Kluyveromyces marxianus INM3114 as well as preparation and application thereof

Abstract

The invention provides Kluyveromyces marxianus INM3114 as well as preparation and application thereof, the Kluyveromyces marxianus INM3114 is preserved in the Guangdong Microbial Culture Collection Center on August 21, 2024, the preservation number is GDMCC NO: 65037, and the preservation address is the 5th floor, No. 59 building, No. 100 Courtyard, Xianlie Middle Road, Guangzhou City, Guangdong Province. The method has the advantages that the method has the capability of generating a flavor substance trans-2-hexenal, the content of trans-2-hexenal after grape juice fermentation can be effectively increased, and the flavor of a baked product is richer.

Description

Technical Field

[0001] The invention belongs to the technical field of industrial microorganisms and relates to a strain of Kluyveromyces marxii INM3114 and a preparation method and application thereof. Background Art

[0002] During the storage process, bread quality will decline due to a series of physical and chemical changes, which is mainly manifested in lighter flavor and worse taste. This series of changes is a complex process involving multiple factors such as water loss, aging, microbial contamination and oxidation reaction.

[0003] The formation of bread aroma mainly depends on the characteristics and quantity of volatile or non-volatile substances during the processing process. During the storage period, microbial contamination, oxidation reaction, water loss and other factors will have an adverse effect on the flavor. Starch retrogradation is a key factor causing bread aging. During the cooling process of bread, the gelatinization and retrogradation of amylose first occur, which mainly affects the hardness of fresh bread. As the storage time increases, amylopectin retrogrades and forms a recrystallized structure, which in turn causes the bread texture to harden, resulting in the deterioration of bread quality.

[0004] Kluyveromyces marxianus is widely found in nature and has been included in the European food additives book as a food safety yeast. The high sugar and low pH characteristics of grape juice provide good conditions for the growth and reproduction of yeast. After long-term natural selection and evolution, a group of superior wild yeast resources that adapt to environmental conditions and grape varieties have gradually formed and attached to the grape skin. During the fermentation process, yeast can produce a variety of aromatic substances, giving the product a unique flavor; it can also produce various enzymes, vitamins and other active ingredients, enriching the nutritional and probiotic properties of the product.

[0005] Grapes are rich in anthocyanins, mostly in the form of glycosides, also known as anthocyanins. And anthocyanins can effectively delay the aging of bread. The basic structure of anthocyanins is 3,5,7-trihydroxy-2-phenylbenzopyran. Due to the different numbers and positions of substituents, hydroxyl groups and methoxy groups on the R1 and R2 positions of the B ring, six main anthocyanins are produced: pelargonidin, cyanidin, delphinidin, peonidin, malvidin and petunidin. In Eurasian species, the free anthocyanins in grapes usually exist in the form of 3-O-monosaccharide anthocyanins, and most of the sugar groups are glucose, which can only be combined with the C3 position on the ring. It generally exists in the form of malvidin-3-O-glucoside, petunidin-3-O-glucoside, delphinidin-3-O-glucoside and peonidin-3-O-glucoside, but does not contain pelargonidin.

[0006] Trans-2-hexenal, also known as chlorophylline, is an organic compound. Molecular formula: C6H10 O, molecular weight 98.143, density 0.8±0.1g / cm 3 . It is a colorless oily liquid, insoluble in water, but soluble in organic solvents such as ethanol. It has a strong aroma of fresh fruits and green leaves, and exists naturally in citronella oil, camphor oil, tea leaves, mulberry leaves, grapes, apples, strawberries and other fruits.

[0007] At present, the research directions of the application of anthocyanins in bread are diverse. Patent: A method for producing colored wheat fermented flour products with high-stability anthocyanins - CN 116530645 A. This invention discloses a method of using colored whole wheat flour as the main raw material, using yeast and lactobacillus mixed fermentation to produce acid, and adding soy protein hydrolyzate at the same time, which significantly improves the stability of anthocyanins and retains the activity of anthocyanins. It does not involve a fermentation method for enhancing flavor. Patent: A micro-reaction system for synthesizing trans-2-hexenal - CN 111359560 A. This invention discloses a micro-reaction system for synthesizing trans-2-hexenal, and does not involve its application in flour products. Patent: A genetically engineered bacterium, a preparation method thereof, and its application in synthesizing anthocyanins - CN118222600 A, this invention discloses a genetically engineered bacterium, a preparation method thereof, and its application in synthesizing anthocyanins, an expression vector skeleton, and a grape-derived colorless anthocyanidin dioxygenase gene and an Arabidopsis-derived 3-O-glucosyltransferase gene connected to the expression vector skeleton. It does not involve the application of anthocyanins in flour products.

[0008] The above patents focus on product functionality, involving fermentation strains, the effect of protein on the stability of anthocyanins in noodle products, the biosynthesis of anthocyanins, and the reactor system for the preparation of trans-2-hexenal. However, they ignore the fact that flavor strongly affects the acceptability of food. In particular, although lactic acid bacteria have a certain stabilizing effect on anthocyanins, organic acids have a strong impact on the overall flavor structure of the product. Therefore, in terms of product development, taking both flavor and function into consideration will be more in line with the market.

[0009] Studies have shown that anthocyanins have strong antioxidant and free radical scavenging abilities, but very little is left after high-temperature cooking. 1) Although soy protein can stabilize anthocyanins, in actual applications, it always carries a genetically modified color. 2) Lactic acid bacteria secrete acidic substances, creating a low pH environment in the food system. While stabilizing anthocyanins, they produce a sour taste, which affects the flavor structure of the product. 3) The addition of coarse grains such as black rice, which are rich in anthocyanins, makes the product texture rough and affects the taste. All of the above directly affect consumers' acceptance of the product. Therefore, it is necessary to develop a strain that can stabilize anthocyanins but at the same time coordinate the flavor. Summary of the invention

[0010] In view of the above problems, the present invention provides a strain of Kluyveromyces marxii INM3114 and a preparation method and application thereof. The strain is used to ferment grape juice to prepare fermented grape juice, thereby creating a low pH environment; the fermented grape juice contains rich and stable anthocyanins; the fermented grape juice is added to dough as an ingredient without adverse effects on gluten formation; the prepared bread remains soft and moist during storage, has no irritating sour taste, and has a stable anthocyanin content; the internal organizational structure of the product is not affected, and the perfect combination of functionality and sensory properties can be achieved.

[0011] The purpose of the invention is achieved through the following scheme: a strain of Kluyveromyces marxianus, Kluyveromyces marxianus INM3114, which was deposited in Guangdong Provincial Microbiological Culture Collection Center on August 21, 2024, with the deposit number: GDMCC NO: 65037, and the deposit address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province.

[0012] Furthermore, the colony characteristics of Kluyveromyces marxianus are as follows: after culturing on a PDA plate for 2 to 3 days, colonies with a diameter of 1.0 to 5.0 mm, white color, oval shape, smooth and moist surface, neat edges, and raised areas are formed.

[0013] A method for preparing Kluyveromyces marxii.

[0014] Step 1: Isolation of Kluyveromyces marxianus:

[0015] Isolation and screening of Kluyveromyces marxianus from raisin samples:

[0016] First, squeeze the raisins and culture them in a 28℃ incubator. Dilute the fermentation liquid by 10 1 -10 7 The fermentation broth with different dilution concentrations was evenly spread on the PDA medium, placed in an incubator and cultured at 28°C for 48 hours, and then white colonies were selected on the PDA medium for screening.

[0017] Step 2: Cultivation of Kluyveromyces marxianus:

[0018] The obtained Kluyveromyces marxianus was cultured to the logarithmic growth phase, and the final concentration of the strain was 1×10 7 CFU / mL, and then inoculated into grape juice at a 1% inoculation amount, and placed in a 28°C incubator for 48 hours to obtain the fermentation liquid.

[0019] Application of Kluyveromyces marxii to improve the content of trans-2-hexenal in grape juice after fermentation.

[0020] The invention discloses an application of Kluyveromyces marxii to effectively retain the anthocyanin content of bread after baking and improve the anti-aging ability of bread.

[0021] An application of the Kluyveromyces marxii yeast according to claim 1, wherein the yeast is used in production: according to the production process of ordinary bread, fermentation liquid that has been fermented by Kluyveromyces marxii for 48 hours is added, and the addition amount is 50g / kg flour.

[0022] A use of Kluyveromyces marxii yeast for making bread.

[0023] The invention discloses an application of Kluyveromyces marxii yeast in making meal packs.

[0024] An application of Kluyveromyces marxii yeast in making toast.

[0025] The invention discloses an application of Kluyveromyces marxii yeast in making European bread.

[0026] Advantages of the present invention: (1) The Kluyveromyces marxianus described in the present invention has the ability to produce the flavor substance trans-2-hexenal, which can effectively increase the content of trans-2-hexenal after grape juice fermentation, making the flavor of baked products more intense.

[0027] (2) The Kluyveromyces marxianus of the present invention can effectively retain the anthocyanin content of bread after baking, making the nutritional components of baked products more stable.

[0028] (3) The Kluyveromyces marxianus of the present invention has the characteristics of improving the aroma and taste of the product and can reduce the hardness of bread during storage. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 For 10 7 Total ion current of trans-2-hexenal in bread made with different inoculum concentrations.

[0030] Figure 2 This is a morphological diagram of the culture medium for Kluyveromyces marxianus.

[0031] Figure 3 This is a Gram staining microscopic examination of Kluyveromyces marxianus. DETAILED DESCRIPTION

[0032] The present invention will be further described below in conjunction with specific embodiments:

[0033] Unless otherwise specified, the experimental methods used in the following embodiments are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial channels.

[0034] Example 1, see attached Figure 1-3 , a strain of Kluyveromyces marxianus, Kluyveromyces marxianus INM3114, which was deposited in Guangdong Provincial Microbiological Culture Collection Center on August 21, 2024, with the deposit number: GDMCC NO: 65037, and the deposit address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province.

[0035] The colony characteristics of a strain of Kluyveromyces marxianus are as follows: after culturing on a PDA plate for 2 to 3 days, colonies with a diameter of 1.0 to 5.0 mm, white color, oval shape, smooth and moist surface, neat edges and raised edges are formed.

[0036] A method for preparing Kluyveromyces marxii.

[0037] Step 1: Isolation of Kluyveromyces marxianus:

[0038] Isolation and screening of Kluyveromyces marxianus from raisin samples:

[0039] First, squeeze the raisins and culture them in a 28℃ incubator. Dilute the fermentation liquid by 10 1 -10 7 The fermentation broth with different dilution concentrations was evenly spread on the PDA medium, placed in an incubator and cultured at 28°C for 48 hours, and then white colonies were selected on the PDA medium for screening.

[0040] Step 2: Cultivation of Kluyveromyces marxianus:

[0041] The obtained Kluyveromyces marxianus was cultured to the logarithmic growth phase, and the final concentration of the strain was 1×10 7 CFU / mL, and then inoculated into grape juice at a 1% inoculation amount, and placed in a 28°C incubator for 48 hours to obtain the fermentation liquid.

[0042] Application of Kluyveromyces marxii to improve the content of trans-2-hexenal in grape juice after fermentation.

[0043] The invention discloses an application of Kluyveromyces marxii to effectively retain the anthocyanin content of bread after baking and improve the anti-aging ability of bread.

[0044] An application of the Kluyveromyces marxii yeast according to claim 1, wherein the yeast is used in production: according to the production process of ordinary bread, fermentation liquid that has been fermented by Kluyveromyces marxii for 48 hours is added, and the addition amount is 50g / kg flour.

[0045] 1. Processing of raw materials

[0046] Take 10g of raisins, clean the dust on the surface, add them to 100g of grape juice, ferment at 28℃ for 48h, dilute the fermentation liquid by 10 1 -10 7 The bacterial solution was evenly spread on the PDA medium to observe the colony morphology. The colonies with different morphologies were picked out and further separated and purified on PDA, and numbered as PDA1-PDA15.

[0047] 2. Preliminary screening of bacterial strains

[0048] The 15 strains were inoculated into malt juice medium at 1% inoculum and cultured at 28°C for 48h. The final cell density reached 10 7 CFU / mL. Take 1 ml of bacterial solution from each tube and inoculate it in 100 mL of grape juice. After culturing at 28°C for 48 hours, centrifuge at 8000 r / min for 10 minutes to obtain the supernatant as the sample for physical and chemical index testing. The results are shown in Table 1.

[0049] Anthocyanin content: Plant anthocyanin detection kit microplate method.

[0050] Trans-2-hexenal content: The extraction method uses 50 / 30um, DVB / CAR / PDMS, Stableflex solid phase microextraction head, takes 5g of sample in a 30mL headspace bottle, 60℃ water bath, and extracts for 40min. For gas chromatography-mass spectrometry detection, HP-Innowax (30m×250μm, 0.25μm) capillary column is selected. GC conditions are: helium as carrier gas, carrier gas flow rate is set to 1mL / min, non-split injection, injection port temperature is 250℃. MS conditions are: ion source temperature 230℃, MS quadrupole temperature 150℃, electron energy 70eV, mass spectrometry scanning range 45~500, scanning mode is full scan. The column box temperature program is: 50℃ for 1min, increase to 160℃ at 4℃ / min, and then increase to 250℃ at 10℃ / min, and maintain for 2min. The compound was identified by mass spectrometry database method, and each peak was compared with NIST Library mass spectrometry database by computer, and the qualitative basis was the material matching degree greater than 800. Internal standard quantitative method: a certain amount of trans-2-hexenal standard was accurately added to the ethanol solution, and the trans-2-hexenal content was calculated according to the peak area ratio.

[0051] Hardness test method: Use flat-bottom cylindrical probe P / 36R. Test conditions are as follows: pre-test rate: 1mm / s; test rate: 1mm / s; post-test rate: 3mm / s; compression degree: 50%; dwell interval: 5s; trigger value: 5g. Each test is repeated 5 times.

[0052] Table 1 Analysis of anthocyanidins and trans-2-hexenal produced by fermentation

[0053]

[0054] Strains PDA3, PDA6 and PDA13 with lower pH and higher anthocyanin and trans-2-hexenal contents were selected for rescreening.

[0055] 3. Strain rescreening

[0056] The three yeast strains PDA3, PDA6 and PDA13 selected in the initial screening were reactivated and cultured. When the bacterial concentration reached 10 7 CFU / mL, it was inoculated into grape juice at 1% inoculation amount, fermented at 28℃ for 48h, and the fermented grape juice was added to the medium seed at 10% of the total amount of wheat. Bread was made according to the national standard GB / T14612-2008 and subjected to sensory evaluation and hardness test. The results are shown in Table 2.

[0057] Table 2 Sensory analysis and hardness of fermented bread

[0058] Species name Bread Appearance taste Average sensory score Bread hardness (g) PDA3 5.0 4.5 4.75 305.584±14.256 PDA6 4.5 4.5 4.5 352.135±15.036 PDA13 4.5 4.5 4.5 369.411±14.833

[0059] Note: The lower the hardness, the softer the bread and the better the anti-aging effect of the bacteria.

[0060] From the results in Table 2, we can see that the average sensory score of bread made with PDA3 is the highest and the bread hardness value is the lowest. As the target strain, the morphology of this strain on the PDA plate medium is observed as follows: Figure 2 As shown, the colony diameter is 1.0 to 5.0 mm, white, oval, with a convex, smooth and moist surface and neat edges. After Gram staining, the results are as follows: Figure 3 shown.

[0061] The PDA3 obtained by the above screening was subjected to 16SrDNA sequencing and identification. After comparative analysis, the 16S region sequence obtained from the strain of the present invention is 100% similar to Kluyveromyces marxianus. It can be determined that the strain is a strain of Kluyveromyces marxianus, which can be used in the food fermentation industry. It is named Kluyveromyces marxianus INM3114. The strain was deposited in the Guangdong Provincial Microbiological Culture Collection Center on August 21, 2024, with a deposit number of: GDMCC NO: 65037, and the deposit address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province. Therefore, in this application, Kluyveromyces marxianus INM3114 and PDA3 refer to the same strain. The PDA3 strain of the present invention has been genetically identified, and its gene sequence is as follows:

[0062] TGTGTTGCATATCCAAAAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAG

[0063] TGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGA

[0064] GGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAA

[0065] TCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAA

[0066] TGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGA

[0067] ACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATT

[0068] GTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGG

[0069] GGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTA

[0070] GCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACG

[0071] TAAGTCAAGGATGCTGGCATAATGGTTATATGCCGCCCGTCTTGAACACACCGGACCCA

[0072] Example 2, genetic stability detection of Kluyveromyces marxianus INM3114:

[0073] The Kluyveromyces marxianus INM3114 in Example 1 was propagated on malt juice liquid medium for 10 generations, and the first, fifth and tenth generation strains were respectively propagated at a bacterial concentration of 10 7 CFU / mL, 1% inoculation amount was inoculated in grape juice, fermented at 28°C for 48h, and the fermented grape juice was added to the medium seed at 10% of the total amount of wheat. Bread was made according to the national standard GB / T14612-2008, and physical and chemical indexes were tested to detect anthocyanin content, trans-2-hexenal content, and bread hardness. The method was referred to Example 1. At the same time, sensory evaluation was carried out to determine its stability in passage, and the specific data are shown in Table 3.

[0074] Table 3 Results of the stability test for passage

[0075]

[0076] The results in Table 3 show that the fermentation performance of Kluyveromyces marxianus INM3114 strains of different generations is normal, the content of trans-2-hexenal and anthocyanin varies within 10%, the strain has good genetic stability and meets the requirements for production and use.

[0077] Example 3, Kluyveromyces marxianus INM3114 is used to make anthocyanin-rich bread;

[0078] Kluyveromyces marxianus INM3114 was inoculated at a concentration of 10 4 -10 8 CFU / mL, inoculated into grape juice at 1% inoculation amount, fermented at 28°C for 48h, and added the fermented grape juice into the medium seed at 10% of the total amount of wheat. According to the national standard GB / T 14612-2008, bread was made and tested for physical and chemical indicators, such as anthocyanin content, trans-2-hexenal content, and bread hardness, with reference to Example 1. PDA9 was used as the control strain, and the results are shown in Tables 4 and 5.

[0079] Table 4 Anthocyanidin and trans-2-hexenal contents in bread

[0080]

[0081]

[0082] Table 5 Bread sensory evaluation results

[0083] Grouping Inoculum size CFU / mL sour taste Sweetness Taste Overall Rating Bread hardness (g) Control group 1 <![CDATA[1.0×10 4 ]]> 4.5 4.5 4.6 13.6 564.706±12.467 Experimental Group 1 <![CDATA[1.0×10 4 ]]> 6.2 6.3 6.2 18.7 343.336±13.081 Control group 2 <![CDATA[1.0×10 5 ]]> 4.3 4.6 4.4 13.3 565.698±11.958 Experimental Group 2 <![CDATA[1.0×10 5 ]]> 7.5 7.1 7.6 22.2 334.568±13.211 Control group 3 <![CDATA[1.0×10 6 ]]> 4.3 4.4 4.7 13.4 568.686±13.431 Experimental Group 3 <![CDATA[1.0×10 6 ]]> 7.5 7.8 7.6 22.9 321.268±12.893 Control group 4 <![CDATA[1.0×10 7 ]]> 4.5 4.4 4.5 13.4 563.670±12.633 Experimental Group 4 <![CDATA[1.0×10 7 ]]> 8.8 8.9 8.8 26.5 302.538±14.041 Control group 5 <![CDATA[1.0×10 8 ]]> 4.5 4.3 4.3 13.1 566.650±11.976 Experimental Group 5 <![CDATA[1.0×10 8 ]]> 6.3 6.5 6.6 19.4 345.533±13.458

[0084] Note: Each item has a full score of 10 points, with a scoring interval of 0.1, and the comprehensive score is the sum of the values ​​of each item.

[0085] From the results in Tables 4 and 5, it can be seen that fermentation with Kluyveromyces marxianus INM3114 can significantly increase the content of trans-2-hexenal and anthocyanins in bread, and the more the inoculation amount, the higher the content of trans-2-hexenal and anthocyanins; however, too high or too low inoculation concentration of Kluyveromyces marxianus INM3114 will affect the sourness, sweetness and taste of bread. The most suitable inoculation concentration is 1.0×10 7 CFU / mL, this concentration can produce sufficient anthocyanin content and improve the flavor and taste of whole grain bread, such as Figure 1 , is the total ion current of trans-2-hexenal in bread made at this inoculation concentration.

[0086] Example 4, making toast with Kluyveromyces marxianus INM3114;

[0087] Kluyveromyces marxianus INM3114 was inoculated at a concentration of 10 7 CFU / mL, inoculated into grape juice at 1% inoculation amount, fermented at 28℃ for 48h, and added the fermented grape juice into the medium seed at 10% of the total amount of wheat. Toast was made according to the national standard GB / T 14612-2008. PDA9 was used as the control group and toast was made in the same way. After fermentation, the method in Example 1 was used to detect trans-2-hexenal, anthocyanin content, and hardness of the toast stored for 1, 4, and 7 days. At the same time, professional appraisers were invited to conduct sensory evaluation of the toast flavor, and the results are recorded in Table 6.

[0088] Table 6 Anthocyanin, trans-2-hexenal detection and toast sensory evaluation results

[0089]

[0090]

[0091] Note: Each sensory evaluation item has a full score of 10 points, with a scoring interval of 0.1, and the comprehensive score is the sum of the values ​​of each item.

[0092] From the results in Table 6, we can see that after 10 7 CFU / mL Kluyveromyces marxianus INM3114 can significantly increase the content of trans-2-hexenal and anthocyanin in toast when making toast; in addition, it can also improve the sensory evaluation of toast, increase the aroma of toast, and improve the flavor and taste of toast, making the toast fragrant, sweet and sour.

[0093] Example 5, Preparation of meal buns with Kluyveromyces marxianus INM3114

[0094] Kluyveromyces marxianus INM3114 was inoculated at a concentration of 10 7 CFU / mL, inoculated into grape juice at 1% inoculation amount, fermented at 28℃ for 48h, and added the fermented grape juice into the medium seed at 10% of the total amount of wheat. Made into meal buns according to the national standard GB / T 14612-2008. PDA9 was used as the control group, and meal buns were made in the same way. After fermentation, the trans-2-hexenal, anthocyanin content, and hardness of the meal buns stored for 1, 4, and 7 days were tested according to the method in Example 1. At the same time, professional appraisers were invited to conduct sensory evaluation of the flavor of the meal buns, and the results are recorded in Table 7.

[0095] Table 7 Anthocyanin, trans-2-hexenal detection and sensory evaluation results of meal bags

[0096]

[0097]

[0098] Note: Each sensory evaluation item has a full score of 10 points, with a scoring interval of 0.1, and the comprehensive score is the sum of the values ​​of each item.

[0099] From the results in Table 7, we can see that after 10 7 CFU / mL Kluyveromyces marxianus INM3114 can significantly increase the content of trans-2-hexenal and anthocyanin in fermented dough; in addition, it can also improve the sensory evaluation of the bread, increase the aroma, and enhance the flavor and taste. Example 6, European bread made with Kluyveromyces marxianus INM3114

[0100] Kluyveromyces marxianus INM3114 was inoculated at a concentration of 10 7 CFU / mL, inoculated into grape juice at 1% inoculation amount, fermented at 28℃ for 48h, and added the fermented grape juice to the medium seed at 10% of the total amount of wheat. European bread was made according to the national standard GB / T 14612-2008. PDA9 was used as the control group, and European bread was made in the same way. After fermentation, the trans-2-hexenal, anthocyanin content, and hardness of the bread stored for 1, 4, and 7 days were tested according to the method in Example 1. At the same time, professional appraisers were invited to conduct sensory evaluation of the flavor of the bread, and the results are recorded in Table 8.

[0101] Table 8 Anthocyanin, trans-2-hexenal detection and sensory evaluation results of European bread

[0102]

[0103]

[0104] Note: Each sensory evaluation item has a full score of 10 points, with a scoring interval of 0.1, and the comprehensive score is the sum of the values ​​of each item.

[0105] From the results in Table 8, we can see that after 10 7 CFU / mL Kluyveromyces marxianus INM3114 can significantly increase the content of anthocyanins and trans-2-hexenal in making European bread; in addition, it can also improve the flavor and taste of European bread.

[0106] Based on the results of the above embodiments, the Kluyveromyces marxianus INM3114 provided by the present invention is applied to the production of toast, dinner rolls, and European bread. On the basis of not changing the existing process, the anthocyanin and trans-2-hexenal contents of the relevant products can be significantly increased, and the aroma and taste of the products can be improved, thereby significantly improving the product quality.

[0107] The above-mentioned embodiments only express several implementation methods of the present invention, and the description is relatively specific and detailed, but it cannot be understood as limiting the scope of the invention patent. It should be pointed out that for ordinary technicians in this field, several modifications and improvements can be made without departing from the concept of the present invention. Therefore, the protection scope of the patent of the present invention shall be based on the attached claims.

Claims

1. A strain of Kluyveromyces marxii, characterized in that: Kluyveromyces marxianus INM3114, the strain was deposited in Guangdong Provincial Microbiological Culture Collection Center on August 21, 2024, with the deposit number: GDMCC NO: 65037, and the deposit address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province.

2. The Kluyveromyces marxii strain according to claim 1, characterized in that: The colony characteristics of Kluyveromyces marxianus are as follows: after culturing on a PDA plate for 2 to 3 days, colonies with a diameter of 1.0 to 5.0 mm, white color, oval shape, smooth and moist surface, neat edges and raised areas are formed.

3. A method for preparing Kluyveromyces marxii according to claim 1, characterized in that: Step 1: Isolation of Kluyveromyces marxianus: Isolation and screening of Kluyveromyces marxianus from raisin samples: First, squeeze the raisins and culture them in a 28℃ incubator. Dilute the fermentation liquid by 10 1 -10 7 The fermentation broth with different dilution concentrations was evenly spread on the PDA medium, placed in an incubator and cultured at 28°C for 48 hours, and then white colonies were selected on the PDA medium for screening. Step 2: Cultivation of Kluyveromyces marxianus: The obtained Kluyveromyces marxianus was cultured to the logarithmic growth phase, and the final concentration of the strain was 1×10 7 CFU / mL, and then inoculated into grape juice at a 1% inoculation amount, and placed in a 28°C incubator for 48 hours to obtain the fermentation liquid.

4. Use of the Kluyveromyces marxii yeast according to claim 1 to increase the content of trans-2-hexenal in grape juice after fermentation.

5. Use of the Kluyveromyces marxii yeast according to claim 1 to effectively retain the anthocyanin content of bread after baking and improve the anti-aging ability of bread.

6. A use of Kluyveromyces marxianus according to claim 1, characterized in that: Production application: According to the production process of ordinary bread, add the fermentation liquid that has been fermented by Marx Kluyveri for 48 hours, and the added amount is 50g / kg flour.

7. Use of the Kluyveromyces marxianus according to claim 1 for making bread.

8. Use of the Kluyveromyces marxii according to claim 1 for making meal packs.

9. Use of the Kluyveromyces marxii yeast according to claim 1 for making toast.

10. Use of the Kluyveromyces marxii yeast according to claim 1 for making European bread.

Images