Preparation method and application of multi-stem-loop structured dual-targeting RNA molecule capable of preventing and treating liver cancer

Abstract

The invention discloses a preparation method and application of a multi-stem-loop structured dual-targeting RNA molecule capable of preventing and treating liver cancer, a hairpin ring and a Tetra-U element are used for connecting a plurality of siRNAs capable of targeting GP73 or hTERT in series to form multi-siRNA, a large amount of RNA molecules can be obtained through prokaryotic expression and induced extraction, the synthesis cost of siRNA drugs is reduced, the RNA molecules can be directly added into cells, and the preparation method is simple and convenient. The RNAi mechanism in the hepatoma cells is triggered without any delivery carrier, so that the expression of target genes in the hepatoma cells is silenced, and the growth of the hepatoma subcutaneous tumor is inhibited through intratumor injection.

Description

Technical Field

[0001] The present invention relates to a preparation method and application of a dual-targeting RNA molecule, and more specifically, to a preparation method and expression, toxicity verification method and application of a dual-targeting RNA molecule with a multi-stem-loop structure of a drug capable of preventing and treating liver cancer, and belongs to the field of biomedicine. Background Art

[0002] Liver cancer is a malignant tumor of the liver, which can be clinically divided into two types: primary liver cancer and secondary liver cancer. Primary liver cancer originates in the liver and is called hepatocellular carcinoma (HCC). Hepatocellular carcinoma is considered to be the most common primary liver cancer in adults, accounting for about 90% of primary liver cancer. Hepatocellular carcinoma is the fifth most common cancer in the world, second only to pancreatic cancer, with a 5-year survival rate of only 18%. In my country, 110,000 patients die from liver cancer each year, and the mortality rate of liver cancer is second only to gastric cancer and esophageal cancer, making it the third most common malignant tumor. Once most people's liver cancer is discovered, it is already in the middle and late stages, so conventional surgical treatment and chemotherapy cannot achieve good therapeutic effects. The treatment drug used for patients with advanced liver cancer in the past 10 years is sorafenib. In 2018, the FDA newly approved lenvatinidinib as a first-line HCC treatment drug. The second-line treatment drug is regorafenib, an oral multikinase inhibitor that can block the kinase activity that promotes cell proliferation, metastasis, angiogenesis and tumor immunity. In addition, other drugs are also used as second-line drugs, such as pembrolizumab, nivolumab, etc.

[0003] Currently, RNAi therapy is considered a promising therapeutic platform. siRNA can knock down the expression of target genes in a sequence-specific manner, and can provide more precise and personalized treatments for various diseases. However, naked siRNA is very easy to degrade both in vivo and in vitro, so nanocarriers are needed to protect siRNA to improve its stability and increase the cellular absorption efficiency of siRNA. Although a lot of research has been conducted on siRNA nanocarriers in recent years, there are widespread problems such as low delivery efficiency and carrier self-toxicity.

[0004] Golgi protein-73 (GP73), also known as GOLM1, is constantly expressed in bile duct epithelial cells of normal liver and almost not expressed in hepatocytes. However, GP73 is significantly upregulated in diseased liver regardless of the cause. In 2017, Ye et al. identified GOLM1, one of the specific genes for HCC metastasis, through whole genome sequencing. The researchers chose shRNA with high knockout efficiency to silence the expression of endogenous GOLM1 in HCC cells. The experimental results showed that knocking down the expression of GOLM1 had a considerable inhibitory effect on the proliferation of some liver cancer cells with high GOLM1 expression. Therefore, inhibiting the expression of GOLM1 can inhibit the development of liver cancer and even treat liver cancer, providing a new therapeutic approach for liver cancer treatment.

[0005] Telomeres are a special type of nuclear protein located at the end of linear chromosomes. Their function is to protect the natural ends of linear chromosomes and prevent DNA breakage or some unnecessary damage. Each time a cell divides, the telomeres shorten. After 50 cycles, the telomere length becomes very short. The shortest telomeres activate DNA damage signals, which induce non-homologous DNA end links, causing cell aging and apoptosis. However, cancer cells can repair telomeres by activating telomerase or telomere replacement extension systems. In humans, telomerase expression is only expressed in stem cells or germline cells, and is almost not expressed in normal adult tissues. However, in 85-90% of human cancers, telomerase activity can be detected at every stage of tumor development, from cancer stem cells to metastatic cancer cells. Telomerase plays a core role in the replication and immortality of cancer cells. In a 2009 study, Dong et al. designed siRNA targeting hTERT. The results showed that hTERT siRNA showed the effects of downregulating telomerase activity in breast cancer cells, inhibiting the viability of breast cancer cells in vivo and in vitro, and causing apoptosis of breast cancer cells both in vivo and in vitro. Therefore, telomerase is also a target for cancer treatment.

[0006] At present, there is no siRNA that silences hTERT sites for the treatment of liver cancer. Existing siRNA drugs on the market all rely on delivery vectors. However, since siRNA is unstable and easily degraded in vitro or in vivo, nanocarriers are usually needed to improve the stability and cell absorption efficiency of siRNA and improve the efficacy of siRNA. However, delivery vectors not only increase the burden on the kidneys, but also easily induce immunity. Therefore, it is necessary to design an RNAi drug that can simultaneously target GP73 and hTERT genes, has a stable structure, and has high RNAi efficiency, without the need for additional delivery vectors, and can also have a significant therapeutic effect on liver cancer. Summary of the invention

[0007] In order to solve the above-mentioned problems of the prior art, the present invention provides a method for preparing a dual-targeting RNA molecule with a multi-stem-loop structure that can prevent and treat liver cancer drugs, which has the technical characteristics of improving the stability of RNA, avoiding the use of delivery vectors, improving the silencing effect on target genes, and improving the efficiency of RNAi therapy.

[0008] The present invention also provides a method for verifying the toxicity of dual-targeting RNA molecules in cells, silencing the expression of target genes in liver cancer cells using dual-targeting RNA molecules, and applications of dual-targeting RNA molecules.

[0009] In order to achieve the above object, the present invention is implemented by the following technical solutions:

[0010] A method for preparing a dual-targeting RNA molecule with a multi-stem-loop structure capable of preventing and treating liver cancer, the preparation method comprising the following steps:

[0011] Step 1): Design of siRNA (DSIR) online siRNA design program was used to design siRNAs for two target genes hTERT and GP73, and siRNAs with a score of >90 and consecutive identical nucleotides <4 were screened out to obtain 6 siRNAs, namely siR1, siR2, siR3, siR4, siR5, and siR6; among them, siR1-siR5 targeted hTERT, and siR6 targeted GP73;

[0012] Step 2): The six siRNAs are respectively used to form shRNA using hairpin loop sequences, and finally the shRNAs are connected in series using Tetra-U to form a long chain sequence with multiple hairpin structures, named multi-siRNA.

[0013] Preferably, siR1 sequence: UUGCUCCAGACACUCUUCCGG;

[0014] siR2 sequence: UUGGUCUCGGCGUACACCGGG;

[0015] siR3 sequence: AUAGCUGGAGUAGUCGCUCUG;

[0016] siR4 sequence: UAGAUGUUGGUGCACACCGUC;

[0017] siR5 sequence: UAGUUGAGCACGCUGAACAGU;

[0018] siR6 sequence: UUCUAUUCGCUCCUCACACUG.

[0019] Preferably, the multi-siRNA sequence is as follows:

[0020] GGGCAGAGUGGACCAUCAUUCCUUUUGCCAUAGCUGGAGUAGUCGCUC

[0021] UGCACCGCAAGGUGCAGAGCGACUACUCCAGCUAUGGCUUUUGCUACC

[0022] GGAAGAGUGUCUGGAGCAAGAGUGGACCAUCAUUCCUUUUGCCUAGAU

[0023] GUUGGUGCACACCGUCUGGCUCCGGCCAGACGGUGUGCACCAACAUCU

[0024] AGGCUUUUGUCCCCCGGUGUACGCCGAGACCAAGAGUGGACCAUCAUU

[0025] CCUUUUGCCUAGUUGAGCACGCUGAACAGUGCCCGCAAGGGCACUGUU

[0026] CAGCGUGCUCAACUAGGCUUUUGCCUCAGGAACACCAAGAAGUUCAAA

[0027] GGAGGCAUGAACUUCUUGGUGUUCCUGAGGCUUUUGGAAUGAUGGUCC

[0028] ACUCUUGGUCUCGGCGUACACCGGGGGACUUUUGGAAUGAUGGUCCAC

[0029] UCUUGCUCCAGACACUCUUCCGGUAGCUUUUGGAAUGAUGGUCCACUC

[0030] UGCCCGGAUGGUCCACUCCUUACACUUUUGGAAUGAUGGUCAAGCCUC

[0031] CAGACCAUCAUUCCUUUUGCCUUCUAUUCGCUCCUCACACUGUUCCUUC

[0032] GGGAACAGUGUGAGGAGCGAAUAGAAGGCUUUUGUGUAAGGAGUGGA

[0033] CCAUCC。

[0034] Preferably, the multi-siRNA can be inserted into a specific expression vector to be expressed in prokaryotes.

[0035] Preferably, a T7 promoter sequence is added upstream of the multi-siRNA coding DNA sequence, and restriction sites for endonucleases Bgl II and Bpu1102 I are added at both ends of the sequence, respectively. The corresponding DNA sequence is obtained by chemical synthesis (by Nanjing GenScript Biotech Co., Ltd.), and then inserted into the prokaryotic expression vector pET-28a between the sites of Bgl II and Bpu1102 I, which is transformed into Escherichia coli HT115 (DE3), and can be synthesized and accumulated in Escherichia coli by IPTG induction, so that a large amount of RNA molecules can be obtained.

[0036] Preferably, by inducing transformation of Escherichia coli engineered bacteria carrying a multi-siRNA plasmid and extracting total RNA from Escherichia coli, specific bands different from total RNA from prokaryotes can be obtained to explore the feasibility of prokaryotic expression.

[0037] Method for verifying the toxicity of dual-targeting RNA molecules in cells: Vero cells were cultured at 5×

[0038] 10 3 cells / well were plated in a 96-well cell culture plate. After adherence, multi-siRNA was added to the cell culture medium at concentrations of 100 ng / μL, 200 ng / μL, 500 ng / μL, and 1000 ng / μL, respectively. Six replicate wells were set for each concentration, and MTT was added at 24 h, 48 h, and 72 h, respectively.

[0039] Method for verifying the toxicity of dual-targeting RNA molecules in cells: Hep3B cells were cultured at 7×10 3 cells / well were plated in a 96-well cell culture plate. After the cells adhered to the plate, 50 ng / μL, 100 ng / μL, 150 ng / μL, and 200 ng / μL of the same concentration were added to the cells. Six replicate wells were set for each concentration. The treatment was terminated at 24 h, 48 h, and 72 h, and MTT detection was performed.

[0040] The dual-targeting RNA molecules silenced the expression of target genes in liver cancer cells. Multi-siRNA and PBS were added to Hep3B cells respectively. Cell RNA was extracted after 24 hours to detect the expression of GP73, hTERT mRNA and target protein in the cells.

[0041] An application of a dual-targeting RNA molecule with a multi-stem-loop structure capable of preventing and treating liver cancer, including a drug containing the dual-targeting RNA molecule.

[0042] Beneficial effects: By concatenating multiple siRNAs into a single RNA molecule, it can be produced in large quantities through prokaryotic expression, solving the problems of high cost of siRNA synthesis and easy degradation of siRNA. It can be directly added to cells without the need for any delivery vector, triggering the RNAi mechanism in liver cancer cells, thereby silencing the expression of target genes in liver cancer cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 Multi-siRNA secondary structure prediction diagram.

[0044] Figure 2 Multi-siRNA prokaryotic expression / induced extraction band diagram.

[0045] Figure 3 Vero cell toxicity test results at 24 hours.

[0046] Figure 4 Vero cell toxicity test results at 48h.

[0047] Figure 5 Vero cell toxicity test results at 72h.

[0048] Figure 6 Test chart of multi-siRNA inhibiting the growth of liver cancer cells in 24 hours.

[0049] Figure 7 Test chart of multi-siRNA inhibiting the growth of liver cancer cells in 48 hours.

[0050] Figure 8 Test chart of multi-siRNA inhibiting the growth of liver cancer cells for 72 hours.

[0051] Fig. 9 One of the expression diagrams of target genes silenced by multi-siRNA in liver cancer cells.

[0052] Fig.10 Figure 2: Multi-siRNA silencing target gene expression in liver cancer cells.

[0053] Fig.11 Schematic diagram of multi-siRNA silencing target protein expression in liver cancer cells.

[0054] Fig.12 Growth curve of subcutaneous liver cancer tumors inhibited by multi-siRNA.

[0055] Fig.13 Ladder diagram of multi-siRNA inhibition of subcutaneous hepatocellular carcinoma growth. DETAILED DESCRIPTION

[0056] The present invention will be further described below in conjunction with the accompanying drawings, but the present invention is not limited to the following embodiments.

[0057] The present invention designs and evaluates siRNA that can effectively silence GP73 and hTERT genes, and concatenates them into an RNA molecule named multi-siRNA. Inserting a specific expression vector enables it to be expressed in prokaryotes, greatly reducing the synthesis cost of siRNA. By inducing the transformation of Escherichia coli engineered bacteria carrying multi-siRNA plasmids, extracting Escherichia coli total RNA, and obtaining specific bands different from prokaryotic total RNA, the feasibility of prokaryotic expression was explored. The toxicity of multi-siRNA was explored through the MTT experiment, and the effect of multi-siRNA on the migration of liver cancer cells was also explored in the scratch experiment. The silencing efficiency of the target gene was studied in fluorescence quantification and WB experiments. In the in vivo experiment, the liver toxicity and biocompatibility of multi-siRNA were explored, and the ability of multi-siRNA to inhibit tumor growth was studied using a subcutaneous tumor model of liver cancer.

[0058] like Figure 1-13 The figure shows a specific embodiment of a method for preparing a dual-targeting RNA molecule with a multi-stem-loop structure that can prevent and treat liver cancer. The present invention uses a hairpin loop and a Tetra-U element to connect multiple siRNAs that can target GP73 or hTERT respectively, so as to form an RNA with multiple stem-loop structures, which can not only improve the stability of RNA and avoid the use of delivery vectors, but also improve the silencing effect on the target gene and improve the efficiency of RNAi therapy.

[0059] The first aspect of the present invention provides a method for preparing a dual-targeting RNA molecule with a multi-stem-loop structure that can prevent and treat liver cancer, which can target GP73 and hTERT sites, inhibit the occurrence and development of liver cancer, and provide a new approach and new idea for the treatment of liver cancer. Specific embodiments The preparation method comprises the following steps:

[0060] Step 1): siRNAs were designed for two target genes hTERT and GP73, and siRNAs with scores > 90 and consecutive identical nucleotides < 4 were screened out to obtain 6 siRNAs, namely siR1, siR2, siR3, siR4, siR5, and siR6; among them, siR1-siR5 targeted hTERT, and siR6 targeted GP73; siR1 sequence: UUGCUCCAGACACUCUUCCGG; siR2 sequence: UUGGUCUCGGCGUACACCGGG; siR3 sequence: AUAGCUGGAGUAGUCGCUCUG; siR4 sequence: UAGAUGUUGGUGCACACCGUC; siR5 sequence: UAGUUGAGCACGCUGAACAGU; siR6 sequence: UUCUAUUCGCUCCUCACACUG;

[0061] Step 2): These six siRNAs are respectively connected to form shRNA using hairpin loop sequences, and finally the shRNAs are connected in series using Tetra-U to form a long chain sequence with multiple hairpin structures, which is named multi-siRNA. Figure 1 Shown is the predicted secondary structure of multi-siRNA.

[0062] The multi-siRNA sequence is as follows:

[0063] GGGCAGAGUGGACCAUCAUUCCUUUUGCCAUAGCUGGAGUAGUCGCUC

[0064] UGCACCGCAAGGUGCAGAGCGACUACUCCAGCUAUGGCUUUUGCUACC

[0065] GGAAGAGUGUCUGGAGCAAGAGUGGACCAUCAUUCCUUUUGCCUAGAU

[0066] GUUGGUGCACACCGUCUGGCUCCGGCCAGACGGUGUGCACCAACAUCU

[0067] AGGCUUUUGUCCCCCGGUGUACGCCGAGACCAAGAGUGGACCAUCAUU

[0068] CCUUUUGCCUAGUUGAGCACGCUGAACAGUGCCCGCAAGGGCACUGUU

[0069] CAGCGUGCUCAACUAGGCUUUUGCCUCAGGAACACCAAGAAGUUCAAA

[0070] GGAGGCAUGAACUUCUUGGUGUUCCUGAGGCUUUUGGAAUGAUGGUCC

[0071] ACUCUUGGUCUCGGCGUACACCGGGGGACUUUUGGAAUGAUGGUCCAC

[0072] UCUUGCUCCAGACACUCUUCCGGUAGCUUUUGGAAUGAUGGUCCACUC

[0073] UGCCCGGAUGGUCCACUCCUUACACUUUUGGAAUGAUGGUCAAGCCUC

[0074] CAGACCAUCAUUCCUUUUGCCUUCUAUUCGCUCCUCACACUGUUCCUUC

[0075] GGGAACAGUGUGAGGAGCGAAUAGAAGGCUUUUGUGUAAGGAGUGGA

[0076] CCAUCC.

[0077] The second aspect of the present invention provides a method for obtaining a large number of RNA molecules. Through prokaryotic expression and induced extraction, a large number of RNA molecules can be obtained, reducing the synthesis cost of siRNA drugs. In a preferred embodiment, multi-siRNA can be inserted into a specific expression vector to be expressed in prokaryotes. Specifically: a T7 promoter sequence is added upstream of the multi-siRNA coding DNA sequence, and restriction sites for endonucleases Bgl II and Bpu1102 I are added to both ends of the sequence, and the corresponding DNA sequence is obtained by chemical synthesis, and then inserted into the prokaryotic expression vector pET-28a between the sites of BglII and Bpu1102I, and transformed into Escherichia coli HT115 (DE3). After IPTG induction, it can be synthesized in large quantities and accumulated in Escherichia coli, and a large number of RNA molecules can be obtained.

[0078] A preferred embodiment is as follows: Figure 2 As shown, by inducing transformation of Escherichia coli engineered bacteria carrying multi-siRNA plasmids and extracting total RNA from Escherichia coli, specific bands different from total RNA from prokaryotes can be obtained to explore the feasibility of prokaryotic expression.

[0079] The toxicity verification method of the dual-targeting RNA molecule in cells of the present invention is to culture Vero cells at 5×

[0080] 10 3 cells / well were plated in a 96-well cell culture plate. After adherence, multi-siRNA was added to the cell culture medium at concentrations of 100 ng / μL, 200 ng / μL, 500 ng / μL, and 1000 ng / μL, respectively. Six replicate wells were set for each concentration, and MTT was added at 24 h, 48 h, and 72 h, respectively.

[0081] The experimental data are as follows Figure 3-5 As shown, at 72 h, multi-siRNA had little effect on the viability of Vero cells at a concentration of 200 ng / μL, but at 500 ng / μL, it inhibited more than 50% of the viability of Vero cells, and at a concentration of 1000 ng / μL, Vero cells had died.

[0082] The toxicity verification method of the dual-targeting RNA molecule in cells of the present invention, based on the toxicity test results in Vero cells, selected a safe concentration within 200 ng / μL to target Hep3B cells in the following experiment.

[0083] Hep3B cells were cultured at 7×10 3 cells / well were plated in a 96-well cell culture plate. After the cells adhered to the plate, 50 ng / μL, 100 ng / μL, 150 ng / μL, and 200 ng / μL of the same concentration were added to the cells. Six replicate wells were set for each concentration. The treatment was terminated at 24 h, 48 h, and 72 h, and MTT detection was performed.

[0084] The experimental data are as follows Figure 6-8 As shown in the figure, at 50ng / μL and 100ng / μL concentrations, multi-siRNA had no effect on the growth of Hep3B cells within 24h and 48h. However, at 150ng / μL and 200ng / μL concentrations, cell growth was significantly inhibited. At 72h, all concentrations were able to inhibit cell growth in a concentration-dependent manner.

[0085] The third aspect of the present invention provides the application of RNA molecules, which are directly added to cells to trigger the RNAi mechanism to silence the expression of target genes. Specifically: dual-targeted RNA molecules silence the expression of target genes in liver cancer cells, multi-siRNA and PBS are added to Hep3B cells respectively, and cell RNA is extracted after 24 hours to detect the expression of GP73, hTERT mRNA, and target protein in the cells.

[0086] like Figure 9-10As shown in the figure, compared with the control group, the expression of GP73 and hTERT mRNA in the experimental group decreased after adding multi-siRNA, and the difference was statistically significant. Fig.11 As shown, "+" indicates that the targeted multi-siRNA was added as the RNA group, and "-" indicates that the non-targeted RNA was added as the NC group. The effect of multi-siRNA on the expression of GP73 and hTERT proteins was analyzed. The results showed that compared with the PBS control group, the expression of GP73 and hTERT proteins in the multi-siRNA group decreased compared with the non-targeted RNA group and the PBS group, and the difference was statistically significant.

[0087] The multi-siRNA of the present invention was used to inhibit the growth of subcutaneous liver cancer tumors:

[0088] In order to verify whether multi-siRNA can inhibit tumor growth in liver cancer-bearing mice, the mice were randomly divided into PBS group, low-concentration group and high-concentration group. Treatment began one week after the model was established. The control group was injected with PBS intratumorally, and the RNA group was injected with multi-siRNA: 3 mg / kg for the low-concentration group and 30 mg / kg for the high-concentration group. The injection was repeated once, and the tumor in the PBS group grew to 1000 mm. 3 The mice were killed. Fig.12 As shown, tumor data analysis is as follows Fig.13 shown.

[0089] It can be concluded that compared with the control group, the tumor volume of the multi-siRNA injection group was smaller, and the tumor of the high-concentration group was smaller than that of the low-concentration group, indicating that there was a dose-dependency. Intratumoral injection can inhibit the growth of subcutaneous liver cancer tumors.

[0090] An application of a dual-targeting RNA molecule with a multi-stem-loop structure that can prevent and treat liver cancer, including a drug containing the dual-targeting RNA molecule, is used to prepare a siRNA drug for treating liver cancer.

[0091] Finally, it should be noted that the present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by ordinary technicians in this field should be considered as the protection scope of the present invention.

Claims

1. A method for preparing a dual-targeting RNA molecule with a multi-stem-loop structure capable of preventing and treating liver cancer, characterized in that The preparation method comprises the following steps: Step 1): Design siRNAs for two target genes hTERT and GP73, and screen out siRNAs with a score of >90 and <4 consecutive identical nucleotides, to obtain 6 siRNAs, namely siR1, siR2, siR3, siR4, siR5, and siR6; among them, siR1-siR5 target hTERT, and siR6 targets GP73; Step 2): The six siRNAs are respectively used to form shRNA using hairpin loop sequences, and finally the shRNAs are connected in series using Tetra-U to form a long chain sequence with multiple hairpin structures, named multi-siRNA.

2. The method for preparing a dual-targeting RNA molecule with a multi-stem-loop structure capable of preventing and treating liver cancer according to claim 1, characterized in that: siR1 sequence: UUGCUCCAGACACUCUUCCGG; siR2 sequence: UUGGUCUCGGCGUACACCGGG; siR3 sequence: AUAGCUGGAGUAGUCGCUCUG; siR4 sequence: UAGAUGUUGGUGCACACCGUC; siR5 sequence: UAGUUGAGCACGCUGAACAGU; siR6 sequence: UUCUAUUCGCUCCUCACACUG.

3. A method for preparing a dual-targeting RNA molecule with a multi-stem-loop structure capable of preventing and treating liver cancer according to claim 1 or 2, characterized in that: The multi-siRNA sequence is as follows: .

4. The method for preparing a dual-targeting RNA molecule with a multi-stem-loop structure capable of preventing and treating liver cancer according to claim 3, characterized in that: Multi-siRNA can be inserted into a specific expression vector for expression in prokaryotes.

5. The method for preparing a dual-targeting RNA molecule with a multi-stem-loop structure capable of preventing and treating liver cancer according to claim 4, characterized in that: A T7 promoter sequence is added upstream of the multi-siRNA coding DNA sequence, and restriction sites for endonucleases Bgl II and Bpu1102 I are added at both ends of the sequence. The corresponding DNA sequence is obtained by chemical synthesis, and then inserted between the sites of Bgl II and Bpu1102 I of the prokaryotic expression vector pET-28a. It is transformed into Escherichia coli HT115 (DE3), and can be synthesized and accumulated in Escherichia coli by IPTG induction, so that a large amount of RNA molecules can be obtained.

6. The method for preparing a dual-targeting RNA molecule with a multi-stem-loop structure capable of preventing and treating liver cancer according to claim 5, characterized in that: By inducing the transformation of Escherichia coli engineered bacteria carrying multi-siRNA plasmids and extracting total RNA from Escherichia coli, specific bands different from total RNA from prokaryotes can be obtained to explore the feasibility of prokaryotic expression.

7. The method for verifying the toxicity of a dual-targeting RNA molecule in a cell according to any one of claims 1 to 6, characterized in that: Vero cells were cultured at 5 × 10 3 cells / well were plated in a 96-well cell culture plate. After adherence, multi-siRNA was added to the cell culture medium at concentrations of 100 ng / μL, 200 ng / μL, 500 ng / μL, and 1000 ng / μL, respectively. Six replicate wells were set for each concentration, and MTT was added at 24 h, 48 h, and 72 h, respectively.

8. The method for verifying the toxicity of a dual-targeting RNA molecule in a cell according to any one of claims 1 to 6, characterized in that: Hep3B cells were cultured at 7×10 3 cells / well were plated in a 96-well cell culture plate. After the cells adhered to the plate, 50 ng / μL, 100 ng / μL, 150 ng / μL, and 200 ng / μL of the same concentration were added to the cells. Six replicate wells were set for each concentration. The treatment was terminated at 24 h, 48 h, and 72 h, and MTT detection was performed.

9. The dual-targeting RNA molecule for silencing the expression of a target gene in liver cancer cells according to any one of claims 1 to 6, characterized in that: Multi-siRNA and PBS were added to Hep3B cells respectively, and the cell RNA was extracted after 24 hours to detect the expression of GP73, hTERT mRNA and target protein in the cells.

10. An application of a dual-targeting RNA molecule with a multi-stem-loop structure capable of preventing and treating liver cancer, characterized in that: A drug comprising the dual-targeting RNA molecule according to any one of claims 1 to 6.

Images