An mRNA encoding anti-Staphylococcus aureus enterotoxin B antibody and its application

The use of mRNA technology to prepare antibodies encoding anti-Staphylococcus aureus enterotoxin B solves the problems of high cost, long cycle and poor stability in traditional antibody production, achieves effective prevention and treatment of Staphylococcus aureus infection, and adapts to rapid emergency production needs.

CN119320780BActive Publication Date: 2025-09-23ARMY MEDICAL UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411437881.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-15
Publication Date
2025-09-23
Estimated Expiration
2044-10-15

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively prevent and treat infections caused by Staphylococcus aureus enterotoxin B (SEB). Traditional antibody production has high costs, long cycles, instability, and a short half-life, making it impossible to quickly respond to sudden war situations.

Method used

mRNA technology is used to prepare mRNA encoding anti-Staphylococcus aureus enterotoxin B antibodies. By expressing and secreting antibodies in the host, long-term protection is achieved, avoiding the cumbersome steps and stability issues of traditional antibody preparation.

Benefits of technology

It achieves effective prevention and treatment of Staphylococcus aureus infection, increases local antibody concentration, achieves the purpose of long-term protection, and adapts to rapid emergency production needs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119320780B_ABST
    Figure CN119320780B_ABST
Patent Text Reader

Abstract

The present invention discloses an mRNA encoding an anti-Staphylococcus aureus enterotoxin B antibody and an application thereof. The mRNA comprises an mRNA encoding a light chain of the anti-Staphylococcus aureus enterotoxin B antibody and an mRNA encoding a heavy chain of the anti-Staphylococcus aureus enterotoxin B antibody, wherein the optimized base sequences of the variable regions CDR1, CDR2 and CDR3 of the heavy chain are shown as SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6, respectively; and the optimized base sequences of the variable regions CDR1, CDR2 and CDR3 of the light chain are shown as SEQ ID NO.7, SEQ ID NO.8 and SEQ ID NO.9. The antibody can be used to neutralize SEB toxin and simultaneously prevent and treat Staphylococcus aureus infection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to an mRNA encoding an anti-Staphylococcus aureus enterotoxin B antibody and also to the application of the antibody. Background Art

[0002] Staphylococcus aureus (hereinafter referred to as S. aureus) is one of the "superbugs" with the highest infection rate in burns and war trauma. S. aureus can cause a variety of infections, such as impetigo, toxic shock syndrome, pneumonia, suppurative arthritis, endocarditis and autoimmune diseases (such as lupus erythematosus). Antibiotics are the most effective way to prevent and control bacterial infections, but due to the pathogenic characteristics of S. aureus, antibiotic prevention and treatment seem powerless. Although new antibiotics against S. aureus have been introduced, the rapid emergence of drug resistance indicates that there is still a need to develop new treatments that do not exert selective pressure on the evolutionary adaptation of bacteria to combat diseases related to S. aureus infections.

[0003] Staphylococcus aureus can express a wide range of virulence factors, thereby evading the host immune response, allowing the bacteria to grow and spread in host cells and cause a variety of diseases. Staphylococcal enterotoxin B (SEB) is one of the main pathogenic factors of S. aureus infection. SEB is classified as a Category B biological warfare agent by the US Centers for Disease Control and Prevention due to its good protein stability, ease of production and aerosolization, and extremely strong incapacitating properties. Currently, there are no effective prevention and treatment methods for SEB biocontrol and S. aureus combat wound infections. Therefore, it is of great significance to strengthen the rapid independent research and development of key technology systems and emergency production capabilities for specific drugs for the immune prevention and treatment of SEB bacterial toxin biological warfare agents. SEB is an important target for the development of antitoxin neutralizing antibodies for the prevention and treatment of S. aureus infections.

[0004] With the development of mRNA technology, the method of preparing mRNA antibodies can overcome the shortcomings of traditional antibody production, such as high cost, long cycle, easy degradation, large dosage, and short half-life, increase the local antibody concentration in the body, and achieve the purpose of long-term protection of the body.

[0005] Traditional monoclonal antibodies are complex in preparation and purification. The tedious extraction process can affect antibody stability and expression of the correct conformation, and the production cycle is long. Furthermore, antibodies are unstable and easily degraded in the body, requiring high dosages and having a short half-life. This makes rapid emergency production and long-term protection difficult in emergencies. mRNA technology offers superior safety, flexible design, and a short R&D and production cycle, making it suitable for large-scale production. mRNA-based antibody technology avoids the tedious steps of traditional antibody preparation and purification. By transferring mRNA encoding the heavy and light chain sequences into the host, the antibodies are directly expressed and secreted within the host after endogenous translational modification. This enables sustained antibody expression and secretion in vivo, overcoming the short half-life of antibodies, increasing local antibody concentrations, and achieving long-term protection. Therefore, research on mRNA antibodies targeting SEB is crucial for effectively preventing and treating Staphylococcus aureus infections in combat wounds, responding promptly to the threat of SEB biological warfare agents, and enhancing the prevention and control of biological threats and major infectious diseases.

[0006] In response to the increasingly serious situation of Staphylococcus aureus infection and the spread of drug resistance, and based on in-depth research on Staphylococcus aureus infection and immune mechanisms, we use new mRNA technologies and methods, and build on previous research on Staphylococcus aureus vaccines and fully human monoclonal antibodies against SEB, to develop new anti-SEB mRNA antibodies. Summary of the Invention

[0007] In view of this, one of the objects of the present invention is to provide an mRNA encoding an anti-Staphylococcus aureus enterotoxin B antibody; a second object of the present invention is to provide the use of the mRNA in the preparation of a drug for preventing or treating Staphylococcus aureus infection; a third object of the present invention is to provide the use of the mRNA in the preparation of a drug for neutralizing Staphylococcus enterotoxin B.

[0008] In order to achieve the above object, the present invention provides the following technical solutions:

[0009] 1. An mRNA encoding an anti-Staphylococcus aureus enterotoxin B antibody, comprising an mRNA encoding an anti-Staphylococcus aureus enterotoxin B antibody light chain and an mRNA encoding an anti-Staphylococcus aureus enterotoxin B antibody heavy chain, wherein the heavy chain mRNA sequence is shown in SEQ ID NO.1; the light chain mRNA sequence is shown in SEQ ID NO.2.

[0010] Preferably, the concentration of the light chain mRNA is 1 μg / μL-10 μg / μL; the concentration of the heavy chain mRNA is 1 μg / μL-10 μg / μL.

[0011] Preferably, the volume ratio of light chain mRNA to heavy chain mRNA is 1:2.

[0012] 2. Use of the mRNA in preparing a vaccine for preventing and / or treating Staphylococcus aureus infection.

[0013] 3. Use of the mRNA in the preparation of a drug for neutralizing Staphylococcal enterotoxin B.

[0014] The beneficial effects of the present invention are as follows: the present invention discloses an mRNA encoding an anti-Staphylococcus aureus enterotoxin B antibody and its application, the antibody mRNA includes an mRNA encoding an anti-Staphylococcus aureus enterotoxin B antibody light chain and an mRNA encoding an anti-Staphylococcus aureus enterotoxin B antibody heavy chain, wherein the nucleic acid sequence of the heavy chain is shown as SEQ ID NO.1; the nucleotide sequence of the light chain is shown as SEQ ID NO.2, the antibody can be used to neutralize SEB toxin, and simultaneously prevent and treat Staphylococcus aureus infection, making it possible to control Staphylococcus aureus infection and the development of drug resistance with "non-antibiotic drugs". BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to make the purpose, technical solutions and beneficial effects of the present invention more clear, the present invention provides the following drawings for illustration:

[0016] Figure 1 The denaturing electrophoresis results of heavy chain (HC) and light chain (LC) mRNA;

[0017] Figure 2 SDS-PAGE was used to detect the supernatant of HEK293F cells transfected with mRNA antibodies (R-reducing electrophoresis analysis; NR-non-reducing electrophoresis);

[0018] Figure 3 Immunoblotting reaction of serum and SEB protein after administration of mRNA antibody to mice;

[0019] Figure 4 The protective effect of mRNA antibodies in the mouse SEB toxin challenge model;

[0020] Figure 5 The protective effect of mRNA antibodies against infection with Staphylococcus aureus ST59 strain;

[0021] Figure 6 This is the therapeutic effect of mRNA antibodies in Staphylococcus aureus ST59 strain infection. DETAILED DESCRIPTION

[0022] The present invention will be further described below with reference to the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it. However, the embodiments are not intended to limit the present invention.

[0023] Example 1. Preparation of heavy chain mRNA and light chain mRNA in mRNA antibodies

[0024] (1) Construction of in vitro transcription template

[0025] The heavy and light chain sequences of the anti-SEB antibody were codon-optimized and used to construct an in vitro transcription template plasmid. The sequence of the plasmid consisted of 5-UTR, T7 promoter sequence, secretion signal peptide sequence, heavy chain / light chain coding region, and 3-UTR.

[0026] The paired heavy chain and light chain template sequences (including 5-UTR, T7 promoter sequence, secretion signal peptide sequence, heavy chain / light chain coding region, 3-UTR) were inserted into the restriction endonucleases BamH1 and Sal1 and then ligated into the non-expression vector pGEX.

[0027] The heavy chain template sequence H1 (SEQ ID NO. 1), and its paired light chain template sequence L1 (SEQ ID NO. 2).

[0028] SEQ ID NO.1:

[0029] TAATACGACTCACTATAGGGACAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGCGGCCGGGAACGGTGCATTGGAACGCGGATTCCCCGTGCCAAGAGTGACTCACCGTCCTTGACACG ATG TGA CGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCAAGCT

[0030] SEQ ID NO.2:

[0031] TAATACGACTCACTATAGGGACAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGCGGCCGGGAACGGTGCATTGGAACGCGGATTCCCCGTGCCAAGAGTGACTCACCGTCCTTGACACG ATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACCAGTCTGTGCTGACTCAGCCGCCCTCAGTGTCTGCGGCCCCAGGACAGAAGGTCACCATCTCCTGCTCTGGAAACAGCTCCAACATTGGGCAGAATCATGTATCCTGGTACCAGCAAGTCCCAGGAAAAGCCCCCAAAGTCCTCATTTATGACACTAAAGAGCGACCCTCAGGGATTCCTGACCGATTCTCTGGCTCCAGGTCTGGCACGTCAGTCACCCTGGGCATCACCGGACTCCAGACTGGGGACGAGGCCGACTACTACTGCGGAACATGGGATAGCAGGCTGAGCGCTGTGGTTTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCGGTCACTCTGTTCCCGCCCTCCTCTGAGGAGCTTCAAGCCAACAAGGCCACACTGGTGTGTCTCATAAGTGACTTCTACCCGGGAGCCGTGACAGTGGCCTGGAAGGCAGATAGCAGCCCCGTCAAGGCGGGAGTGGAGACCACCACACCCTCCAAACAAAGCAACAACAAGTACGCGGCCAGCAGCTATCTGAGCCTGACGCCTGAGCAGTGGAAGTCCCACAGAAGCTACAGCTGCCAGGTCACGCATGAAGGGAGCACCGTGGAGAAGACAGTGGCCCCTACAGAATGTTCACAACCGCGGTTCGCGGCCGCT TGA CGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCAAGCT

[0032] (2) In vitro transcription, Cap addition and Poly A structure modification

[0033] Template preparation: The above template plasmid is linearized by double enzyme digestion with BamH1 and Sal1, and purified by gel recovery, which can be used as an in vitro transcription template. The purified heavy chain or light chain DNA linear template is added with the corresponding reagents according to the reaction system in Table 1 for in vitro transcription and cap structure modification:

[0034] Table 1. Reaction system

[0035]

[0036]

[0037] The mixture was gently mixed with a pipette, centrifuged at 1000 g to collect the liquid hanging on the wall of the control tube, and then incubated at 37°C for 2 hours. 1 μL of DNase I was then added to the reaction system to digest the remaining DNA template in the reaction solution, and incubated at 37°C for 15 minutes. The obtained mRNA was then modified with Poly A according to the operating instructions to obtain crude mRNA.

[0038] (3) mRNA product purification

[0039] To the above reaction solution, add 50 μL of LiCl solution (containing 7.5 M LiCl and 50 mM EDTA), mix well, and store at -20°C overnight. Centrifuge at 13,000 g for 5 min, remove the supernatant, and collect the precipitate. Wash three times with pre-cooled 75% ethanol, reconstitute with RNase-free water, and then analyze by electrophoresis.

[0040] Example 2: Denaturing Electrophoresis Analysis of Heavy and Light Chain mRNA

[0041] The mRNA encoding the heavy or light chain prepared above was purified by fast protein liquid chromatography, and the concentration of the purified mRNA was measured using a NanoDrop micro-detector. Simultaneously, 1× MOPS electrophoresis fluid was used to prepare agarose gel and electrophoresis buffer. A certain volume of the prepared mRNA was added to an equal volume of 2× RNA loading dye, and the mixture was heated at 70°C for 10 minutes. Electrophoresis was performed at 100 V for approximately 30 minutes and the results were observed.

[0042] The results showed that the denaturing electrophoresis results of heavy chain (HC) and light chain (LC) mRNA were as follows Figure 1 The results showed that the prepared heavy chain (HC) and light chain (LC) mRNA had good purity and no degradation.

[0043] Example 3, SDS-PAGE detection of mRNA antibody in HEK 293F cell transfection supernatant

[0044] Heavy chain mRNA and light chain mRNA were mixed in a volume ratio of 1:2, coated with lipid nanoparticles (LNP), and then added to HEK293F cells. HEK293 basal medium was supplemented 4 hours after transfection, and the cells were cultured in a 37°C, 5% CO2 incubator for 48 hours. The transfection supernatant was collected by centrifugation at 3000×g for 30 minutes and purified by protein A affinity chromatography. The purified antibodies were loaded with reducing loading buffer and non-reducing loading buffer, respectively, and then analyzed by SDS-PAGE.

[0045] The results are as follows Figure 2 As shown, the results showed that the transfected cells successfully expressed the antibody, and the relative molecular weight of the antibody obtained by purification after mRNA antibody transfection was about 160-180KD, the heavy chain was about 55KD, and the light chain was about 25KD.

[0046] Example 4: Western Blot Detection of the Structural Integrity of Antibodies Produced by mRNA Antibodies in Vivo

[0047] The purified SEB protein was loaded on SDS-PAGE and transferred to a PVDF membrane. The serum of mice after administration of the mRNA antibody was collected as the primary antibody and incubated with the PVDF membrane overnight at 4°C. The membrane was washed three times with PBST, and then HRP-labeled anti-mouse secondary antibody was added. The cells were incubated at room temperature for 1 hour, washed three times with PBST, and then exposed with an exposure solution for photography.

[0048] The results are as follows Figure 3 The results showed that the serum could specifically bind to the SEB protein, indicating that the SEB-mRNA antibody could mediate the production of antibody molecules with complete structures in mice after administration.

[0049] Example 5: ELISA detection of serum antibody concentration

[0050] The heavy chain mRNA and light chain mRNA were mixed in a mass ratio of 1:2 and dissolved in a pH 4.0, 50 mmol / L citric acid-sodium citrate solution to a final concentration of 33.3 μg / mL. 1 mL of ethanol solution containing phospholipids and 3 mL of mRNA aqueous solution were drawn out with a syringe, respectively. The mixture was mixed at a volume ratio of 1:3 between the ethanol phase and the buffer phase and a flow rate ratio of 6 mL / min:18 mL / min to obtain lipid nanoparticles (LNPs) encapsulating mRNA.

[0051] Example 6: SEB toxin challenge model and protective evaluation

[0052] 6-8 week old Balb / c mice were divided into 4 groups, 10 in each group. Each group was injected with 0.05 mg / kg, 0.25 mg / kg and 0.5 mg / kg of mRNA antibody and an equal volume of sterile PBS through the tail vein. 24 hours after administration, SEB toxin was administered through the tail vein (10 mg per mouse) and the survival of the mice was observed. The results are shown in Figure 2. Figure 4 As shown, all mice in the PBS-treated group died within 24 hours after SEB toxin challenge. Survival rates were 30%, 70%, and 100% at doses of 0.05 mg / kg, 0.25 mg / kg, and 0.5 mg / kg of mRNA antibody, respectively. These results demonstrate that mRNA antibodies can effectively neutralize SEB toxin in mice in a dose-dependent manner.

[0053] Example 7: Staphylococcus aureus ST59 strain challenge model and evaluation of preventive and therapeutic effects

[0054] Staphylococcus aureus ST59 strain was cultured at 1.0×10 7 CFU / mouse tail vein challenge was used to establish a stable bacterial infection model. 6-8 week old Balb / c mice were divided into two groups, 10 in each group, and injected with 0.5 mg / kg mRNA antibody and an equal volume of sterile PBS into the tail vein. 24 hours later, ST59 strain was used to challenge the tail vein. 72 hours after administration, the mice were sacrificed, and their organs were collected to detect bacterial colonization. Figure 5 The results showed that 0.5 mg / kg of the mRNA antibody significantly reduced bacterial colonization in various organs of mice. The results indicate that the mRNA antibody of the present invention can effectively prevent sepsis caused by Staphylococcus aureus infection.

[0055] As described above, 6-8 week old Balb / c mice were divided into 2 groups, 10 in each group, and challenged with 1.0×107 CFU / mouse of Staphylococcus aureus ST59 strain via tail vein. 30 minutes after challenge, 0.5 mg / kg of mRNA antibody was administered. 72 hours after challenge, the mice were sacrificed, and their organs were collected to detect bacterial colonization. Figure 6 As shown, in the ST59 challenge treatment model, the 0.5 mg / kg mRNA antibody administration group significantly reduced bacterial colonization in various organs of mice. These results demonstrate that the mRNA antibody against SEB toxin described herein can effectively treat sepsis caused by Staphylococcus aureus infection, treating and delaying disease progression to a certain extent.

[0056] The above embodiments are merely preferred embodiments for the purpose of fully illustrating the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are within the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims.

Claims

1. An mRNA encoding an anti-Staphylococcus aureus enterotoxin B antibody, characterized in that: It comprises an mRNA encoding an anti-Staphylococcus aureus enterotoxin B antibody light chain and an mRNA encoding an anti-Staphylococcus aureus enterotoxin B antibody heavy chain, wherein the heavy chain mRNA sequence is shown in SEQ ID NO.1; and the light chain mRNA sequence is shown in SEQ ID NO.

2.

2. Use of the mRNA according to claim 1 in the preparation of a vaccine for preventing and / or treating Staphylococcus aureus infection.

3. Use of the mRNA according to claim 1 in the preparation of a medicament for neutralizing Staphylococcal enterotoxin B.

Citation Information

Patent Citations

  • Completely human SEB monoclonal antibody for resisting staphylococcus aureus enterotoxin B and application of completely human SEB monoclonal antibody

    CN116178534A

  • Staphylococcal Enterotoxin B specific Monoclonal antibody and use therof

    KR102274759B1