Application of Raddeanoside R8 in preparation of DKK1 inhibitor and cancer treatment medicine

Abstract

The invention discloses application of Raddeanoside R8 in preparation of a DKK1 inhibitor and a cancer treatment medicine, and belongs to the field of biological medicine. The invention finds that the Raddeanoside R8 can be combined with the DKK1 to inhibit the activity of the DKK1, and the Raddeanoside R8 can inhibit the viability or invasion ability of cancer cells expressing the DKK1 protein. According to the invention, the medicinal value of the Raddeanoside R8 is found, the new pharmaceutical application of the Raddeanoside R8 is provided, and a new prevention and treatment medicine is provided for DKK1 expression cancers.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine and relates to the application of Raddeanoside R8 in the preparation of DKK1 inhibitors and cancer therapeutic drugs. Background Art

[0002] DKK1 is a secretory protein with a molecular weight of approximately 29 kDa. DKK1 inhibits the canonical Wnt / β-catenin signaling pathway mainly by binding to the co-receptor LRP5 / 6 of the Wnt signaling pathway. Under normal physiological conditions, DKK1 participates in regulating cell proliferation, differentiation, migration and other processes by inhibiting Wnt / β-catenin signaling.

[0003] DKK1 is abnormally expressed in many cancers, especially in cervical cancer, esophageal squamous cell carcinoma, etc. High levels of DKK1 expression are associated with malignant transformation, increased invasiveness, and poor prognosis of tumors. Therefore, DKK1 is regarded as a potential therapeutic target, and the development of inhibitors against DKK1 is expected to be used to inhibit tumor growth and spread.

[0004] Blocking DKK1 can reduce its inhibitory effect on the Wnt signaling pathway, thereby promoting normal Wnt / β-catenin signaling and helping to inhibit the growth and proliferation of tumor cells. Summary of the invention

[0005] The present invention finds that Raddeanoside R8 has a binding pocket with DKK1 through molecular docking, and proves that Raddeanoside R8 has an inhibitory effect on the activity of DKK1 through transcription, protein and cell levels, and Raddeanoside R8 can affect the viability and invasion ability of cancer cells expressing DKK1 by inhibiting DKK1. The purpose of the present invention is to provide a new application of Raddeanoside R8, that is, to provide the application of Raddeanoside R8 in the preparation of DKK1 inhibitors and cancer treatment drugs.

[0006] The purpose of the present invention is achieved through the following technical solutions:

[0007] Use of Raddeanoside R8 or a pharmaceutically acceptable salt thereof in the preparation of a DKK1 inhibitor.

[0008] Use of Raddeanoside R8 or a pharmaceutically acceptable salt thereof in the preparation of a drug for treating cancer. The cancer is a cancer expressing DKK1.

[0009] Use of Raddeanoside R8 or a pharmaceutically acceptable salt thereof in the preparation of a drug for treating cervical cancer. Further, the drug for treating cervical cancer is a drug that inhibits the viability of cervical cancer cells.

[0010] Use of Raddeanoside R8 or a pharmaceutically acceptable salt thereof in the preparation of a drug for treating liver cancer. Further, the drug for treating liver cancer is a drug that inhibits the invasive ability of liver cancer cells.

[0011] The present invention has the following advantages and beneficial effects: The present invention discovers the new medicinal value of Raddeanoside R8 and provides a new preventive and therapeutic drug for the inhibition of DKK1 and cancer expressing DKK1. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 This is the molecular docking diagram of Raddeanoside R8 and DKK1 protein, A: docking conformation of DKK1 and Raddeanoside R8; B: highest affinity conformation of Raddeanoside R8 and DKK1; C: interaction between Raddeanoside R8 and DKK1.

[0013] Figure 2 This is the SPR binding image of Raddeanoside R8 and DKK1 protein.

[0014] Figure 3 The IC50 results of Raddeanoside R8 on SiHa cells. A is the IC50 result of Raddeanoside R8 on SiHa cells without DKK1 protein added; B is the IC50 result of Raddeanoside R8 on SiHa cells with DKK1 protein added.

[0015] Figure 4 The effect of Raddeanoside R8 addition on the transcription level of DKK1.

[0016] Figure 5 The images are microscope observation (A) and cell counting (B) of Raddeanoside R8 inhibiting the invasion of HepG2 cells. DETAILED DESCRIPTION

[0017] The following examples are used to further illustrate the present invention, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

[0018] The HepG2 and SiHa cells used in the following examples are human liver cancer and cervical cancer cell lines expressing DKK1 protein, respectively; the statistical analysis of the results of the examples was performed using a two-tailed unpaired t-test, *: P<0.05, **: P<0.01, ***: P<0.001, ****: P<0.0001.

[0019] Example 1

[0020] During the docking process of DKK1 and Raddeanoside R8, AUTODOCK4.2 was used to analyze the molecular docking mode of DKK1 and Raddeanoside R8. The DKK1 structure ID is 3S8V, which was obtained from the RCSB database. The structure is an LRP6-DKK1 complex. MOE was used to remove the LRP6 protein, and DKK1 and Raddeanoside R8 were pre-processed, including processes such as hydrogenation, dehydration, protonation and energy minimization. The 2D and 3D structures of Raddeanoside R8 were drawn by ChemBioDrawUltra 14.0 and ChemBio3D Ultra 14.0, respectively. The binding pocket of DKK1 and Raddeanoside R8 was predicted by computational simulation methods. The docking score of DKK1 and Raddeanoside R8 was -5.9409. The interaction was completed through the PLIP online service. The results are shown in. Figure 1 .

[0021] Example 2

[0022] The equilibrium dissociation constants of DKK1 and Raddeanoside R8 were determined by surface plasmon resonance (SPR) technology, further proving the interaction between DKK1 protein and Raddeanoside R8. DKK1 protein was immobilized on a COOH sensor chip (Nicoya, Canada). The chip was rinsed with PBS (pH = 7.4) to obtain a stable detection baseline. Raddeanoside R8 with increasing concentrations (0.015625 μM, 0.03125 μM, 0.0625 μM, 0.25 μM, 0.5 μM, 1 μM) was injected into the chip. PBS was set as a negative control. The speed of each cycle was set to 20 μL / min. The data obtained from the measurement were analyzed using Trace Drawer software. The interaction between DKK1 and Raddeanoside R8 was evaluated using the binding reaction kinetic parameters. Figure 2 As shown in Figure 2, the equilibrium dissociation constant (Kd) of DKK1 and Raddeanoside R8 was calculated by Trace Drawer software to be 6.12×10 - 6M, further indicating that DKK1 has a strong binding affinity with Raddeanoside R8.

[0023] Example 3

[0024] The cultured human cervical cancer SiHa cells (5×10 5 / mL) and different concentrations of Raddeanoside R8 (20, 40, 60 and 80 μM) were incubated with 20 μM protein DKK1 or an equal amount of culture medium for 48 hours; the blank control group was added with 0.1% dimethyl sulfoxide (DMSO) as a solvent. The cell viability was determined using a CCK-8 kit (absorbance A450 value of the treatment group / absorbance A450 value of the blank control group × 100%). The half inhibitory concentration (IC50) of Raddeanoside R8 on cell viability was calculated using GraphPad.Prism.v5.0-IC50 value calculation software.

[0025] The results are as follows Figure 3 As shown in Figure 2, as the concentration of Raddeanoside R8 increased, the cell activity decreased, and the addition of DKK1 protein had a more obvious inhibitory effect on this result. Figure 3 As can be seen in A and 3B, when the concentration of Raddeanoside R8 reaches about 39.56μM, the activity of SiHa cells can be inhibited by 50%, while in the group with DKK1 protein added, the concentration of Raddeanoside R8 reaches about 50.43μM to inhibit the activity of SiHa cells by 50%. This indicates that Raddeanoside R8 can inhibit the proliferation of cells expressing DKK1, and the expression level of DKK1 affects the working efficiency of Raddeanoside R8.

[0026] Example 4

[0027] HepG2 cells (5×10 5After 12 h of incubation with 0, 1, 5, 10 and 20 μM Raddeanoside R8 (μM / mL), the culture medium was washed with PBS, total RNA of the cells was extracted using TRIzol reagent (Invitrogen), RNA was reverse transcribed, and cDNA was prepared using a first-strand cDNA synthesis kit (Thermo Fisher Scientific). Next, gene expression analysis was performed by real-time quantitative PCR using SYBR Select Master Mix, primers and Bio-Rad real-time PCR system. mRNA expression was normalized to GAPDH using the formula (ΔCt=Ct target gene-Ct internal reference gene) and expressed as relative mRNA expression (ΔΔCt=2-(ΔCt sample-ΔCt control)). At least three independent biological replicates were performed for each expression analysis. All experimental steps were performed according to the instructions of the manufacturer (Thermo Fisher Scientific). The primer sequences used for gene expression analysis are as follows:

[0028] DKK1-F: CTTGGTACCGAGCTCGGATCCATGATGGCTCTGGGCGC,

[0029] DKK1-R: GAAGGGCCCTCTAGACTCGAGGTGTCTCTGACAAGTGTGAAGCCTAGAA G.

[0030] Internal reference GAPDH-F: GGAGCGAGATCCCTCCAAAAT,

[0031] Internal reference GAPDH-R: GGCTGTTGTCATACTTCTCATGG.

[0032] The results are as follows Figure 4 As shown, with the increase of Raddeanoside R8 concentration, the transcription level of DKK1 gene showed a gradually decreasing trend, indicating that Raddeanoside R8 has an inhibitory effect on the expression of DKK1.

[0033] Example 5

[0034] The day before the experiment, the matrix gel was taken out from -20℃ and placed in a 4℃ refrigerator overnight to allow the matrix gel to melt from a solid state to a liquid state. The next day, the matrix gel was diluted 1:9 and coated on the upper chamber surface of the bottom membrane of the Transwell chamber, and then placed in a 37℃ incubator to air dry overnight.

[0035] HepG2 cells were added to the Transwell chamber using a pipette. The volume of the added cell suspension was 200 μL and the number of cells in the cell suspension was 2×105 Then, 20 μM Raddeanoside R8 and 10 μM endotoxin-free DKK1 protein or 20 μM Raddeanoside R8 were added to the cells, and the group without reagent was used as a control. Then, freshly prepared complete medium was added to the lower chamber and the cells were placed in an incubator at 37°C for 48 h.

[0036] Take out the chamber with tweezers, suck out the residual culture medium with a pipette, and then soak it in methanol solution for 20 minutes. Finally, soak the chamber in PBS solution for 3 times, 5 minutes each time, put the chamber in a fume hood to air dry, and then soak it in 0.5% crystal violet solution for 20 minutes. Soak the Transwell chamber in PBS solution again, and then observe the chamber on a microscope.

[0037] The results are as follows Figure 5 As shown in A and 5B, compared with the control group, the invasion ability of HepG2 cells with the addition of Raddeanoside R8 was significantly reduced, but the addition of DKK1 protein could alleviate this inhibitory effect, indicating that Raddeanoside R8 mainly affects the invasion ability of HepG2 cells by binding to DKK1 and inhibiting the activity of DKK1.

[0038] The above embodiments are only used to help illustrate the present invention. The implementation methods of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. Use of Raddeanoside R8 or a pharmaceutically acceptable salt thereof in the preparation of a DKK1 inhibitor.

2. Use of Raddeanoside R8 or a pharmaceutically acceptable salt thereof in the preparation of cancer therapeutic drugs.

3. The use according to claim 2, characterized in that: The cancer is a cancer expressing DKK1.

4. Use of Raddeanoside R8 or a pharmaceutically acceptable salt thereof in the preparation of a drug for treating cervical cancer.

5. The use according to claim 4, characterized in that: The cervical cancer treatment drug is a drug that inhibits the viability of cervical cancer cells.

6. Use of Raddeanoside R8 or a pharmaceutically acceptable salt thereof in the preparation of a drug for treating liver cancer.

7. The use according to claim 6, characterized in that: The liver cancer therapeutic drug is a drug that inhibits the invasive ability of liver cancer cells.

Images