Recombinant HA gene and application thereof in improving HA protein expression level of H7 subtype influenza virus

Abstract

The invention discloses a recombinant HA (Hemagglutinin) gene and application thereof in improving the HA protein expression level of an H7 subtype influenza virus. The recombinant HA gene is obtained by replacing a 1-48bp sequence of an H7N9 influenza virus HA gene with a signal peptide of the H9N2 influenza virus HA gene. The invention relates to creation of a method for improving H7 subtype influenza virus HA protein expression based on an H9HA signal peptide sequence and application of the method. Transfection and salmonella vector infection tests prove that H9HA signal peptide sequence replacement can remarkably improve the H7 subtype influenza virus HA protein expression level; immune protection experiments prove that the H9HA signal peptide sequence can significantly improve the protection efficiency of the rSC0130 (pS-9s7m) vaccine against H7N9 virus challenge; the invention provides a feasible scheme for improving the expression level of the exogenous eukaryotic antigen delivered by the salmonella, and has great market application potential and potential economic benefits.

Description

Technical Field

[0001] The invention relates to a recombinant HA gene and application thereof in improving the expression level of HA protein of H7 subtype influenza virus, belonging to the technical field of genetic engineering. Background Art

[0002] Influenza A virus (IAV) belongs to the family Orthomyxoviridae, and to date, 18 combinations of HA and 11 NA subtypes have been identified. IAV is widely present in wild waterfowl and can spread widely and cross species barriers, causing multiple epidemics in animals and humans.

[0003] At present, many studies have shown that bacterial vectors, such as attenuated Salmonella, lactic acid bacteria, etc., can deliver protective antigens through oral immunization. At present, the main way for Salmonella vectors to deliver exogenous antigens is to carry prokaryotic expression plasmids and eukaryotic expression plasmids to express exogenous antigens in host immune cells. However, Salmonella is a prokaryotic cell, and there are significant deficiencies when it is used as a vector to deliver viral proteins, etc., which requires the use of host cell systems to express antigens. For example, the expression level of viral antigens delivered by Salmonella in host eukaryotic cells is extremely low, resulting in a serious lack of immune protection efficiency against viruses induced by Salmonella candidate vaccines that deliver viral antigens. Summary of the invention

[0004] Purpose of the invention: The technical problem to be solved by the present invention is to provide a method for improving the expression level of Salmonella-delivered virus antigens in eukaryotic cells and improving the protective efficiency of Salmonella vector-delivered virus antigen vaccines.

[0005] Technical solution: To solve the above technical problems, the present invention provides a recombinant HA gene, wherein the recombinant HA gene is obtained by replacing the 1-48bp sequence of the HA gene of the H7N9 influenza virus with the signal peptide of the HA gene of the H9N2 influenza virus; the GenBank accession number of the HA gene of the H9N2 influenza virus is KJ000710.1.

[0006] Wherein, the nucleotide sequence of the signal peptide of the H9N2 influenza virus HA gene is shown as SEQ ID NO.1.

[0007] Wherein, the nucleotide sequence of the recombinant HA gene is shown as SEQ ID NO.2.

[0008] The H7 HA protein signal peptide is replaced with the H9 HA protein signal peptide sequence to create a method for increasing the expression level of foreign antigens delivered by Salmonella virus in eukaryotic cells.

[0009] The present invention also provides a recombinant plasmid and a recombinant bacterium, which contain the recombinant HA gene.

[0010] The present invention also provides the use of the signal peptide of the H9N2 influenza virus HA gene, the recombinant HA gene or the recombinant plasmid, and the recombinant bacteria in improving the expression level of the HA protein.

[0011] The present invention also provides a method for improving the expression level of HA protein, comprising the following steps: inserting the recombinant HA gene into an expression vector, and transfecting to obtain cells with high HA protein expression level.

[0012] The present invention also provides a cell with a high HA protein expression level obtained by the method.

[0013] The present invention also provides a method for preparing a strain with a high expression level of HA protein, comprising the following steps: inserting the recombinant HA gene into an expression vector, adding competent cells, and identifying the correct clone by PCR as the strain with a high expression level of HA protein.

[0014] The present invention also provides a strain with a high HA protein expression level prepared by the method.

[0015] The present invention also provides the use of the signal peptide of the H9N2 influenza virus HA gene, the recombinant HA gene or the recombinant plasmid, and the recombinant bacteria in preparing a medicine or vaccine for treating and / or preventing influenza A virus.

[0016] The present invention intends to increase the expression level of Salmonella-delivered virus antigens in eukaryotic cells and improve the protective efficiency of Salmonella vector-delivered virus antigen vaccines.

[0017] HA protein plays an extremely important role in the entire life cycle of influenza virus, mainly including: recognizing and binding to cell surface receptors, assisting the virus to enter host cells and inducing the host to produce neutralizing antibodies. Therefore, HA protein is the main antigen of influenza virus vaccine. In previous studies, it was found that under the same conditions, the protein level expressed by the eukaryotic expression plasmid containing H9 HA protein was significantly higher than that of H7 HA protein. The present invention designs to replace the H7 HA protein signal peptide with the H9 HA protein signal peptide sequence to create a method for increasing the expression level of exogenous antigens of Salmonella delivery virus in eukaryotic cells.

[0018] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. The present invention relates to the creation and application of a method for improving the expression of HA protein of H7 subtype influenza virus based on H9HA signal peptide sequence. Transfection and Salmonella vector infection experiments prove that H9 HA signal peptide sequence replacement can significantly improve the expression level of HA protein of H7 subtype influenza virus; 2. Immune protection experiments prove that H9 HA signal peptide sequence can significantly improve the protection efficiency of rSC0130 (pS-9S7M) vaccine against H7N9 virus attack; 3. The present invention provides a feasible solution for improving the expression level of exogenous eukaryotic antigens delivered by Salmonella, which has great market application potential and potential economic benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 PCR identification of χ6212 (pS0017-9S7M) bacterial solution;

[0020] Figure 2 Western blot identification of HA protein with signal peptide replacement;

[0021] Figure 3 It is rSC0130 (pS0017-9S7M) bacterial liquid PCR identification;

[0022] Figure 4 Western blot identification of HA protein in HEK293T cells after rSC0130 (pS0017-9S7M) infection;

[0023] Figure 5 The HI titer of serum of SPF chickens immunized with rSC0130 (pS0017-9S7M) bacterial solution;

[0024] Figure 6 The neutralizing antibody titer of SPF chicken serum after immunization with rSC0130 (pS0017-9S7M) bacterial solution;

[0025] Figure 7 The mortality rate of SPF chickens vaccinated after challenge with the homologous H7N9 avian influenza virus;

[0026] Figure 8 Pathological changes in the lungs of SPF chickens immunized with the homologous H7N9 avian influenza virus. DETAILED DESCRIPTION

[0027] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0028] Example 1: Construction of H7N9 avian influenza virus HA antigen containing H9N2 avian influenza virus HA signal peptide sequence

[0029] The gene sequence of the signal peptide was extracted from the H9N2 influenza virus HA gene (GenBank: KJ000710.1 on NCBI), and the sequence is shown in SEQ ID NO.1: ATGGAGACCATCAGCCTGATCGCCATCCTGGTG GTGGCCACCGTGAGC, replacing the 1-48bp sequence of the H7N9 influenza virus HA gene. The corresponding gene fragment was then synthesized and sequence optimized, and the sequence is shown in SEQ ID NO.2, and a Flag tag was introduced at the 3' end of the gene fragment. The H7N9 influenza virus HA gene was used as a control, and the corresponding gene fragment was synthesized and sequence optimized, and the sequence is shown in SEQ ID NO.3, and a Flag tag was also introduced at the 3' end of the gene fragment.

[0030] Example 2: Construction of a eukaryotic expression plasmid expressing H7N9 avian influenza virus HA antigen

[0031] The HA gene obtained in Example 1 (sequences shown in SEQ ID NO.2 and SEQ ID NO.3) was inserted into the expression vector pS0017 (sequence shown in SEQ ID NO.4) stored in this laboratory using homologous recombination to form recombinant expression plasmids pS0017-9S7M (sequence shown in SEQ ID NO.5) and pS0017-H7HA (sequence shown in SEQ ID NO.6). Subsequently, the plasmid pS0017-9S7M was transformed into the defective strain χ6212 stored in this laboratory (strain gene information: Ф80d lacZΔM15deoRΔ(lacZYA-argF)-U169 glnV44λ - gyrA96 recA1 endA1ΔasdA4Δzhf-2∷Tn10hsdR17(R - M +); the article disclosing the strain: Ashraf, S., W. Kong, S. Wang, J. Yang, and R. Curtiss. 2011. Protective cellular responses elicited by vaccination within fluenza nucleoprotein delivered by a live recombinant attenuated Salmonella vaccine. Vaccine 29: 3990-4002.), picked the clone, and identified it by PCR and sequencing. The correct clone was identified as the positive clone and named χ6212 (pS0017-9S7M). The PCR reaction program was: 98°C 2min, 98°C 10s, 55°C 10s, 72°C 1min, 72°C 5min, for a total of 34 cycles. The PCR reaction system is shown in Table 1.

[0032] Table 1 PCR amplification system

[0033]

[0034]

[0035] PCR results are as follows Figure 1 As shown, lane 1 is DL5000 marker, and lanes 2-3 are the identification results of χ6212 (pS0017-9S7M). The identification primers (F: SEQ ID NO.7: 5'-CGGTGGGAGGTCTATATAAGCA G-3', R: SEQ ID NO.8: 5'-CTGCATTCTAGTTGTGGTTTGTCC-3') amplified a fragment of the expected size, 1719 bp (SEQ ID NO.2), confirming that the χ6212 (pS0017-9S7M) strain was successfully obtained. Example 3: Expression level detection of the eukaryotic expression plasmid expressing the HA antigen of the H7N9 avian influenza virus in HEK293T cells

[0036] use Transfection was performed using Transfection Reagent when the cells were in good condition and the confluence reached about 80%. Add 1000ng pS0017-9S7M plasmid DNA to 100μL of antibody-free and blood-free DMEM, then add 7μl Lipofectamine reagent, mix and incubate at room temperature for 20min. Discard the original culture medium in the culture plate and wash 3 times with PBS. Add 400μl serum-free culture medium to each well. Add 100μL of the above mixture to each well and gently tilt to mix. Incubate at 37°C, 5% CO2 for 6h. Discard the transfection medium, wash 3 times with PBS, and add LB culture medium for culture. Screen under a microscope after 48h. Cells cultured for 48h were lysed using high-efficiency RIPA cell lysis buffer (400μl / well), 100ul of 5×SDS-PAGE loading buffer was added, placed in boiling water, and boiled for 10min. Use Precast Tris-Glycine Gel (12%) (full gold, DG102-01), and perform SDS-PAGE electrophoresis at a concentration voltage of 80 V and a separation voltage of 120 V. After the electrophoresis is completed, install it on a transfer device (BIO-RAD, 1658004) in the order of negative electrode-sponge-thick filter paper-separation gel-nitrocellulose filter membrane (NC) membrane-thick filter paper-positive electrode, and then place it in an ice bath and transfer it at 80 V for 120 min. The NC membrane was removed, washed 3 times with TBST, 5 min each time, placed in blocking solution, blocked at room temperature for 2.5 h, washed 6 times with TBST, 5 min each time, used Flag tag monoclonal antibody (Biyuntian, AF2852) as primary antibody, diluted 1:3000, incubated at 4°C overnight, washed 6 times with TBST, 5 min each time, used goat anti-mouse IgG-HRP (Boster, BA1050) as secondary antibody, diluted 1:1000 (V / V), incubated at room temperature for 2 h, washed 6 times with TBST, 5 min each time, and developed. The results are shown in Figure 2 As shown, lane 1 is a protein marker (Novozyme, MP102), lane 2 is the result of pS0017-H7HA transfection, and lane 3 is the result of pS0017-9S7M transfection. β-actin is used as an internal reference, indicating that H9 signal peptide sequence replacement can significantly increase the expression level of HA protein. Example 4: Identification of HA expression level after cells infected with candidate vaccine strain rSC0130 (pS0017-9S7M) that delivers H7N9 avian influenza virus HA antigen eukaryotic expression plasmid

[0037] Preparation of rSC0130 competent cells: Take out the rSC0130 strain constructed in this experiment and freeze it at -70°C (the article that published this strain: Vet Microbiol.2024Oct 9:298:110264.doi:10.1016 / j.vetmic.2024.110264.), pick a small amount of bacterial liquid with an inoculation loop and streak three lines on an LB plate containing arabinose and DAP, culture at 37°C for 18h, pick a single colony and inoculate it in a test tube containing 5mL LB liquid culture medium, and culture it at 37°C with a horizontal shaker at 220rpm for 12h; add the bacterial liquid to 100mL LB liquid culture medium containing 0.2% arabinose and DAP at a ratio of 1:100, and culture it at 37°C with shaking for about 4h to make its OD value 0.4-0.5; take 50mL of bacterial liquid and place it in a sterile 50mL centrifuge tube and ice bath for 30min; centrifuge at 4°C, 4000rpm for 10min, and discard the supernatant; add 15mL of pre-cooled 0.1mol / L CaCl2 solution, gently resuspend the precipitate, ice bath for 20 minutes, centrifuge at 4000rpm at 4℃ for 10 minutes, and discard the supernatant; put on ice, use 15mL pre-cooled 0.1mol / LCaCl2 to gently resuspend the precipitate again, ice bath for 20 minutes, centrifuge at 4000rpm at 4℃ for 10 minutes, and discard the supernatant; use 1.5mL pre-cooled 0.1mol / LCaCl2 glycerol storage solution to gently resuspend the precipitate, dispense into 1.5mL finger tubes at 100μL / tube, and keep at -70℃ for use.

[0038] Take out the rSC0130 competent cells, place them on ice to melt, add the pS0017-9S7M plasmid to 50 μL of rSC0130 competent cells, mix gently, and place them on ice for 30 minutes; heat shock in a 42°C water bath for 90 seconds, and then quickly place them on ice for 3 minutes; add LB liquid culture medium (without antibiotics) preheated at 37°C to make the final volume 1mL; shake well, culture at 37°C for 1h, 150rpm; after gently blowing, take 100 μL of culture solution and inoculate it on the LB plate culture medium containing arabinose with a final concentration of 0.2%, and spread it evenly with a glass rod; place the culture dish in a 37°C constant temperature incubator for 30 minutes, and after the bacterial solution is completely absorbed by the culture medium, invert the culture dish and place it in a 37°C constant temperature incubator overnight. After identifying the positive colony, perform PCR identification on the positive bacteria. The correct clone was identified as the positive clone and named rSC0130 (pS0017-9S7M). The PCR reaction procedure and system are shown in Example 1. The identification primers (F: SEQ ID NO.9: 5'-CGGTGGGAGGTCTATATAAGCAG-3', R: SEQ ID NO.10: 5'-CTG CATTCTAGTTGTGGTTTGTCC-3') amplified a fragment of the expected size, 1719 bp (SEQ ID NO.2), confirming that the rSC0130 (pS0017-9S7M) strain was successfully obtained ( Figure 3 ). Among them, the first lane is DL5000 marker, and the 2nd and 3rd lanes are the identification results of rSC0130 (pS0017-9S7M).

[0039] HEK293T cells with good growth conditions were mixed with MDCK cells (stored in this laboratory) at a ratio of 3:1 and plated in a 6-well plate and cultured at 37°C overnight. The rSC0130 (pS0017-9S7M) colony was picked and added to a 5 ml test tube and cultured at 37°C overnight. Then the bacterial solution was transferred at a ratio of 1:100 and cultured until OD 600 =0.9. Take 1 ml of bacterial solution and centrifuge at 8000rpm for 8min, wash twice with sterile PBS, resuspend the bacterial solution with 100μL DMEM, and infect the cells at a dose of MOI=10 for 1h. Then wash 3 times with DMEM, add 1ml of DMEM medium containing gentamicin to each well (the concentration of gentamicin is 100μg / mL), and incubate for 90min to kill extracellular bacteria. Then, wash each well three times with 1ml of DMEM. After maintaining for 24h, collect the cells for WB experiment to detect HA protein expression. The results are as follows Figure 4As shown, the first lane is the protein marker (Novozymes, MP102), the second lane is the infection result of rSC0130 (pS0017-H7HA) (the control group constructed in our laboratory), and the third lane is the infection result of rSC0130 (pS0017-9S7M). β-actin is used as the internal reference. The results show that the candidate vaccine strain rSC0130 (pS0017-9S7M) that delivers the H7N9 avian influenza virus HA antigen eukaryotic expression plasmid can significantly and higher level express HA protein after infecting cells.

[0040] Example 5: Determination of the immune protection efficacy of the rSC0130 (pS0017-9S7M) recombinant Salmonella candidate vaccine

[0041] Oil seedling preparation: Formaldehyde diluent was prepared at a ratio of formaldehyde: PBS (0.01 mol / L, pH = 7.2) = 1:49; the virus was inactivated at a ratio of H7N9 influenza virus allantoic fluid: formaldehyde diluent = 43:7, incubated at 37°C shaking for 12 hours, and left to stand at 4°C overnight. The inactivated allantoic fluid was inoculated into 10-day-old SPF chicken embryos to detect the inactivation effect; after the inactivation was completed, the aqueous phase and the oil phase were prepared; aqueous phase: Tween-80 (Sigma, 9005-65-6) with a final concentration of 4% was added to the inactivated allantoic fluid, and shaken at 37°C to fully dissolve; oil phase: Span-20 (Sigma, 1338-39-2) with a final concentration of 4% was added to the sterilized mineral oil; the aqueous phase and the oil phase were mixed at a ratio of 1:3 and fully emulsified.

[0042] Experimental groups: rSC0130 (pS0017-9S7M) immunization group, rSC0130 (pS0017-H7HA) immunization group, empty vector immunization control group, oil vaccine immunization control group and PBS control group were set up respectively; experimental animals: 1-day-old SPF chickens, 14 in each group, a total of 70. Immunization route: oral immunization with SC0130 (pS0017-9S7M) and rSC0130 (pS0017-H7HA), 5×10 9 CFU / mouse, no food or water for 4 hours before immunization; oil seedling subcutaneous injection in the neck, 200μL / mouse; empty vector oral immunization, 5×10 9 CFU / mouse; PBS group was orally immunized with 0.2mL sterile PBS. Immunization schedule: first immunization at 1 day old, second immunization at 14 days old, and third immunization at 28 days old.

[0043] Two weeks after the third immunization, blood was collected from all test chickens to collect serum and detect the antibody level in the serum. Serum preparation: 1 ml of blood was collected, 37°C for 2 hours, 3000 rpm for 6 minutes; supernatant was taken and placed at 4°C. Operation steps: 25 μL of PBS was added to each 96 plastic plate; 25 μL of serum was added to the first well, diluted 1:2, and the first well was gently blown with a pipette (about 30 times) to mix it thoroughly, and 25 μL was aspirated and placed in the second well. The same method was used until the last well. 25 μL should be discarded after blowing the last well; 25 μL of four units of antigen was added to each well, and it was placed at room temperature (20°C) for 30 minutes. 25 μL of 1% chicken red blood cells was added to each well, and it was placed at room temperature (20°C) for 30 minutes, and the results were observed. Control group setting: 25 μL of chicken red blood cells plus 50 μL of PBS. The well with the highest dilution concentration on the hanging line was taken as the result. The antibody results are as follows Figure 5 As shown, the results showed that rSC0130(pS0017-9S7M) Salmonella vector vaccine could induce higher levels of HI titers in chickens compared with rSC0130(pS0017-H7HA).

[0044] Two weeks after the three vaccinations, the serum of chickens in each group was collected for micro-neutralization test. The method is as follows:

[0045] (1) Sample processing: Each group of serum samples was heat inactivated in a water bath at 56°C for 30 min; (2) Serum serial dilution: The inactivated serum was added to a 96-well plate and serially diluted with DMEM medium from 1:10 to 1:10240, with a volume of 50 μL after dilution; (3) H7N9 influenza virus liquid (10 7 TCID 50 / 100 μL) diluted to 100 TCID 50 / 50 μL of virus solution; (4) add 50 μL of diluted 100 TCID 50 / 50μL of virus solution, incubate in a 37℃ incubator for 1h; (5) Take a 96-well cultured MDCK cell monolayer with a growth confluence rate of 90%, wash it three times with PBS, then add the serum virus mixture to the MDCK cell wells, and incubate it in a 37℃, 5% CO2 incubator; (6) Observe the cell lesions on day 3, take 25μL of the supernatant to a disposable blood coagulation plate, add 25μL of 1% chicken red blood cell suspension to each well, and observe the results after standing at room temperature for 30min. The results of neutralizing antibodies are as follows Figure 6 As shown, the results showed that rSC0130(pS0017-9S7M) Salmonella vector vaccine could induce higher levels of neutralizing antibodies in chickens compared with rSC0130(pS0017-H7HA).

[0046] Two weeks after the third vaccination, AIV was challenged by nasal and eye drops with a dose of 100 LD 50 . The mortality of chickens was observed within 7 days after the challenge. Lung tissue samples were collected 6 days after the challenge, and pathological sections were made to observe the histopathological changes. Figure 6 The results showed that rSC0130 (pS0017-9S7M) Salmonella vector vaccine can significantly improve the survival rate of immunized chickens ( Figure 7 ). Histopathological changes and scores Figure 8 As shown in the figure, the results showed that the chickens in the rSC0130 (pS0017-H7HA) immunization group had pathological changes such as hemorrhage, a large number of inflammatory cell infiltration, and disappearance of alveolar structure in the lungs. However, the pathological changes in the rSC0130 (pS0017-9S7M) immunization group were significantly alleviated, showing a lower level of inflammatory cell infiltration, and the alveolar structure was able to remain intact.

Claims

1. A recombinant HA gene, characterized in that: The recombinant HA gene is obtained by replacing the 1-48bp sequence of the H7N9 influenza virus HA gene with the signal peptide of the H9N2 influenza virus HA gene; the GenBank accession number of the H9N2 influenza virus HA gene is KJ000710.

1.

2. The recombinant HA gene according to claim 1, characterized in that: The nucleotide sequence of the signal peptide of the H9N2 influenza virus HA gene is shown in SEQ ID NO.

1.

3. The recombinant HA gene according to claim 1, characterized in that: The nucleotide sequence of the recombinant HA gene is shown in SEQ ID NO.

2.

4. A recombinant plasmid or recombinant bacterium, characterized in that: It contains the recombinant HA gene according to any one of claims 1 to 3.

5. Use of the signal peptide of the H9N2 influenza virus HA gene with a nucleotide sequence as shown in SEQ ID NO.1, the recombinant HA gene according to any one of claims 1 to 3, or the recombinant plasmid or recombinant bacteria according to claim 4 in improving the expression level of HA protein.

6. A method for increasing the expression level of HA protein, characterized in that: The method comprises the following steps: inserting the recombinant HA gene according to claim 1 or 2 into an expression vector, and performing transfection to obtain cells with a high HA protein expression level.

7. A cell with a high HA protein expression level obtained by the method of claim 6.

8. A method for preparing a strain having a high expression level of HA protein, characterized in that: The method comprises the following steps: inserting the recombinant HA gene of any one of claims 1 to 3 into an expression vector, adding competent cells, and identifying the correct clone by PCR as the strain with high HA protein expression level.

9. A strain with a high HA protein expression level prepared by the method of claim 8.

10. Use of the signal peptide of the H9N2 influenza virus HA gene with a nucleotide sequence as shown in SEQ ID NO. 1, the recombinant HA gene according to any one of claims 1 to 3, or the recombinant plasmid or recombinant bacteria according to claim 4 in the preparation of a drug or vaccine for treating and / or preventing influenza A virus.

Images