular carcinoma, cholangiocarcinoma, hepatic angiosarcoma and / or hepatoblastoma, preferably hepatocellular carcinoma.

3. A method for screening a drug for preventing and / or treating lung cancer, wherein the method comprises screening the drug using the drug target according to claim 1 or 2; Preferably, the liver cancer includes hepatocellular carcinoma, cholangiocarcinoma, hepatic angiosarcoma and / or hepatoblastoma, preferably hepatocellular carcinoma.

4. A circBCO2 inhibitor, comprising a substance that inhibits the expression of circBCO2, inhibits the activity of circBCO2, reduces the content of circBCO2, silences, knocks down or knocks out the circBCO2 gene, or disrupts the signal pathway regulated by circBCO2; Preferably, the signaling pathway regulated by circBCO2 includes miR-590-5p, LANCL1 and / or ROS signaling pathway; Preferably, the circBCO2 inhibitor comprises at least one of a small molecule compound, a peptide, a peptide mimetic, a matrix analog, an aptamer, an antibody, a dsRNA, a shRNA, a microRNA, a siRNA, and a sgRNA; More preferably, the circBCO2 inhibitor comprises shRNA, and preferably the shRNA has a sequence as shown in SEQ ID NO:

1.

5. Use of the circBCO2 inhibitor according to claim 4 in the preparation of a medicament for preventing and / or treating liver cancer; Preferably, the liver cancer includes hepatocellular carcinoma, cholangiocarcinoma, hepatic angiosarcoma and / or hepatoblastoma, preferably hepatocellular carcinoma.

6. The use according to claim 5, characterized in that The medicine also contains other active ingredients for preventing and / or treating liver cancer; Preferably, the drug further comprises a pharmaceutically acceptable excipient; Preferably, the pharmaceutically acceptable excipients include at least one of a diluent, an excipient, a binder, a humectant, a surfactant, a lubricant, and a disintegrant; Preferably, the dosage form is selected from a dosage form for gastrointestinal administration or a dosage form for parenteral administration; Preferably, the dosage form for administration via the gastrointestinal tract comprises at least one of powder, tablet, granule, capsule, sustained-release agent, solution, dry suspension, effervescent tablet, emulsion, suspension, syrup, drops, and chewable tablet; Preferably, the non-gastrointestinal administration dosage form comprises at least one of an injection dosage form, a respiratory tract administration dosage form, a skin administration dosage form, a mucosal administration dosage form, and a cavity administration dosage form; Preferably, the subject to which the drug is administered is an animal.

7. A marker for liver cancer, comprising circBCO2; Preferably, the liver cancer includes hepatocellular carcinoma, cholangiocarcinoma, hepatic angiosarcoma and / or hepatoblastoma, preferably hepatocellular carcinoma. Preferably, the marker comprises a prognostic marker.

8. Use of the marker according to claim 7 in the preparation of a product for diagnosis and / or prognosis of liver cancer; The product comprises a substance for detecting the marker of claim 7 at the gene level and / or protein level; Preferably, the substance comprises a substance for at least one of the following detection techniques or methods: immunohistochemistry, Western blotting, Northern blotting, PCR, biochip, nucleic acid sequencing, amino acid sequencing, high performance liquid chromatography, capillary gel electrophoresis, near infrared spectroscopy, mass spectrometry, surface plasmon resonance, immuno-PCR, biotin-avidin technology; More preferably, the immunohistochemistry method includes at least one of enzyme-linked immunosorbent assay, immunofluorescence assay, radioimmunoassay, immunoprecipitation, immunochemiluminescence, colloidal gold immunoassay, fluorescent immunochromatography, complement fixation analysis, flow cytometry fluorescence resolution, and single molecule detection technology; More preferably, the substance includes at least one of a substance specific to circBCO2, a probe that specifically recognizes circBCO2, a gene chip, a protein chip, and a primer that specifically amplifies circBCO2; More preferably, the substance specific to circBCO2 includes at least one of an antibody that specifically binds to circBCO2, a ligand protein or polypeptide that specifically binds to circBCO2, a non-protein compound that specifically recognizes circBCO2, or a nucleic acid aptamer that specifically recognizes circBCO2; preferably, the product includes a reagent, a test plate, a test paper, a device, a system, a kit, a chip or a nucleic acid membrane strip; Preferably, the liver cancer includes hepatocellular carcinoma, cholangiocarcinoma, hepatic angiosarcoma and / or hepatoblastoma, preferably hepatocellular carcinoma.

9. A product for diagnosing and / or prognosing liver cancer, the product comprising a substance for detecting the marker of claim 7 at the gene level and / or protein level; Preferably, the substance comprises a substance for at least one of the following detection techniques or methods: immunohistochemistry, Western blotting, Northern blotting, PCR, biochip, nucleic acid sequencing, amino acid sequencing, high performance liquid chromatography, capillary gel electrophoresis, near infrared spectroscopy, mass spectrometry, surface plasmon resonance, immuno-PCR, biotin-avidin technology; More preferably, the immunohistochemistry method includes at least one of enzyme-linked immunosorbent assay, immunofluorescence assay, radioimmunoassay, immunoprecipitation, immunochemiluminescence, colloidal gold immunoassay, fluorescent immunochromatography, complement fixation analysis, flow cytometry fluorescence resolution, and single molecule detection technology; More preferably, the substance includes at least one of a substance specific to circBCO2, a probe that specifically recognizes circBCO2, a gene chip, a protein chip, and a primer that specifically amplifies circBCO2; More preferably, the substance specific to circBCO2 includes at least one of an antibody that specifically binds to circBCO2, a ligand protein or polypeptide that specifically binds to circBCO2, a non-protein compound that specifically recognizes circBCO2, or a nucleic acid aptamer that specifically recognizes circBCO2; preferably, the product includes a reagent, a test plate, a test paper, a device, a system, a kit, a chip or a nucleic acid membrane strip.

10. A system for diagnosing and / or prognosing liver cancer, the system comprising: Detection component: the detection component is used to detect the marker according to claim 7 at the gene level and / or protein level; Result judging component: The result judging component is used to output a diagnosis and / or prognosis result according to the result of the marker detected by the detection component.

Images