Brassica napus black rot resistance gene BnBR1 and its application

Abstract

The present invention provides a Brassica napus black rot resistance gene BnBR1 and its application, belonging to the technical field of genetic engineering. The present invention isolated and cloned a Brassica napus black rot resistance gene BnBR1 from the highly black rot resistant variety "ZS9mXccR-1" of Brassica napus, and its nucleotide sequence is shown in SEQ ID NO.1, and the protein sequence encoded by this gene is shown in SEQ ID NO.2. The BnBR1 gene can improve the resistance of Brassica napus to black rot. By genetic transformation or hybridization, applying BnBR1 to Brassica napus breeding can effectively improve the resistance of Brassica napus varieties to black rot, thereby reducing the damage of black rot and achieving the purpose of increasing production and stable production. The present invention provides a new gene source for the excavation of black rot functional genes and molecular breeding, and has broad application prospects in enhancing the resistance of Brassica napus to black rot.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a black rot resistance gene BnBR1 of Brassica napus and an application thereof. Background Art

[0002] Brassica napus is a plant of the genus Brassica in the family Cruciferae. It has high grain yield and is one of the important oil crops. It also has important value in feed, green manure, vegetables, energy, tourism and nectar sources.

[0003] Black rot is a plant disease caused by Xanthomonas campestrispv. campestris (Xcc). Xcc is a model bacteria of the genus Xanthomonas, which mainly harms Brassica crops such as cabbage, kale, and rapeseed. Rapeseed black rot is widely distributed in rapeseed producing areas. Due to changes in climate and cultivation methods, the incidence of rapeseed black rot has become more serious. The incidence rate in general diseased fields is 10% to 20%, and the incidence rate in severely diseased fields is 60% to 80%, causing a 30% to 50% reduction in rapeseed production and causing significant economic losses.

[0004] At present, black rot is prevalent in the world's Brassica crop producing areas and is one of the most serious diseases of Brassica crops. For a long time, the prevention and control of black rot has mainly relied on the application of chemical fungicides, including treating seeds with fungicides and applying chemical pesticides before and after the disease occurs. The frequent and large-scale use of pesticides to prevent and control black rot has increased farmers' production costs on the one hand, and on the other hand, chemical fungicides have also caused environmental and ecological problems such as poisoning non-target organisms and polluting the environment and food.

[0005] Planting resistant varieties is the main biological control measure for black rot. For a long time, the development and utilization of black rot resistant varieties have been considered the most economical and effective measure to control black rot. At present, 11 physiological races have been identified in Xcc that can infect Brassica plants, among which race 1 and race 4 are the most widely distributed and most harmful races. There are many reports on black rot resistance loci in cabbage crops, and 31 QTLs have been located, of which 21 QTLs are resistant to race 1. 39 QTLs have been located in cabbage, of which 8, 7, 9, and 11 QTLs are resistant to races 1, 3, 4, and 6, respectively. Only one QTL resistant to race 4 has been reported in Brassica napus. In summary, although so many QTLs have been located in Brassica crops, black rot resistance genes have not yet been cloned in Brassica crops. Summary of the invention

[0006] The object of the present invention is to provide a Brassica napus black rot resistance gene BnBR1 and its application to solve the above problems.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The present invention provides a black rot-resistant gene BnBR1 of Brassica napus, and the nucleotide sequence of BnBR1 is shown in SEQ ID NO.1.

[0009] The present invention also provides a protein encoded by the black rot-resistant gene BnBR1 of Brassica napus, and the amino acid sequence of the protein is shown in SEQ ID NO.2.

[0010] The present invention also provides a vector containing the black rot-resistant gene BnBR1 of Brassica napus.

[0011] The present invention also provides a cell containing the black rot-resistant gene BnBR1 of Brassica napus.

[0012] The present invention also provides a method for improving the resistance of Brassica napus to black rot, the method includes overexpressing the black rot-resistant gene BnBR1 of Brassica napus in rapeseed, and the nucleotide sequence of the gene BnBR1 is shown in SEQ ID NO.1.

[0013] The present invention also provides a molecular marker for predicting or identifying the resistance of Brassica napus to black rot, and the molecular marker is the A / T polymorphism at the 156th position of the amplified fragment of the primer pair 590-2F / R; the nucleotide sequences of the primer pair 590-2F / R are shown in SEQ ID NO.6 and SEQ ID NO.7 respectively.

[0014] The present invention also provides the primer pair of the molecular marker, including a forward primer and a reverse primer. The nucleotide sequence of the forward primer 590-2F is shown in SEQ ID NO.6; the nucleotide sequence of the reverse primer 590-2R is shown in SEQ ID NO.7.

[0015] The present invention also provides the application of the molecular marker in breeding black rot-resistant Brassica napus.

[0016] The present invention also provides the application of the primer pair in breeding black rot-resistant Brassica napus.

[0017] By adopting the above technical solution, the present invention has the following beneficial effects: The present invention isolates and clones a black rot resistance gene BnBR1 from the highly resistant variety "ZS9mXccR-1" of Brassica napus to black rot. Its nucleotide sequence is shown in SEQ ID NO.1, and the protein sequence encoded by this gene is shown in SEQ ID NO.2. The BnBR1 gene can improve the resistance of Brassica napus to black rot. By applying BnBR1 to Brassica napus breeding through genetic transformation or hybridization, the resistance of Brassica napus varieties to black rot can be effectively improved, thereby reducing the harm of black rot and achieving the purpose of increasing production and ensuring stable yields. The present invention provides a new gene source for the excavation of black rot functional genes and molecular breeding, and has broad application prospects in enhancing the resistance of Brassica napus to black rot. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 It is the GWAS result map of black rot resistance of 357 Brassica napus natural populations; A is the Manhattan plot of GWAS, the significance threshold is set to 0.05 / the number of markers, and the locus indicated by the arrow is the significantly associated locus; B is the Q-Q plot of GWAS.

[0019] Figure 2 It is the disease resistance identification result of the disease-resistant parent "ZS9mXccR-1" and the disease-susceptible parent ZS9. Mock is the negative control without inoculating the pathogen, and Race 3 is inoculating the black rot pathogen race 3.

[0020] Figure 3 It is the gene collinearity result map of the disease-resistant parent "ZS9mXccR-1" and the disease-susceptible parent ZS9 within the mapping interval.

[0021] Figure 4 It is the plasmid map of the pCAMBIA1301-BnBR1 overexpression vector.

[0022] Figure 5 It is the PCR identification of Brassica napus plants transgenic for BnBR1; + is the positive control, - is the negative control, M is the Marker, and 35S::BnBR1-T0 is the T0 generation plants of Brassica napus transgenic for BnBR1.

[0023] Figure 6 It is the statistical chart of black rot resistance of Brassica napus plants transgenic for BnBR1.

[0024] Figure 7 It is the leaf surface map of Brassica napus plants transgenic for BnBR1. BnBR1-1, BnBR1-8, and BnBR1-12 are the T1 generation positive plants of Brassica napus transgenic for BnBR1.

[0025] Figure 8Verification of the molecular marker of the BnBR1 gene in Example 5B. Detailed implementation mode

[0026] The technical solutions provided by the present invention will be described in detail below in conjunction with the embodiments, but they cannot be construed as limiting the protection scope of the present invention.

[0027] The disease-resistant parental Brassica napus "ZS9mXccR-1" in the embodiment of the present invention is the rapeseed variety recorded in the literature "Yang, L., Zhao, C., Bai, Z., et al. Comparative transcriptome analysis ofcompa tible andincompatible Brassica napus-Xanthomonas campestris interactions. Fro ntPlantSci. 2022, 13, 960874."

[0028] Example 1. Cloning and sequence determination of the black rot disease-resistant gene BnBR1

[0029] Take the young leaves of the disease-resistant parental Brassica napus "ZS9mXccR-1" and extract genomic DNA by the 2% CTAB extraction method. Design primers according to the genomic sequence of the BnBR1 gene, and the genomic sequence of the BnBR1 gene is shown in SEQ ID NO.3:

[0030] SEQ ID NO.3:

[0031]

[0032] Forward primer: ATGCAGCTTCTTCGACTCCTT (SEQ ID NO.4);

[0033] Reverse primer: TTAGTCTAACTTGATTCGACC (SEQ ID NO.5).

[0034] PCR amplification was carried out using 2×Phanta Max Master Mix (Dye Plus) high-fidelity enzyme (Nanjing Novoprotein Scientific Inc.). The 50 μL amplification reaction system included: 2×Phanta Max MasterMix (Dye Plus), 25.0 μL; ddH2O, 20 μL; 10 μM primer, 2 μL; and 50 ng DNA template. The amplification reaction was performed on a Bioer PCR instrument, and the reaction program was: 94°C for 3 min; 94°C for 15 s, 55°C for 15 s, 72°C for 30 s, for 32 cycles; 72°C for 5 min. After recovering the fragment by agarose gel electrophoresis, a ligation reaction was carried out with pEASY-T1 Sample Cloning Vector (Takara Biotechnology Co., Ltd.). 10 μL of the ligation product was taken and transformed into Escherichia coli DH5α competent cells by heat shock method. 800 μL of liquid LB medium was added, and the cells were recovered for 1 h, then spread on an LB plate containing ampicillin antibiotic and cultured at 37°C for 14 h. White monoclonal colonies were selected, amplified and cultured in liquid LB medium containing ampicillin antibiotic, and then sequenced. After sequencing analysis, the full length of this gene was 2521 bp, with 1 intron and 2 exons. Its CDS were the segments 1-1286 bp and 1873-2521 bp respectively, and the full length of the CDS sequence was 1935 bp.

[0035] Take the young leaves of the disease-resistant parental rapeseed "ZS9mXccR-1", extract the total RNA of rapeseed with TriZol Reagent (Thermo Fisher Scientific), take 2.0 μg of total RNA for reverse transcription, and the reverse transcription kit used is Hifair III 1stStrand cDNA Synthesis Kit (Yeasen Biotech Co., Ltd., Shanghai). The steps of the reverse transcription reaction refer to the instruction manual of this kit. Using the cDNA synthesized by the reverse transcription reaction as a template, using SEQ ID NO.4 as the forward primer and SEQ ID NO.5 as the reverse primer, perform PCR amplification with 2×Phanta Max MasterMix (Dye Plus) high-fidelity enzyme (Nanjing Novozymes Biotech Co., Ltd.). The 50 μL amplification reaction system includes: 2×Phanta Max MasterMix (Dye Plus), 25.0 μL; ddH2O, 20 μL; 10 μM primer, 2 μL; and 50 ng cDNA template. The amplification reaction is carried out on a Bioer PCR instrument, and the reaction program is: 94 °C for 3 min; 94 °C for 15 s, 55 °C for 15 s, 72 °C for 30 s, for 32 cycles; 72 °C for 5 min. A fragment with a length of 1935 bp is obtained by PCR amplification. Sanger sequencing analysis shows that the sequence contains a complete CDS sequence, and the sequence is as shown in SEQ ID NO.1, and the encoded protein contains 644 amino acids, and the amino acid sequence is as shown in SEQ ID NO.2.

[0036] SEQ ID NO.1:

[0037]

[0038] SEQ ID NO.2:

[0039] MQLLRLLSLLVLFFHFISFSSSLNHDGLSLLALKSAVAHDPTRVMTSWSESDQTPCHWPGITCTRGRVTSLTLSGRRLSGYIPSELGLLDSLTRLELSRNNFSEPVPTRLFNAVNLRYIDLSHNSISGPVPAQIKALKNLTHLDVSSNRLNGSLPESLTQLGSLVGTLNLSYNRFSGEIPPSYGRFPVFVSLDLGHNNLTGKIPQIGSLLNQGPTAFAGNSDLCGFPLQKMCREPKLVAPKPEGSQILNRKPNRISEKNNKPVTGTVTVSLITGFSVVIGVVSLSVWLIRRKQSSGEFKSENTAAPPEEEKGKLVAMDEGFELELEDLLRASAYVVGKSRSGIVYRVVAGMGSGTVAATFSTSTVVAVRRLSDGDATWRRKDFENEVEAIGRVHHPNIVRLRAYYYAEDERLLITDYIRNGSLYSALHGGSSNTLPSLSWPERLRIAQGTARGLMYIHEYSPRKYVHGNLKSTKILLDDELQPRISGFGLTRLVSGYSKLTGSISAKRQSLDQTFLTSATVVTRISSPSVAYLAPEARATSGCKLSQKCDVYSFGVVLMELLTGRKPNASSENSGEELVCIVRSWFKEGKHLDEILDQEVINKGYEEKQVIAAIHVALNCTEKDPEVRPRMRSVSESLGRIKLD。

[0040] Example 2. Molecular Marker of Black Rot Resistance Gene BnBR1

[0041] By comparing the BnBR1 genomic sequence with the genomic sequence of the allele in the susceptible material - Brassica napus Zhongshuang 9 (ZS9), the results showed that there was a base difference in the intron region of BnBR1 compared with the susceptible material. In the resistant parent "ZS9mXccR-1", the amplified fragment length of marker 590-2 was 345 bp, and the 156th base was A; in the susceptible parent ZS9, the amplified fragment length of marker 590-2 was 344 bp, and the 156th base was T. Therefore, this molecular marker showed SNP polymorphism at the 156th base of the amplified sequence.

[0042] The primers for amplifying this sequence are as follows:

[0043] Forward primer 590-2F: GGTCCACCATCCGAATATC (SEQ ID NO.6);

[0044] Reverse primer 590-2R: AAGAGGAACACGCCAATC (SEQ ID NO.7).

[0045] If Brassica napus is resistant to black rot, the amplified fragment is as shown in SEQ ID NO.8:

[0046] GGTCCACCATCCGAATATCGTACGGCTGAGAGCTTATTACTATGCAGAGGACGAGAGGCTTTTGATCACGGATTACATACGTAATGGCAGCTTGTACTCTGCTTTACATGGTAATGGTTGTTAACTTCATCATTAGTTTAACCACTAATTACAATAATTATTCTTTTATTTTGTTGTTTTGCTTTTACCTTTATGAGGTTTGATTGAGATTGAGAGAAGAGACAAGATTAGGTTTATTTTGGGAGTTAGTGTTATTGATCGAGTTGATGGTTGGATCTATGTATATAAAGTTTTTGTCTTTGAGTATTTGTTTGATTCTATTGTTTTGATTGGCGTGTTCCTCTT;

[0047] If Brassica napus is susceptible to black rot, the amplified fragment is as shown in SEQ ID NO.9:

[0048] GGTCCACCATCCGAATATCGTACGGTTGAGAGCTTATTACTATGCAGAGGACGAGAGGCTTTTGATCACGGATTACGTTCGTAATGGCAGCTTGTACTCTGCTTTACATGGTAATGGTTGTTAACTTCATCATTAGTTTAACCACTAATTACAATTATTATTCTTTTATTTTGTTGTTTTGCTTT.ACCTTTATGAGGTTTGATTGAGATTGAGAGAAGAGAC AAGATTTGGTTTATTTTGGGAGTTAGTGTTATTGATCGAGTTGATGGTTGGATCTAT GTATATAAAGTTTTTGTCTTTGAGTCTTTGTTTGATTGTATTGTATTGATTGGCGTG TTCCTCTT。

[0049] Using the DNA of Brassica napus cultivars or breeding materials resistant to black rot as a template for amplification, if a 345-bp amplification fragment can be amplified with primers 590-2F / 2R and the 156th base is A, it indicates the presence of BnBR1 resistant to black rot in Brassica napus. The above SNP molecular marker provided by the present invention has high efficiency in identifying the presence of the BnBR1 resistance gene, can predict the black rot resistance of Brassica napus plants, and accelerate the breeding process of Brassica napus cultivars resistant to black rot.

[0050] Example 3. Construction of BnBR1 gene overexpression vector and genetic transformation

[0051] 1. Amplify the target gene

[0052] Amplify the CDS sequence of the BnBR1 gene according to the method in Example 1.

[0053] 2. Ligate to construct the pCAMBIA1301-BnBR1 recombinant vector

[0054] Digest the pCAMBIA1301 vector with NcoI-BglII to obtain the linearized pCAMBIA1301 vector, and ligate the recovered PCR amplification product with the linearized pCAMBIA1301 vector according to the instructions of the IIOne Step Cloning Kit (Nanjing Novizan Biotech Co., Ltd.). The reaction conditions are 50 °C for 30 min. After sequencing verification is correct, proceed to the next application.

[0055] 3. Positive clone sequencing

[0056] Primers were designed for the pCAMBIA1301 - BnBR1 vector to amplify the BnBR1 gene, and agarose gel electrophoresis PCR was performed for identification to verify the correctness of the BnBR1 gene in the pCAMBIA1301 - BnBR vector. The primer sequences for designing primers for the pCAMBIA1301 - BnBR1 vector are as follows:

[0057] Forward primer: AGAACACGGGGGACTCTTGAC (SEQ ID NO.10);

[0058] Reverse primer: GAGAAAAACTAGAAATTTACC (SEQ ID NO.11).

[0059] For transformation identification, DH5α competent cells were used. The specific process is as follows: First, take E. coli DH5α competent cells from the -80 °C refrigerator, place them on ice, and incubate on ice for 20 min. Then, pipette 2 μL of plasmid from -20 °C, add 50 μL of competent cells, mix well and transfer to a 1.5 mL EP tube, and incubate on ice for 30 min; Heat shock the EP tube at 42 °C for 90 s, and then quickly transfer it to an ice bath for 2 min; Add 950 μL of LB medium without antibiotics to the above EP tube, mix well and place it in a 37 °C, 220 rpm constant temperature shaker, and shake culture for 1 hour to resuscitate the bacteria; Take 50 μL and spread it on an LB solid medium containing kanamycin (100 μg / mL), incubate it upside down at 37 °C for 16 hours, and store it at 4 °C; Pick a single colony and transfer it to 5 mL of LB medium (containing kanamycin), shake culture at 37 °C, 220 rpm for 16 hours; Pick 3 colonies from each plate and inoculate them into LB medium containing 50 μg / mL kanamycin, and culture at 37 °C for 16 hours; After the culture is completed, extract the plasmid by the alkaline lysis method and perform sequencing verification; Re - transform the plasmid with correct sequencing into competent cells DH5α, and use a high - purity plasmid mid - scale extraction kit to extract the plasmid for standby. This plasmid is the plasmid overexpressing the BnBR1 gene.

[0060] 4. Transformation of the pCAMBIA1301 - BnBR1 recombinant vector into Brassica napus

[0061] The recombinant vector pCAMBIA1301-BnBR1 was transferred into Agrobacterium tumefaciens GV3101. Single colonies were picked for enlarged culture. After PCR verification without errors, an equal volume of 50% glycerol was added and mixed well, and it was stored at -70 °C for later use. The recombinant vector pCAMBIA1301-BnBR1 was introduced into the black rot-susceptible variety ZS9 by the Agrobacterium tumefaciens-mediated genetic transformation method. The specific method is as follows: The ZS9 seeds were disinfected and inoculated into a germination culture flask, and cultured in the dark at 23 °C for 5 days; the hypocotyls of rape seedlings were cut into segments of 0.4 - 0.6 cm and inoculated into the pre-culture medium, and cultured under light at 23 °C for 2 days; Agrobacterium was picked into the infection solution to prepare an Agrobacterium resuspension with an OD 600 = 0.2, and the explants were inoculated into the Agrobacterium suspension and infected for 10 min; the infected explants were inoculated on sterile filter paper to dry, and then inoculated on the co-culture medium, and cultured in the dark at 23 °C for 48 - 72 h; the co-cultured explants were inoculated on the decontamination medium, and cultured under light at 23 °C for 6 days; the decontaminated explants were inoculated on the selection / differentiation medium, with 30 explants per petri dish, and cultured under light at 23 °C. The plate was changed every 15 days, and the differentiated buds were inoculated on the rooting medium and cultured under light at 23 °C until roots grew.

[0062] Example 4. Functional verification of the BnBR1 gene transgenic

[0063] After obtaining the plants transformed with the BnBR1 gene overexpression vector, genomic DNA was extracted and amplified using the BnBR1 gene-specific primers to obtain 14 positive transgenic plants ( Figure 5 ).

[0064] The BnBR1 gene-specific primers are as follows:

[0065] Forward primer 590-1F: TCCGTCGTGATCGGAGTAGT (SEQ ID NO.12);

[0066] Reverse primer 590-1R: TCCGGTGAGCTTTGAGTAGC (SEQ ID NO.13).

[0067] After the positive transgenic plants were bagged and self-crossed to harvest T1 generation seeds, T1 generation positive single plants were identified using BnBR1 gene-specific primers, and disease resistance identification was carried out using the leaf-cutting inoculation method: when the seedlings grew to the four-leaf stage, they were inoculated with Xanthomonas campestris pv. campestris. The inoculation method was to dip the scissors into the suspension of Xanthomonas campestris pv. campestris for 2 s first, and then use the scissors to cut a wound about 2 cm in length in the direction perpendicular to the main vein at the tip of the fully expanded leaf. The bacterial liquid was dipped once for each cut, and sterile water was inoculated as a control. The seedlings were kept moist before and after inoculation. The length of the "V"-shaped lesion was measured on the 8th day after inoculation. The average value after removing the extreme values of the lesion length was used as the disease resistance phenotype. The transgenic positive lines BnBR1-1, BnBR1-8, and BnBR1-12 were identified and statistically analyzed for resistance to Xanthomonas campestris pv. campestris. The results are as Figure 6 and Figure 7 shown. The resistance of the three transgenic lines was significantly higher than that of the susceptible parent ZS9 ( Figure 6 ), confirming that the BnBR1 gene has the function of resisting Xanthomonas campestris pv. campestris. Therefore, the Xanthomonas campestris pv. campestris resistance gene BnBR1 can be applied in Brassica napus and can also be applied in Brassica napus seeds, and can be used to cultivate Brassica napus varieties with the performance of resisting Xanthomonas campestris pv. campestris.

[0068] Example 5. Verification of BnBR1 gene molecular markers

[0069] Materials: The Xanthomonas campestris pv. campestris-resistant parent "ZS9mXccR-1" (containing the Xanthomonas campestris pv. campestris resistance gene BnBR1), the Xanthomonas campestris pv. campestris-susceptible Brassica napus varieties ZS9, ZS11, Westar, Mendel, and ZY821.

[0070] The primers for the molecular marker were 590-2F and 590-2R.

[0071] Method: The genomic DNA of Brassica napus samples was extracted by the CTAB extraction method. The sample DNA was amplified using the primers 590-2F / R. The 50 μL reaction system included: 2×Phanta Max MasterMix (Dye Plus), 25.0 μL; ddH2O, 20 μL; 10 μM primers, 2 μL; and 50 ng DNA template. The amplification reaction was carried out on a Bioer PCR instrument, and the reaction program was: 94 °C for 3 min; 94 °C for 15 s, 55 °C for 15 s, 72 °C for 30 s, 32 cycles; 72 °C for 5 min. After the amplification products were recovered by agarose gel electrophoresis, they were ligated to the pEASY-T1 Sample Cloning Vector (Takara Biotechnology Co., Ltd.). Take 10 μL of the ligation product, transform Escherichia coli DH5α competent cells by the heat shock method, add 800 μL of liquid LB medium, resuscitate for 1 h, coat it on an LB plate containing ampicillin antibiotic, and culture at 37 °C for 14 h. Select white monoclonal colonies, amplify and culture them in liquid LB medium containing ampicillin antibiotic, and sequence. The results are as Figure 8as shown

[0072] The results showed that using the 590-2 molecular marker primer could amplify the corresponding 345bp or 344bp fragment, and the strain with the 156th base being T was susceptible to black rot, while the strain that amplified the corresponding 345bp fragment and the 156th base being A was resistant to black rot. The molecular marker method provided by the present invention can accurately screen out the strain containing the black rot resistance gene BnBR1, thus greatly improving the breeding efficiency.

[0073] As can be seen from the above examples, the present invention provides the black rot resistance gene BnBR1 of Brassica napus and its application. The BnBR1 gene can improve the resistance of Brassica napus to black rot. By applying BnBR1 to Brassica napus breeding through genetic transformation or hybridization, the resistance of Brassica napus varieties to black rot can be effectively improved, thereby reducing the damage of black rot and achieving the purpose of increasing production and stabilizing production.

[0074] The above are only the preferred embodiments of the present invention. It should be pointed out that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. The Brassica napus black rot-resistant gene BnBR1, characterized in that, The nucleotide sequence of BnBR1 is shown in SEQ ID NO.

1.

2. The protein encoded by the Brassica napus black rot resistance gene BnBR1 according to claim 1, characterized in that, The amino acid sequence of the said protein is shown in SEQ ID NO.

2.

3. A vector containing the Brassica napus black rot resistance gene BnBR1.

4. Use of the Brassica napus black rot resistance gene BnBR1 described in claim 1 in the following (1) and / or (2): (1) Use in the improvement of Brassica napus black rot resistance; (2) Use in the molecular breeding of Brassica napus black rot resistance.

5. A method for improving the resistance of Brassica napus to black rot, characterized in that, The said method includes overexpressing the Brassica napus black rot resistance gene BnBR1 described in claim 1 in rapeseed.

6. A primer pair for amplifying and identifying molecular markers for resistance to black rot in Brassica napus, characterized in that, The said primer pair includes a forward primer and a reverse primer. The nucleotide sequence of the forward primer 590-2F is shown in SEQ ID NO.6; the nucleotide sequence of the reverse primer 590-2R is shown in SEQ ID NO.

7.

7. Use of the primer pair described in claim 6 in the breeding of Brassica napus resistant to black rot.

Images