InDel molecular marker primers for identifying soybeans with high palmitic acid content and their application

Abstract

The present invention discloses InDel molecular marker primers for identifying soybeans with high palmitic acid content and their applications. The upstream primer nucleotide sequence of the InDel molecular marker primer is shown in SEQ ID NO. 1, and the downstream primer nucleotide sequence is shown in SEQ ID NO. 2. The present invention targets the QTLqPA_2_1 interval, combines parental resequencing data, screens out Indel sites with differential bases greater than 15 bp, and designs InDel molecular markers for the base deletion at Chr02_5018100. Based on the InDel molecular markers, InDel primer sequences are designed, PCR amplification is performed, and the test results are observed to identify the palmitic acid content phenotype. The primers of the present invention can be used to identify and screen soybean palmitic acid content phenotypes, and can quickly, accurately, and effectively breed soybean varieties with high palmitic acid content, accelerate the crop breeding process, and improve the efficiency and success rate of breeding.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to InDel molecular marker primers for identifying soybeans with high palmitic acid content and applications thereof. Background Art

[0002] Soybeans are the primary source of vegetable oil and contain five key fatty acid components: palmitic acid (PA), stearic acid (SA), oleic acid (OA), linoleic acid (LA), and linolenic acid (LNA). Palmitic acid and stearic acid are saturated fatty acids, while oleic acid, linoleic acid, and linolenic acid are unsaturated fatty acids. The ratio of the various fatty acid components in soybean oil directly determines its flavor, shelf life, and nutritional value. As living standards improve, dietary requirements become increasingly stringent, and people pursue healthier foods. Saturated fats are fatty acids without double bonds, and excessive intake can lead to sudden increases in high blood pressure, cholesterol, and coronary heart disease.

[0003] Soybean seed quality traits are regulated by multiple genes and are quantitative traits with complex genetic mechanisms and are susceptible to environmental influences. Many researchers, both domestically and internationally, have conducted QTL mapping studies on soybean protein, fat, and fatty acid composition. However, the QTLs detected vary across different environments or genetic backgrounds, and few have been reproducibly identified.

[0004] This study primarily used a RIL population constructed from "Jidou 17 x Jidou 12" as material. QTLs for protein, fat, and fatty acid composition in soybean grains harvested over two years in Shijiazhuang and Sanya were mapped and stable genetic loci were identified. Correlations between fatty acid components were analyzed, identifying major genetic loci regulating soybean fatty acid content and analyzing interactions between these loci. This approach lays the foundation for molecular marker-assisted breeding of high-quality soybeans. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide InDel molecular marker primers for identifying soybeans with high palmitic acid content and applications thereof.

[0006] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows.

[0007] An InDel molecular marker primer for identifying soybeans with high palmitic acid content, wherein the upstream primer nucleotide sequence of the InDel molecular marker primer is shown as SEQ ID NO.1, and the downstream primer nucleotide sequence is shown as SEQ ID NO.2.

[0008] The application of InDel molecular marker primers with the upstream primer nucleotide sequence shown as SEQ ID NO.1 and the downstream primer nucleotide sequence shown as SEQ ID NO.2 in identifying soybeans with high palmitic acid content.

[0009] An InDel molecular marker for identifying soybeans with high palmitic acid content, wherein the InDel molecular marker is a sequence amplified using an InDel molecular marker primer using a soybean genome as a template; the upstream primer nucleotide sequence of the InDel molecular marker primer is shown in SEQ ID NO.1, and the downstream primer nucleotide sequence is shown in SEQ ID NO.2; the nucleotide sequences amplified using the InDel molecular marker primer are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0010] A kit for identifying soybeans with high palmitic acid content, comprising the InDel molecular marker primer according to claim 1.

[0011] The method for identifying soybeans with high palmitic acid content using an InDel molecular marker primer having an upstream primer nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer nucleotide sequence as shown in SEQ ID NO.2 comprises the following steps:

[0012] (1) Using the DNA of the soybean material to be tested as a template, PCR amplification is performed using InDel molecular marker primers to obtain PCR amplification products;

[0013] (2) Detect the amplified product by agarose gel electrophoresis and observe the electrophoresis detection results.

[0014] Further preferably, the reaction system for PCR amplification in step (1) is as follows: in a 20 μL reaction system, 1 μL of DNA template, 1 μL of forward primer and 1 μL of reverse primer, 6 μL of ddH2O and 10 μL of 2×Mix

[0015] Further preferably, the reaction procedure of PCR amplification in step (1) is: pre-denaturation at 95°C for 3 min; denaturation at 93°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 30 s, 33 cycles; final extension at 72°C for 5 min, and storage at 4°C.

[0016] Further preferably, the mass concentration of agarose gel in step (2) is 6%.

[0017] Further preferably, when the length of the amplified product is 458 bp, the gene marker band type of the soybean to be tested is A; when the length of the amplified product is 501 bp, the gene marker band type of the soybean to be tested is B; the palmitic acid content is: soybeans with gene marker band type A are greater than or are candidate greater than soybeans with gene marker band type B.

[0018] Application of the InDel molecular marker primers whose upstream primer nucleotide sequence is shown as SEQ ID NO.1 and whose downstream primer nucleotide sequence is shown as SEQ ID NO.2 or the InDel molecular marker according to claim 3 in soybean molecular marker-assisted breeding.

[0019] The beneficial effects of the above technical solution are as follows: the present invention, based on the QTLqPA_2_1 interval and combined with parental resequencing data, screens for Indel sites with base differences greater than 15 base pairs, and designs an InDel molecular marker for the base deletion at Chr02_5018100. Based on the InDel molecular marker, InDel primer sequences are designed, PCR amplification is performed, and the test results are observed to identify the palmitic acid content phenotype. Using the primers of the present invention, it is possible to identify and screen soybean palmitic acid content phenotypes, and rapidly, accurately, and effectively breed soybean varieties with high palmitic acid content, accelerating the crop breeding process and improving breeding efficiency and success rate. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the histogram of palmitic acid content of the parent varieties in Shijiazhuang in 2022, 2023, and 2024;

[0021] Figure 2 This is a schematic diagram of the distribution of palmitic acid content in the Shijiazhuang RIL population, where Skew shows the skewness of the population distribution relative to the mean; Kurt shows the peak value of the population data;

[0022] Figure 3 This is a schematic diagram of the electrophoresis results of materials 1 to 48;

[0023] Figure 4 This is a schematic diagram of the electrophoresis results of materials 49 to 96;

[0024] Figure 5 This is a schematic diagram of the electrophoresis results of materials 97 to 144;

[0025] Figure 6 This is a schematic diagram of the electrophoresis results of materials 145 to 168;

[0026] Figure 7 This is a schematic diagram of the Indel marker typing of the RIL population and the results of the palmitic acid content in the grains;

[0027] Figure 8 This is a schematic diagram of the QTL location of protein, fat and fatty acid content on chromosome Chr02 of the population, where pro: protein content; oil: fat content; PA: palmitic acid content. DETAILED DESCRIPTION

[0028] The following examples illustrate the present invention in detail. The various raw materials and equipment used in the present invention are conventional commercial products and can be directly obtained through commercial purchase. The experimental methods used in the following examples are all conventional methods unless otherwise specified.

[0029] It should be understood that when used in the present specification and the appended claims, the term "comprising" indicates the presence of described features, integers, steps, operations, elements and / or components, but does not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components and / or collections thereof.

[0030] It will also be understood that the term "and / or" used in this specification and the appended claims refers to and includes any and all possible combinations of one or more of the associated listed items.

[0031] References to "one embodiment" or "some embodiments" in this specification mean that one or more embodiments of the present application include a particular feature, structure, or characteristic described in conjunction with that embodiment. Thus, phrases such as "in one embodiment," "in some embodiments," "in other embodiments," and "in other embodiments" appearing in various places in this specification do not necessarily refer to the same embodiment, but rather mean "one or more but not all embodiments," unless otherwise specifically emphasized. The terms "including," "comprising," "having," and variations thereof all mean "including but not limited to," unless otherwise specifically emphasized.

[0032] In addition, in the description of the present application specification and the appended claims, the terms "first", "second", "third", etc. are only used to distinguish the descriptions and cannot be understood as indicating or implying relative importance.

[0033] The following will be combined with specific embodiments of the present invention to clearly and completely describe the technical solutions of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0034] Example 1: Extraction of soybean fatty acid components

[0035] Select dry, undamaged, uniformly sized, and plump soybean seeds. Grind 10 seeds from each plant. Wash each sample after grinding to prevent contamination. Weigh 0.1 g of ground soybean powder into a 2 mL centrifuge tube and set aside.

[0036] Fatty acid extraction steps:

[0037] (1) Add 1 mL of petroleum ether to the centrifuge tube containing soybean powder and shake for 1 hour;

[0038] (2) Centrifuge for 10 minutes at 4000 rpm, then aspirate 800 μL of supernatant into a 10 mL centrifuge tube, add 1.5 mL of methanol / KOH, mix thoroughly, and let stand for 1 hour;

[0039] (3) After standing, add 5 mL of distilled water to separate the oil;

[0040] (4) Pipette 150 μL of the upper layer of oil into a 2.0 mL sample bottle, and then add 450 mL of petroleum ether to make up the volume for testing.

[0041] Example 2: Detection of fatty acid components by gas chromatograph

[0042] This study used an Agilent 6890 gas chromatograph for detection. The chromatographic column model was Agilent DB-23 capillary column (30m×0.25mm, 0.25μm); the injection method was automatic injection; the injection needle specification was 10μL, and the injection volume was 2μL each time; the split ratio was 20:1; the column oven temperature was set to 180-220℃; the front inlet temperature was set to 250℃ and the front inlet pressure was set to 5.4psi; the total front inlet flow rate was 17mL / min; the carrier gas was nitrogen 25mL / min, hydrogen: 30mL / min, and air: 400mL / min; the heating method adopted programmed heating: initial temperature 150℃, equilibration time 2min, heating to 220℃ at 5℃ / min-1 and holding for 11min; the detector was a flame ionization detector (FID) at a temperature of 250℃; each sample was tested for 18min, with a sample detection interval of 1min, and the data sampling frequency was 20Hz / 0.1min.

[0043] The output spectra were analyzed by Agilent Chem Station software equipped with an Agilent 6890 gas chromatograph. The relative contents (%) of the five fatty acids were calculated based on the ratio of the target fatty acid signal peak area to the total area of the fatty acid signal peaks using the area normalization method. Each material was tested in duplicate three times.

[0044] Example 3, result analysis

[0045] (1) Analysis of differences in palmitic acid content between the two parental materials

[0046] The palmitic acid content of the parental grains from different years and different environments was analyzed. Figure 1The fatty acid content of the two parents planted in Shijiazhuang in 2022 is shown as follows: the palmitic acid content of the female parent Jidou 17 is 11.27%, and the palmitic acid content of the male parent Jidou 12 is 12.8%. The fatty acid content of the parents planted in Shijiazhuang in 2023 is shown as follows: Figure 3-6 As shown, the palmitic acid content of the female parent, Jidou 17, is 11.72%, while that of the male parent, Jidou 12, is 13.09%. The palmitic acid content of the male parent, Jidou 12, is significantly higher by 1.37 percentage points compared to the female parent, Jidou 17. This indicates that palmitic acid content varies between the parents. A comparison of fatty acid content between Jidou 17 and Jidou 12 harvested in Sanya in 2024 shows that the palmitic acid content of the female parent, Jidou 17, is 11.88%, while that of the male parent, Jidou 12, is 13.13%. The palmitic acid content of the male parent, Jidou 12, is significantly higher by 1.25 percentage points compared to the female parent, Jidou 17.

[0047] (2) Phenotypic variation and genetic analysis of fatty acid content in RIL populations

[0048] As shown in Table 1, the maximum palmitic acid content in the RIL population harvested in Shijiazhuang in 2022 was 13.28%, the minimum was 10.21%, the average was 11.94%, the inter-population standard deviation was 0.55, and the palmitic acid coefficient of variation was 4.65%. The maximum palmitic acid content in the RIL population harvested in Shijiazhuang in 2023 was 13.61%, the minimum was 10.63%, the average was 12.09%, the inter-population standard deviation was 0.51, and the palmitic acid coefficient of variation was 4.20%. The heritability of palmitic acid in the RIL population planted in Shijiazhuang from 2022 to 2023 was 0.83. The maximum palmitic acid content in the RIL population harvested in Sanya in 2024 was 14.05%, the minimum was 10.91%, the average palmitic acid content in the population was 12.38%, and the inter-population standard deviation was 0.54. The intra-population palmitic acid coefficient of variation was 4.40%. The minimum heritability of palmitic acid content in Sanya cultivation in 2024 was 0.77.

[0049] The above data results indicate that the palmitic acid content of this population is subject to genetic regulation, so QTL positioning analysis can be performed on the palmitic acid content in the seeds of the RIL population.

[0050] Table 1 Phenotypic variation and genetic analysis of palmitic acid content in Shijiazhuang and Sanya RIL populations from 2022 to 2024

[0051]

[0052] The distribution of palmitic acid content in the 2023 population was 0.22 with a skewness of -0.30. The distribution of palmitic acid content in the RIL population harvested in Sanya in 2024 was 0.07 with a skewness of -0.18. The fatty acid content of the RIL population in the three years showed an approximately normal distribution, which is a typical quantitative trait, such as Figure 2 shown.

[0053] Example 4: QTL mapping of fatty acid composition in RIL populations

[0054] To further elucidate the genetic basis of soybean fatty acid composition, this study analyzed palmitic acid content in soybean seeds from RIL populations constructed from cultivars Jidou 17 and Jidou 12, planted in Shijiazhuang in 2022-2023 and in Sanya in 2024. Based on the constructed maps, QTL IciMapping 4.1 was used to locate QTLs for fatty acid content in the RIL populations.

[0055] The results are shown in Table 2. Six QTLs related to palmitic acid content were located in Shijiazhuang in 2022-2023 by QTL IciMaping 4.1, with LOD values ranging from 2.93 to 6.64 and contribution rates of 5.07% to 12.54%. They were distributed on chromosomes 2, 3, 8, 9, and 12, respectively. Among them, a QTL locus with a large LOD value was located, qPA-2-1 on chromosome 2, with a positioning interval of Chr02_4627941-Chr02_5028055 and an LOD value of 6.64, explaining 12.54% of the phenotypic variation. Three QTLs related to palmitic acid content were detected: qPA_2_1 and qPA_2_3, and qPA_2_2 and qPA_2_4, located on chromosome 2, with LOD values of 3.94 and 6.64, and 3.93 and 4.51, respectively, explaining phenotypic contributions of 7.92% and 12.54%, and 7.71% and 8.5%, respectively. qPA_8_1 and qPA_8_2, located on chromosome 8, with LOD values of 3.45 and 3.68, respectively, explained 8.30% and 9.00% of the phenotypic variation, respectively.

[0056] Using QTL IciMapping 4.1, QTL mapping for palmitic acid content in soybean seeds harvested in Sanya in 2024 was performed. Two QTLs were located: qPA_5_1 on chromosome 5, with an LOD value of 3.62, explaining 8.20% of the phenotypic variation. qPA_8_3 on chromosome 8 was also detected repeatedly in Shijiazhuang over the two years, with an LOD value of 3.93, explaining 8.91% of the phenotypic variation.

[0057] Table 2 QTL mapping results of palmitic acid content in RIL population (QTL Mapping 4.1)

[0058]

[0059] Example 5. Development and Application of Indel Markers

[0060] like Figure 8 As shown, for the qPA_2_1 interval, combined with the parental resequencing data, we screened for indel sites with base differences greater than 15 bp, and designed primers based on the flanking sequences. The results showed that between the parents, there were 15 indel sites with base differences greater than 15 bp within the 4,600,000-5,100,000 bp interval on chromosome chr02.

[0061] Table 3 Detailed information of 15 Indel sites in the interval

[0062]

[0063]

[0064]

[0065] Design PCR primers for amplification and analyze them in combination with phenotypic data. The PCR amplification reaction system and amplification conditions are as follows:

[0066] Table 4 PCR amplification reaction system

[0067]

[0068] Table 5 PCR amplification conditions are as follows:

[0069]

[0070]

[0071] To prepare agarose gel: Take 6g of agarose powder, add 100ml of 1× TAE buffer, and heat in a microwave oven until fully melted. Set the electrophoresis instrument voltage to 130V and run for approximately three and a half hours.

[0072] The results showed that the Indel at Chr02_5018100 was GT / GTGAGGTACGATAGGGGGGAGCTCGTTGCGGCGGAGCAAGTCGA T. According to its flanking sequences, the PCR primer sequences were designed as follows: Chr02_5018100 FP: AGTGTGTTTTGGATGAGGTAA (SEQ ID NO. 1); Chr02_5018100 FP: GTTTAAGGGATTTTCTGCTCA (SEQ ID NO. 2).

[0073] When the length of the amplified product is 458 bp, the gene marker band type of the soybean to be tested is A, and the nucleotide sequence of 458 bp is shown as SEQ ID NO.3;

[0074] When the length of the amplified product is 501 bp, the gene marker band type of the soybean to be tested is B, and the 501 bp nucleotide sequence is shown as SEQ ID NO.4; the palmitic acid content is as follows: the soybean with gene marker band type A is greater than or is candidate greater than the soybean with gene marker band type B.

[0075] The Indel marker developed in this study was used to perform PCR amplification and electrophoresis on the high-generation materials of this RIL population, and the electrophoresis detection results were observed. For details, see the attached Figure 3-6 .

[0076] The marker was used to perform typing on 196 materials in the Jidou 17×Jidou 12 population. The banding pattern consistent with the parent Jidou 12 was marked as A, the banding pattern consistent with the parent Jidou 17 was marked as B, and H was a heterozygous type. Figure 7 As shown in Tables 6 and 7, combined with the phenotypic data, the results showed that in 2022, there were 67 accessions with band A, with a corresponding mean palmitic acid content of 0.1203; there were 69 accessions with band B, with a corresponding mean palmitic acid content of 0.1180. There was a significant difference between groups A and B, with a P value of 0.0155. In 2023, there were 73 accessions with band A, with a corresponding palmitic acid content of 0.1216; there were 87 accessions with band B, with a corresponding palmitic acid content of 0.1199. There was a significant difference between groups A and B, with a P value of 0.0397. In 2024, there were 72 accessions with band A, with a corresponding palmitic acid content of 0.1249; there were 86 accessions with band B, with a corresponding palmitic acid content of 0.1221. There was a significant difference between groups A and B, with a P value of 0.0019.

[0077] Table 6 Specific results of Indel marker typing in RIL population

[0078]

[0079]

[0080]

[0081]

[0082]

[0083] Table 7 Indel marker typing of RIL population and association analysis results with grain palmitic acid content

[0084]

[0085] The analysis results in Table 7 show that the differences in palmitic acid content between the two gene marker bands formed in the subpopulations of soybeans consisting of 2022 band type, 2023 band type and 2024 band type all reached a significant level (P<0.05).

[0086] This marker can effectively distinguish two gene marker band types and has a co-dominant characteristic; this marker can be used to assist in screening soybean offspring materials with high palmitic acid content.

[0087] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to these examples without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

[0088] In the above embodiments, the description of each embodiment has its own focus. For parts that are not described or recorded in detail in a certain embodiment, reference can be made to the relevant description of other embodiments.

[0089] The embodiments described above are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. These modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention, and should all be included in the scope of protection of the present invention.

Claims

1. Use of InDel molecular marker primers in identifying soybeans with high palmitic acid content. The upstream primer nucleotide sequence of the InDel molecular marker primer is shown in SEQ ID NO. 1, and the downstream primer nucleotide sequence is shown in SEQ ID NO.

2. PCR amplification is performed using the InDel molecular marker primers. When the amplified product is 458 bp in length, the genetic marker band type of the soybean to be tested is A; when the amplified product is 501 bp in length, the genetic marker band type of the soybean to be tested is B. The palmitic acid content is determined as follows: soybeans with genetic marker band type A have a greater palmitic acid content than, or are potentially greater than, soybeans with genetic marker band type B.

2. A method for identifying soybeans with high palmitic acid content using the InDel molecular marker primers according to claim 1, characterized in that: The following steps are involved: (1) Using the DNA of the soybean material to be tested as a template, PCR amplification is performed using InDel molecular marker primers to obtain PCR amplification products; (2) Detecting the amplified product by agarose gel electrophoresis and observing the electrophoresis detection results; (3) When the length of the amplified product is 458 bp, the gene marker band type of the soybean to be tested is A; when the length of the amplified product is 501 bp, the gene marker band type of the soybean to be tested is B; the palmitic acid content is as follows: the soybean with gene marker band type A is greater than or is candidate greater than the soybean with gene marker band type B.

3. The method according to claim 2, characterized in that The reaction system for PCR amplification in step (1) was as follows: 1 µL of DNA template, 1 µL of forward primer and 1 µL of reverse primer, 6 µL of ddH2O, and 10 µL of 2×Mix in a 20 µL reaction system.

4. The method according to claim 2, characterized in that The reaction procedure of step (1) PCR amplification is as follows: pre-denaturation at 95°C for 3 min; denaturation at 93°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 30 s, 33 cycles; final extension at 72°C for 5 min, and storage at 4°C.

5. The method according to claim 2, characterized in that The mass concentration of the agarose gel in step (2) is 6%.

Images