A molecular marker for identifying Vitis vinifera L. and its interspecific hybrid grapes and its application

Abstract

The present invention discloses a molecular marker for identifying Vitis vinifera and its interspecific hybrid grapes and its application, belonging to the technical field of biological breeding. Through the analysis of whole-genome resequencing data, the present invention identifies a significant InDel locus IH1, which is located at 7,224,357 bp on chromosome 13 of grapes. This locus shows significant genotypic differences between Vitis vinifera grapes and their interspecific hybrids. Through the differences in the number and distribution of electrophoretic bands, Vitis vinifera grapes and their interspecific hybrids can be visually and accurately distinguished. Based on the characteristics of this molecular marker, it can be used for rapid screening of interspecific hybrid offspring lines in the early stage of breeding to eliminate self-crossed offspring. At the same time, it can also rapidly screen the genetic background of seedlings to ensure the accuracy of seedlings, which plays an important role in the early screening of breeding offspring and the screening of the genetic background of seedlings.

Description

Technical Field

[0001] The present invention relates to the technical field of biological breeding, in particular to a molecular marker for identifying Eurasian grapes and their interspecific hybrids and an application thereof. Background Art

[0002] Grapes are one of the world's most important cash crops, possessing extremely high economic value. In recent years, with advances in agricultural technology and diversifying consumer demand, China's grape planting area and production have steadily increased, making the grape industry one of the country's most important fruit crops. In particular, China's expanding market demand for both table and wine grapes is driving higher demands for both variety diversity and quality.

[0003] In grape breeding, interspecific hybridization, a widely used genetic improvement method, can introduce superior genetic resources not found in cultivated varieties, thereby increasing grape genetic diversity. Through interspecific hybridization, superior traits not found in cultivated varieties, such as disease resistance, cold tolerance, and drought resistance, can be transferred to cultivated varieties. Common hybrid combinations include Vitis vinifera (Vitis vinifera) and American Vitis species (such as Vitis labrusca and Vitis Riparia), which are primarily used to improve disease resistance and cold tolerance; and Vitis vinifera (Vitis vinifera) and wild Vitis species (such as Vitis amurensis and Vitis aestivalis), which aim to enhance cold tolerance and stress resistance.

[0004] The phenotypes of interspecific hybrid offspring are often quite similar to those of their parents. Therefore, accurately identifying the authenticity of hybrids based solely on traditional morphological, agronomic, or physiological and biochemical indices is extremely difficult. This is especially true in complex hybridization settings. These traditional screening methods are not only subject to environmental influences but are also inefficient and costly. To address the limitations of these traditional methods, modern molecular biology techniques are being widely used to improve the accuracy and efficiency of identification. The specific genomic differences exhibited by interspecific hybrid offspring make molecular markers an ideal tool. Because interspecific hybrids are derived from a combination of genes from different species, they may exhibit heterozygosity, whereas Vitis vinifera (Vitis vinifera) remains homozygous at specific loci. These genotypic differences provide an effective basis for distinguishing Vitis vinifera from its hybrid offspring. Such markers can also be used to identify the genetic background of seedlings, reducing the mixing of seedlings and rootstocks, as well as errors in seedling use.

[0005] With the development of molecular biology, molecular marker technology has become a key tool for germplasm identification. Through genomic-level analysis, molecular markers can rapidly identify hybrids in the early stages of breeding, significantly shortening the breeding cycle. They can also rapidly analyze the genetic background of seedlings before planting, confirming their accuracy and reducing economic losses caused by seedling problems. However, current molecular marker identification of interspecific hybrids in grapes still faces challenges such as insufficient marker specificity, complex technical operations, and high testing costs. Therefore, developing an efficient and specific molecular marker identification method would provide important technical support for the rapid screening of interspecific hybrids and rapid testing of seedlings, further promoting the development of grape breeding. Summary of the Invention

[0006] The present invention aims to provide a molecular marker for identifying Vitis vinifera and its interspecific hybrids and its application, so as to solve the problems existing in the above-mentioned prior art. The molecular marker can accurately distinguish Vitis vinifera and its interspecific hybrids, thereby improving breeding efficiency and accuracy and reducing breeding costs.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The present invention provides a molecular marker for identifying Vitis vinifera and its interspecific hybrids. The nucleotide sequence of the molecular marker is shown in SEQ ID NO: 1. A 34 bp deletion polymorphism exists starting from position 49 of the molecular marker:

[0009] Preferably, if there is a 34 bp deletion starting from position 49 of the molecular marker and the genotype shows a heterozygous state, the grape is an interspecific hybrid; if there is no 34 bp deletion starting from position 49 of the molecular marker and the genotype shows a homozygous state, the grape is Vitis vinifera; wherein the sequence of the 34 bp deletion is shown in SEQ ID NO: 4.

[0010] The present invention also provides a primer pair for identifying Vitis vinifera and its interspecific hybrids, the primer pair being used to amplify a molecular marker whose nucleotide sequence is shown in SEQ ID NO: 1, and the nucleotide sequence of the primer pair being shown in SEQ ID NO: 2-3.

[0011] The present invention also provides a kit comprising the primer pair.

[0012] The present invention also provides a method for identifying Vitis vinifera and its interspecific hybrids, comprising the following steps:

[0013] Using the genomic DNA of the grape sample to be tested as a model, PCR amplification is performed using the primer pair described in claim 2, and the grape sample to be tested is judged to be Eurasian species or interspecific hybrid grape based on the number and distribution differences of marker site bands in the amplified product; the marker site is positions 49-82 of the nucleotide sequence shown in SEQ ID NO: 1.

[0014] Preferably, the PCR amplification reaction system includes 25 μL of 2×Rapid Taq Master Mix, 2 μL of upstream sequence and downstream sequence, 0.1-1 μg of DNA template, and ddH 2 O is added to a total volume of 50 μL.

[0015] Preferably, the reaction procedure of the PCR amplification is: denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 59°C for 30 s, with the annealing temperature decreasing by 0.5°C in each cycle, extension at 72°C for 30 s, for a total of 5 cycles; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, for a total of 25 cycles; finally extension at 72°C for 5 min; and storage at 4°C.

[0016] Preferably, the judgment method is: if a double band appears at the marker site, it is judged to be an interspecific hybrid grape; if a single band appears at the marker site, it is judged to be Vitis vinifera.

[0017] The present invention also provides application of the molecular marker, the primer pair or the kit in identifying Eurasian species and interspecific hybrid grapes.

[0018] The present invention also provides the use of the molecular marker, the primer pair or the kit in assisting grape breeding.

[0019] The present invention discloses the following technical effects:

[0020] (1) Through in-depth analysis of whole-genome resequencing data, the present invention selected a marker site with significant genotypic differences, namely the InDel site at bp 7,224,357 on chromosome 13 of grape. A 34-bp deletion at this site results in a double band on the electrophoresis pattern of interspecific hybrid grapes, while Vitis vinifera exhibits a single band. This stable genetic difference ensures high accuracy in the identification of interspecific hybrid grapes, effectively avoiding misclassification issues.

[0021] (2) The molecular marker system of the present invention provides accurate genetic background classification in the early stages of grape breeding. This precise genetic information enables breeders to quickly screen individuals that meet breeding goals and eliminate individuals that do not undergo effective hybridization, thereby shortening the breeding cycle and improving breeding efficiency. Furthermore, the molecular markers can also be used to identify seedlings and determine their genetic background, providing molecular-level evidence for seedling evaluation and identification, thereby ensuring seedling accuracy.

[0022] (3) Compared with traditional methods, the single marker locus system of the present invention significantly simplifies the detection process and reduces the reliance on multiple marker loci. This simplification reduces reagent consumption and operational steps, making large-scale screening and classification more economical and feasible, thereby significantly reducing the overall cost of germplasm identification.

[0023] (4) The molecular marker technology of the present invention not only improves the accuracy of identifying interspecific hybrids of grapes but also provides a reliable scientific basis for the registration and protection of new grape varieties. By accurately distinguishing interspecific hybrids from Vitis vinifera, this technology effectively prevents cultivar confusion and maintains the legitimacy and uniqueness of the varieties. Furthermore, the present invention supports the registration, certification, and intellectual property protection of grape seedlings, further contributing to the maintenance of the market value and legal rights of the varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0025] Figure 1 The electrophoresis typing results of molecular marker IH1 in interspecific hybrids and Vitis vinifera; M represents a 500bp DNA marker, and 1-30 correspond to grape varieties Beixiang, Beifeng, Beizi, Beiquan, Xinbeichun, Beichun, Beihong, Beixin, Beimei, Sangiovese, Syrah, Ugni Blanc, Aligoté, Riesling, Zidave, Chardonnay, Pinot Gris, Pinot Blanc, Pinot Noir, Petit Manseng, Guirenxiang, Petit Verdot, Malbec, Sauvignon Blanc, Grenache, Marselan, Cabernet Sauvignon, Cabernet Gernischt, Cabernet Franc, and Merlot, respectively. DETAILED DESCRIPTION

[0026] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0027] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0028] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0029] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0030] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0031] Example 1 Screening and Identification of Molecular Marker IH1 of Vitis vinifera and Its Hybrids

[0032] This study selected representative Vitis vinifera species (Cabernet Sauvignon, Cabernet Franc, Pinot Noir, etc.) and their interspecific hybrids (Beihong, Beimei, etc.) for whole-genome resequencing. Sequencing data were normalized and a significant InDel site was identified (site information is shown in Table 1), located at 7,224,357 bp on chromosome 13 of Vitis vinifera, using the reference genome of V. vinifera PN40024 (12X). This site exhibits significant differences between interspecific hybrids and Vitis vinifera. The wild parent of the interspecific hybrid possesses a 34 bp deletion, resulting in hybrid offspring carrying different alleles and exhibiting a heterozygous state, while Vitis vinifera lacks this deletion and remains homozygous. Based on this site, a molecular marker, IH1 (nucleotide sequence shown in SEQ ID NO: 1), was designed to specifically amplify the target fragment. By comparing the number and distribution of electrophoretic bands, Vitis vinifera and its interspecific hybrids can be visually distinguished.

[0033] Sequence of molecular marker IH1:

[0034] CCCCAGGCTATTTGTGAAGAAGATGAAGAAGATGACAAAAATGACAAT AAGATCAAGGCAAATTCTTA GTATTCATCGACTC AGAAATCTTATCTCAAGCAAAAGTATCAAATGAATATTAGATCAGGCATTACACTGGTTAATTTAGAGGTTACAATTGTATGTAACAAATAAAGCTGATTTCTGTATCCACCCAAA. The underlined portion of the above sequence is a deleted 34 bp sequence.

[0035] Table 1 Sequence information of InDel sites corresponding to marker IH1

[0036]

[0037] This embodiment mainly includes the following steps:

[0038] (1) Genomic data analysis and variation information acquisition

[0039] Whole-genome resequencing was performed on representative Vitis vinifera species and their interspecific hybrids. The sequencing data were normalized and information on variant sites with significant genetic differences was extracted.

[0040] (2) Marker region selection and primer design

[0041] A genotypic site was selected, and a marker region approximately 150 bp upstream and downstream of the site was screened. Specific primers were then designed for classification and identification. The selected marker region contained relatively stable genetic variability, and its flanking sequences were identical. This dominant marker was effective in distinguishing Vitis vinifera from its interspecific hybrids.

[0042] (3) Sample preparation and DNA extraction

[0043] Select young grape tissues (such as leaves, stems, and roots), or mature tissues in special cases. Genomic DNA is extracted using a modified CTAB method to obtain high-quality DNA samples, ensuring the accuracy and reliability of subsequent analysis.

[0044] (4) PCR amplification

[0045] Touchdown PCR was used for amplification in a 50 μL reaction volume. This method improves amplification specificity by gradually lowering the annealing temperature, thereby enhancing the ability to detect the target fragment.

[0046] Table 2 Reaction system

[0047]

[0048] The reaction program was as follows: denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 59°C for 30 s (0.5°C reduction per cycle), extension at 72°C for 30 s, for a total of 5 cycles; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, for a total of 25 cycles; final extension at 72°C for 5 min; and storage at 4°C.

[0049] Primer 1: 5'-CCCCAGGCTATTTGTGAAGA-3' (SEQ ID NO: 2);

[0050] Primer 2: 5'-TTTGGGTGGATACAGAAATCAG-3' (SEQ ID NO: 3)

[0051] (5) Electrophoresis and result verification

[0052] Polyacrylamide gel electrophoresis and silver staining revealed the presence of double bands in the interspecific hybrid, while Vitis vinifera exhibited a single band. This is due to genotypic differences between the two at the marker locus: the interspecific hybrid harbors a 34-bp deletion, resulting in different alleles and a heterozygous state; Vitis vinifera lacks this allele and is homozygous. Differences in the number and distribution of bands allow Vitis vinifera to be distinguished from its interspecific hybrid.

[0053] Example 2 Application of molecular marker IH1 in identifying Vitis vinifera and its hybrids

[0054] In this example, nine interspecific hybrids independently bred in the laboratory (Beixiang, Beifeng, Beizi, Beiquan, Xinbeichun, Beichun, Beihong, Beixin, and Beimei) and 21 Eurasian wine grape species (Sangiovese, Syrah, Ugni Blanc, Aligoté, Riesling, Zidave, Chardonnay, Pinot Gris, Pinot Blanc, Pinot Noir, Petit Manseng, Guirenxiang, Petit Verdot, Malbec, Sauvignon Blanc, Grenache, Marselan, Cabernet Sauvignon, Cabernet Gernischt, Cabernet Franc, and Merlot) were selected and used to verify the typing effect of marker IH1.

[0055] 1. Sampling and DNA extraction

[0056] Young leaves, tender stems and other tender tissues of hybrid seedlings were collected, and DNA was extracted using the improved CTAB plant genomic DNA rapid extraction kit.

[0057] Table 3 Names of hybrid seedling germplasm resources

[0058]

[0059]

[0060] 2. DNA quality testing

[0061] The purity and concentration of DNA samples were detected by ultraviolet-visible spectrophotometer and 1% agarose gel electrophoresis. 260 / 280 A value between 1.8 and 2.0 is considered high purity. Simultaneously, the purity and concentration of the DNA sample are tested by 1% agarose gel electrophoresis. Highly defined and uniform bands indicate high-quality DNA extraction. Smearing indicates DNA degradation and requires re-extraction. Ultimately, combining these two methods, the DNA concentration is diluted to approximately 200 ng / μL and stored at 4°C. For long-term storage, it can be stored at -20°C.

[0062] 3. PCR amplification

[0063] 3.1 Primer design

[0064] Specific primers were designed based on the location of the InDel site at 7,224,357 bp on grape chromosome 13, as shown below:

[0065] Table 4 Molecular marker IH1 specific amplification primer information

[0066]

[0067] 3.2 PCR reaction system

[0068] All operations were performed on ice, and the total PCR amplification reaction system was 50 μL, as shown in Table 2 of Example 1.

[0069] 3.3PCR parameters

[0070] To improve the specificity of the amplified product, touchdown-PCR was used to amplify the target fragment. The specific procedure was as follows: denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 59°C for 30 s (0.5°C lowered for each cycle), and extension at 72°C for 30 s, for a total of 5 cycles; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 30 s, for a total of 25 cycles; and finally extension at 72°C for 5 min; and storage at 4°C.

[0071] 4. Polyacrylamide gel electrophoresis

[0072] (1) Preparation of electrophoretic gel

[0073] This standard uses 12% polyacrylamide gel with a gel area of ​​306×95mm 2The specific production process is as follows: Thoroughly rinse the long and short gel plates with detergent and tap water, then rinse once or twice with distilled water and air dry. Spray the surface with 95% ethanol. After the ethanol evaporates and there are no impurities, place the long gel plate horizontally on a flat stand on the laboratory bench, then place the short gel plate on top. Finally, clamp the two plates together with clamps. After assembly, seal the bottom with 1.5% agarose. Prepare a 70mL 12% native gel. To a clean Erlenmeyer flask, add 24.5mL of distilled water, 28mL of 30% polyacrylamide (29:1), 25mL of SDS-PAGE separation buffer, 700μL of 10% ammonium persulfate, and finally 28μL of TEMED. Mix thoroughly and pour the gel horizontally. Slowly add the gel solution into the gel chamber formed by the two glass plates to avoid air bubbles. If bubbles form during pouring, gently tap the glass plates to remove them. Finally, insert a comb and let the gel stand for 1-2 hours.

[0074] (2) Electrophoresis parameters

[0075] A vertical electrophoresis tank was used, the electrophoresis voltage was 220 V, the current fluctuated with the voltage, and the electrophoresis time was 1 h.

[0076] (3) Dyeing

[0077] Use silver staining to detect the polyacrylamide gel electrophoresis results and take photos for record. The specific steps are as follows:

[0078] ① Fixation: After removing the gel, place it in a flat plate containing 250 mL of 10% glacial acetic acid, so that the solution covers the gel surface by about 5 mm, and shake it parallel for 15 minutes.

[0079] ②Washing: Pour off the acetic acid solution and wash with distilled water three times, 2 minutes each time.

[0080] ③ Staining: Pour away the distilled water, add 250mL of 2‰ AgNO3 solution into the dish, and then shake in parallel for 30 minutes.

[0081] ④Washing: Pour out the fixative solution, add distilled water and wash once, shaking for about 10 seconds.

[0082] ⑤ Color development: Add 250 mL of 3% NaOH solution and 1.25 mL of formaldehyde to the dish and shake in parallel for about 10 minutes until color develops.

[0083] ⑥ Fixation: Pour away the color developing solution, add 250mL of 10% glacial acetic acid, and shake for 2 minutes to terminate the reaction.

[0084] ⑦ Preservation: Pour out the fixative, add distilled water and preserve the gel.

[0085] 5. Results Analysis

[0086] like Figure 1As shown in the figure, the sample numbering order is consistent with that in Table 3. Electrophoresis results show that all interspecific hybrids exhibit double bands, with the amplified product appearing at 198 bp and 164 bp. In contrast, Vitis vinifera exhibits a single band, with the amplified product appearing at 198 bp. This is due to genotype differences between the two at the marker locus. The interspecific hybrids contain a 34 bp deletion, resulting in different alleles and a heterozygous state, while Vitis vinifera lacks this variation and appears homozygous. This demonstrates that the molecular markers of the present invention can effectively distinguish Vitis vinifera from its interspecific hybrids by distinguishing between the number and distribution of bands.

[0087] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should fall within the scope of protection determined by the claims of the present invention.

Claims

1. A molecular marker for identifying Vitis vinifera and its interspecific hybrids, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO:

1. A 34 bp deletion polymorphism exists starting from the 49th position of the molecular marker.

2. The molecular marker according to claim 1, characterized in that If there is a 34 bp deletion starting from the 49th position of the molecular marker and the genotype is heterozygous, it is an interspecific hybrid grape; if there is no 34 bp deletion starting from the 49th position of the molecular marker and the genotype is homozygous, it is Vitis vinifera; wherein the sequence of the 34 bp deletion is shown in SEQ ID NO:

4.

3. A primer pair for identifying Vitis vinifera and its interspecific hybrids, characterized in that: The primer pair is used to amplify a molecular marker whose nucleotide sequence is shown in SEQ ID NO: 1, and the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3.

4. A kit comprising the primer pair according to claim 3.

5. A method for identifying Eurasian species and their interspecific hybrids of grapes, characterized in that: The following steps are involved: Using the genomic DNA of the grape sample to be tested as a model, PCR amplification is performed using the primer pair described in claim 3, and judging whether the grape sample to be tested is Eurasian species or interspecific hybrid grape according to the number and distribution difference of the marker site bands of the amplified product; the marker site is positions 49-82 of the nucleotide sequence shown in SEQ ID NO: 1; The method of determination is: if double bands appear at the marker site, it is determined to be an interspecific hybrid grape; If a single band appears at the marker site, it is judged to be Vitis vinifera.

6. The method according to claim 5, characterized in that The PCR amplification reaction system includes 25 μL of 2×Rapid TaqMaster Mix, 2 μL of upstream sequence and downstream sequence respectively, 0.1-1 μg of DNA template, and ddH2O is added to a total volume of 50 μL.

7. The method according to claim 5, characterized in that The reaction procedure of the PCR amplification is as follows: denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 59°C for 30 s, annealing temperature decreased by 0.5°C in each cycle, extension at 72°C for 30 s, for a total of 5 cycles; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, for a total of 25 cycles; finally extension at 72°C for 5 min; and storage at 4°C.

8. Use of the molecular marker according to any one of claims 1 to 2, the primer pair according to claim 3, or the kit according to claim 4 in identifying Vitis vinifera and its interspecific hybrids.

9. Use of the molecular marker according to any one of claims 1 to 2, the primer pair according to claim 3, or the kit according to claim 4 in assisting breeding for distinguishing Vitis vinifera and its interspecific hybrids.

Images