A salvia miltiorrhiza rosmarinic acid synthase mutant with improved enzyme activity, preparation method and application

Abstract

The invention discloses a salvia miltiorrhiza rosmarinic acid synthase mutant with improved enzyme activity, and belongs to the field of enzyme engineering. The present invention mutates the large-volume arginine near the salvia miltiorrhiza rosmarinic acid synthase substrate pocket cavity into a small-volume tryptophan by means of site-directed mutagenesis, changes the substrate pocket cavity structure, improves the substrate entry and exit efficiency, thereby significantly improving the enzyme activity of the strain expressing salvia miltiorrhiza rosmarinic acid synthase, and improves the salvia miltiorrhiza rosmarinic acid synthase enzyme activity by 1.9-2.5 times. The modified strain is more suitable for industrial application, can reduce production costs, and improve production efficiency.

Description

Technical Field

[0001] The invention relates to a salvia miltiorrhiza rosmarinic acid synthase mutant with improved enzyme activity, belonging to the field of enzyme engineering. Background Art

[0002] Phenolic acids are a class of secondary metabolites derived from plants. They have anti-inflammatory, antioxidant, anti-diabetic, antiviral, anti-tumor, neuroprotective and liver protective effects, and are widely used in many industries such as food, pharmaceuticals, and nutrition and health care. Rosmarinic acid is an important intermediate of phenolic acid compounds, and is also the basic structure for the biosynthesis of phenolic acid active ingredients such as lithospermic acid, salvianolic acid B, and scutellarin. At present, rosmarinic acid and its derivatives are still mainly obtained through plant extraction or chemical synthesis. However, due to the limited plant resources and the high pollution generated during the chemical synthesis process, the existing acquisition methods can no longer meet the growing actual needs.

[0003] Rosmarinic acid gene is derived from Salvia miltiorrhiza ( Salvia miltiorrhiza Bunge ), rosmarinic acid is an important active ingredient in Danshen. Danshen is a widely used medicinal plant in traditional Chinese medicine, mainly used to treat cardiovascular diseases, liver diseases, etc. The medicinal value of Danshen mainly comes from the rich phenolic acid compounds it contains, among which rosmarinic acid is one of the main components. The biosynthesis of rosmarinic acid originates from tyrosine metabolism and phenylalanine metabolism, and the important precursor compounds p-coumaroyl-CoA and 3,4-dihydroxyphenyllactic acid are synthesized through multi-step enzyme-catalyzed reactions. Under the catalytic action of rosmarinic acid synthase, the two are esterified to form coumaroyl-3,4-dihydroxyphenyllactic acid, and then rosmarinic acid is formed under the action of cytochrome P450 enzymes.

[0004] Rosmarinic Acid Synthase (RAS) plays a key role in catalyzing the biosynthesis of rosmarinic acid in Salvia miltiorrhiza and is considered to be the key rate-limiting enzyme for rosmarinic acid synthesis. Improving the expression level of this enzyme can increase the content of rosmarinic acid and other phenolic acid compounds in Salvia miltiorrhiza. Finding or constructing a rosmarinic acid synthase with high catalytic activity has become a hot topic in current research. Therefore, obtaining a rosmarinic acid synthase with high catalytic activity is an urgent practical need and is also of great significance to improving the quality and yield of Salvia miltiorrhiza medicinal materials. Summary of the invention

[0005] The invention realizes heterologous expression of salvia miltiorrhiza rosmarinic acid synthase through gene cloning and recombinant expression, and changes key residues near the substrate pocket of salvia miltiorrhiza rosmarinic acid synthase through site-directed mutagenesis, thereby further improving the catalytic activity of salvia miltiorrhiza rosmarinic acid synthase.

[0006] The problem to be solved by the present invention is to provide a rosmarinic acid synthase mutant with improved enzyme activity, wherein the mutation is a site-directed mutation of key residues near the substrate pocket of the rosmarinic acid synthase derived from Salvia miltiorrhiza, the amino acid sequence of which is shown in SEQ ID NO.1, thereby improving the activity of the rosmarinic acid synthase.

[0007] Another technical problem solved by the present invention is to provide a method for constructing the mutant.

[0008] In order to achieve the above object, the present invention is implemented by the following scheme:

[0009] The invention provides a rosmarinic acid synthase mutant with improved enzyme activity. The mutation is site-directed mutation of key residues near the substrate pocket of rosmarinic acid synthase derived from Salvia miltiorrhiza, the amino acid sequence of which is shown in SEQ ID NO.1, thereby improving the activity of rosmarinic acid synthase.

[0010] The present invention provides a method for constructing the mutant, wherein the mutation is to mutate the arginine at position 367 of the rosmarinic acid synthase shown in the amino acid sequence of SEQ ID NO.1 to tryptophan; or to mutate the glycine at position 293 to arginine or isoleucine, and the mutant is selected from any one of the following:

[0011] R367W: arginine at position 367 mutated to tryptophan;

[0012] G293R: glycine at position 293 mutated to arginine;

[0013] G293I: glycine at position 293 mutated to isoleucine;

[0014] The amino acid sequences of the rosmarinic acid synthase mutants R367W, G293R and G293I are shown in SEQ ID NOs. 2-4, respectively.

[0015] In one embodiment of the present invention, the gene encoding rosmarinic acid synthase was connected to the vector pCold-TF and transformed into Escherichia coli BL21 (DE3). Transformants were selected and inoculated into LB liquid medium, cultured at 37°C for 12 hours, and then transferred to TB medium with an inoculation volume of 1%. The cells grew to OD 600 When the pH was 1.0, IPTG was added for induction, and the culture temperature was lowered to 20°C for 24 h. The cells were collected, ultrasonically disrupted to obtain the recombinant protein, and the rosmarinic acid synthase protein was purified.

[0016] The present invention also provides a recombinant Escherichia coli that can catalyze the synthesis of rosmarinic acid from caffeoyl-coenzyme A and 3,4-dihydroxyphenyllactic acid. The gene encoding rosmarinic acid synthase from Salvia miltiorrhiza is connected to an expression vector and then transformed into Escherichia coli. Rosmarinic acid is synthesized by adding caffeoyl-coenzyme A and 3,4-dihydroxyphenyllactic acid.

[0017] The present invention mutates the large-volume arginine near the substrate pocket cavity of rosmarinic acid synthase into a small-volume tryptophan by means of site-directed mutagenesis, changes the structure of the substrate pocket cavity, improves the efficiency of substrate entry and exit, thereby significantly improving the enzyme activity of rosmarinic acid synthase expressed by the strain, and increases the enzyme activity of rosmarinic acid synthase by 1.9-2.5 times. The modified strain is more suitable for industrial application, can reduce production costs, and improve production efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 : The electrophoresis results of the recombinant Salvia miltiorrhiza rosmarinic acid synthase protein in Example 2 of the present invention.

[0019] Figure 2 : Chromatographic analysis of the Salvia miltiorrhiza rosmarinic acid synthase obtained in Example 2 of the present invention.

[0020] Figure 3 : The relative enzyme activity verification results of the Salvia miltiorrhiza rosmarinic acid synthase mutant prepared in Example 4 of the present invention. DETAILED DESCRIPTION

[0021] LB medium: tryptone 10 g / L, yeast powder 5 g / L, NaCl 10 g / L, pH 7.0;

[0022] TB medium: peptone 12 g / L, yeast extract 24 g / L, glycerol 8 g / L, 17 mmol / L KH2PO4, 72 mmol / LK2HPO4.

[0023] The catalytic activity of rosmarinic acid synthase was determined by high performance liquid chromatography detection. The catalytic activity of recombinant rosmarinic acid synthase and mutants was determined in 50 mM potassium phosphate buffer (pH 7.5). The buffer contained: 2 mM caffeoyl-CoA, 2 mM 3,4-dihydroxyphenyllactic acid and 100 μg purified recombinant protein. The reaction volume was 500 μL. After reacting in a 25℃ water bath for 2 h, 250 μL of chromatographic grade methanol was added to terminate the reaction. The protein was precipitated by centrifugation at 12000 rpm for 2 min. An equal amount of heat-inactivated recombinant protein was taken as a negative control. The sample was filtered through a 0.22 μm filter and analyzed by HPLC-UV system. The chromatographic column used was a C-18 reversed silica column, the mobile phase was 0.03% trifluoroacetic acid water: acetonitrile (7:3, v / v), the flow rate was 1 mL / min, and the detection wavelength was 281 nm. The product peak area was measured, and a bar graph was made by drawing software. The enzyme activity was characterized by the product peak area.

[0024] Example 1 Cloning of Salvia miltiorrhiza Rosmarinic Acid Synthase Gene

[0025] S1. Design primers;

[0026] Primers were designed based on the sequence of the rosmarinic acid synthase gene of Salvia miltiorrhiza annotated in the Salvia miltiorrhiza transcriptome database of our laboratory. The primers directly have homology arms (underlined). The specific primer designs are as follows:

[0027] F: GGGAATTCCATATG ATGAAGATCGATATCACAGACTCGA (SEQ ID NO.5)

[0028] R: CGCGGATCCTCA AATATCATAAAACAACTTCTCGAA (SEQ ID NO.6)

[0029] S2, PCR amplification;

[0030] The total volume of the PCR reaction system for gene cloning was 50 μL: 20 μL of ddH2O, 1 μL of template, 2 μL of upstream primer, 2 μL of downstream primer, and 25 μL of PrimeSTAR Max DNA Polymerase. The PCR amplification temperature conditions were as follows: denaturation at 98°C for 3 min, followed by 35 cycles of amplification (98°C for 15 s, 53°C for 15 s, and 72°C for 2 min), and post-extension at 72°C for 10 min. The PCR product was finally stored at 4°C.

[0031] The PCR product was recovered by a gel recovery kit and sent to Zhejiang Shangya Biological Co., Ltd. for sequencing. The sequence of the Salvia miltiorrhiza rosmarinic acid synthase gene obtained by sequencing is shown in SEQ ID NO.7;

[0032] S3, double enzyme digestion and ligation with vector;

[0033] Using restriction enzymes Nde I and Sal I The pCold-TF plasmid was double-digested with 10×Fast Digest Buffer 5μL, pCold-TF plasmid 30μL, restriction endonuclease Nde I and Sal I 2.5 μL each, 10 μL sterile distilled water. After the above reaction was reacted at 37°C for 1 hour, gel recovery was performed using a gel recovery kit, and then connected with the PCR recovery product to obtain a connection reaction product;

[0034] The connection system is: Exnase 1μL, 5×CE Buffer 2μL, pCold-TF gel recovery product 1μL, PCR recovery product 1μL, sterile distilled water 5μL.

[0035] The above reaction was reacted at 37°C for 30 min and then placed on ice for 5 min to prepare for transformation;

[0036] S4, transform host cells;

[0037] S4.1. Take one tube of JM109 competent cell prepared above and place it on ice to thaw.

[0038] S4.2. Transfer all the ligation reaction solution into JM109 competent medium and pipette evenly;

[0039] S4.3, after ice bathing for 30 min, heat shock in a 42°C water bath for 90 s, then ice bath for 2 min;

[0040] S4.4, add 600 μL LB medium and culture at 37°C for 45 min;

[0041] S4.5, centrifuge at 5000r / min for 2min, discard 500μL supernatant, pipette the remaining bacteria and culture solution evenly, spread on a plate containing ampicillin resistance, and invert and culture at 37℃ overnight;

[0042] S4.6. Select 5 monoclonal recombinant plasmids for colony PCR positive identification, and send the positive clones to Zhejiang Shangya Biotechnology for sequencing. The positive recombinant plasmid with correct sequencing is named pCold-SmRAS1;

[0043] S4.7. Transfer the positive recombinant plasmid into BL21 (DE3) competent cell to obtain the recombinant strain for use.

[0044] Example 2 Induced expression of recombinant strains and protein purification verification

[0045] S1, pick a single colony;

[0046] 100 μL of the recombinant strain prepared in Example 1 was added to 20 mL of LB medium, 100 μL of ampicillin solution (final concentration of 100 μg / ml) was added, and an empty vector strain (pCold-TF plasmid transferred into BL21 (DE3)) was used as a control, and cultured overnight at 37°C and 220 rpm to obtain a seed bacterial solution;

[0047] S2, seed culture;

[0048] Take 200 μL of the seed solution from the previous step and transfer it to a flask containing 20 mL of LB medium. Add 100 μL of ampicillin solution (final concentration is 100 μg / ml) and culture until OD 600 =1.0;

[0049] S3, induced expression;

[0050] Add 50 μL of IPTG solution (final concentration 0.8 mmol / L) to each flask. -1 ), 20°C, 220 rpm, induced culture for 24 h;

[0051] S4, bacterial lysis to release the expressed target protein;

[0052] Take 1 mL of the empty plasmid bacterial solution and the recombinant plasmid bacterial solution with the target gene induced in step 3, centrifuge at 12000 rpm for 5 min, discard the supernatant, add 1 mL of phosphate buffer (pH = 7.5) to resuspend the bacteria, and ultrasonically disrupt them for 5 min;

[0053] S5. Detect the expression and purity of the target protein;

[0054] Centrifuge at 12000rpm for 5min at 4℃ and run protein gel for verification

[0055] S6, protein purification and enzyme activity identification;

[0056] By the above method, the remaining pCold-SmRAS1 cells were enriched and ultrasonically disrupted to obtain a crude enzyme solution. The target protein was purified by Ni-column using AKTApure protein purification system, and the target protein was eluted by gradient using a high concentration imidazole buffer containing 300 mM, such as Figure 1As shown in the figure, M is the marker, sample 00 is the target protein without any purification treatment; samples 01, 02, 03, and 04 represent the results of different purification steps. They are processed step by step during the purification process. The ordinate represents the relative position of the protein in the gel, that is, the molecular weight of the protein in the molecular weight standard (Marker). As can be seen from the picture, the band of the target protein pCold-SmRAS1 is becoming clearer and the intensity is getting higher, and the impurity bands are getting fewer. The protein adsorbed on the column is eluted to obtain rosmarinic acid synthase for use.

[0057] Example 3 Verification of the catalytic activity of Salvia miltiorrhiza rosmarinic acid synthase

[0058] The catalytic activity of rosmarinic acid synthase was determined by high performance liquid chromatography detection. The catalytic activity of recombinant Salvia miltiorrhiza rosmarinic acid synthase was determined in 50 mM potassium phosphate buffer (pH 7.5). The buffer contained: 2 mM caffeoyl-CoA, 2 mM 3,4-dihydroxyphenyllactic acid and 100 μg purified recombinant protein. The reaction volume was 500 μL. After reacting in a 25°C water bath for 2 h, 250 μL of chromatographic grade methanol was added to terminate the reaction. The protein was precipitated by centrifugation at 12000 rpm for 2 min. An equal amount of heat-inactivated recombinant protein was taken as a negative control. The sample was filtered through a 0.22 μm filter and analyzed by HPLC-UV system. The chromatographic column used was a C-18 reversed phase silica column, the mobile phase was 0.03% trifluoroacetic acid water: acetonitrile (7:3, v / v), and the flow rate was 1 mL / min. The results showed that rosmarinic acid synthase can catalyze the esterification reaction of caffeoyl-CoA and 3,4-dihydroxyphenyllactic acid to form rosmarinic acid, such as Figure 2 SmRAS1 is the rosmarinic acid synthase obtained in Example 2, and Boiled SmRAS1 is an inactivated recombinant protein.

[0059] Example 4 Obtaining a highly active Salvia miltiorrhiza rosmarinic acid synthase mutant

[0060] Using the site-directed mutagenesis kit (TaKaRa), 3 pairs of primers were designed (see Table 1), the primer sequences are shown in SEQ ID NO.9-14, and the constructed pCold-SmRAS1 was used as a template to perform PCR, and the arginine at position 367 near the rosmarinic acid synthase substrate pocket cavity was mutated to tryptophan; or the glycine at position 293 was mutated to arginine or isoleucine, which were named R367W, G293R, and G293I, respectively. The PCR reaction conditions were: 95°C 5min, 34 cycles (95°C 5min, 60°C 30s, 72°C 5min40s), 72°C 10min. PCR amplification system: template 1μL, upstream and downstream primers 1μL each, dNTP Mix 4μL, 5×primeSTAR Buffer 10μL, sterilized double distilled water 32.5μL, primeSTAR DNA polymerase 0.5μL. The PCR product was purified and recovered using a gel recovery kit, and the concentration of the recovered product was tested by electrophoresis.

[0061] The transformants were sequenced by Zhejiang Shangya Biotechnology and named pCold-SmRAS1-R367W, pCold-SmRAS1-G293R, and pCold-SmRAS1-G293I.

[0062] Table 1 Primer sequences

[0063] Primer Name Primer Sequence (5’-3’) R367W sense GGGTGATCAGCTGGGTGTGGCTGCCGGTGTATGAGCCG (SEQ ID NO.9) R367W Antisense GCTCATACACCGGCAGCCACACCCAGCTGATCACCCACAGAT (SEQID NO.10) G293R sense CTGCCGCAGGGATACTTCAGGAACGCCATCTTCTTCGCCACG (SEQ ID NO.11) G293R Antisense GGCGAAGAAGATGGCGTTTCGGAAGTATCCCTGCGGCAGCCG (SEQ ID NO.12) G293I sense CTGCCGCAGGGATACTTCATTAACGCCATCTTCTTCGCCACG (SEQ ID NO.13) G293I Antisense GGCGAAGAAGATGGCGTTAATGAAGTATCCCTGCGGCAGCCG (SEQ ID NO.14)

[0064] Example 5 Verification of high-yield rosmarinic acid synthase producing strain

[0065] The plasmid sequenced correctly in Example 4 was transformed into E. coli BL21 (DE3), and the transformants were selected and inoculated into LB liquid medium at 37°C for 12 hours, and then transferred to TB medium with an inoculation volume of 1%. The cells grew to OD 600 When the concentration of 1.0 was 1.0, IPTG was added for induction, and the culture temperature was lowered to 20°C for 24 h. The fermented bacteria were collected, and the cells were broken to collect the recombinant protein to detect its catalytic activity. The enzyme activity of the unmutated Salvia miltiorrhiza rosmarinic acid recombinant strain was measured, and a bar graph was made using a drawing software, such as Figure 3 The experimental results show that compared with the starting strain and the starting strain (the strain without any mutation treatment, represented by WT in the figure), the enzyme activity of the mutants is significantly improved, and R367W, G293R, and G293I are 1.9-2.5 times higher than the starting strain.

[0066] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A rosmarinic acid synthase mutant with improved enzyme activity, characterized in that: The amino acid sequence of the rosmarinic acid synthase mutant with improved enzyme activity is shown in SEQ ID NO.

2.

2. A gene encoding a rosmarinic acid synthase mutant with improved enzyme activity as claimed in claim 1, characterized in that: The nucleotide sequence of the coding gene is shown in SEQ ID NO.

8.

3. A recombinant expression plasmid, characterized in that: Contains the coding gene according to claim 2.

4. The recombinant expression plasmid according to claim 3, characterized in that: The expression vector is pCold-TF.

5. A recombinant genetically engineered bacterium, characterized in that: Comprising the recombinant expression plasmid according to claim 3 or 4.

6. The recombinant genetically engineered bacterium according to claim 5, characterized in that: It is Escherichia coli BL21 (DE3).

7. A method for preparing the rosmarinic acid synthase mutant with improved enzyme activity according to claim 1, characterized in that: The coding gene according to claim 2 is connected to an expression vector, and a host cell is transformed to obtain a recombinant genetically engineered bacterium; the recombinant genetically engineered bacterium expresses a rosmarinic acid synthase mutant to obtain a rosmarinic acid synthase mutant with improved activity.

8. The method according to claim 7, characterized in that The expression vector is pCold-TF.

9. The method according to claim 7, characterized in that: The host cell was Escherichia coli BL21 (DE3).

Images