Dcaps molecular marker for identifying green shoulder in eggplant and application thereof

By developing the dCAPS molecular marker for identifying green fruit shoulders in eggplant, and using specific primer pairs for PCR amplification and enzyme digestion, rapid and accurate identification of green fruit shoulders in eggplant was achieved, improving breeding efficiency and success rate.

CN119320843BActive Publication Date: 2025-11-28GUANGXI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411739925.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-29
Publication Date
2025-11-28
Estimated Expiration
2044-11-29

AI Technical Summary

Technical Problem

Existing technologies are insufficient for the accurate identification and breeding selection of green fruit shoulders in eggplants, affecting breeding efficiency and cycle.

Method used

A dCAPS molecular marker for identifying the green shoulder of eggplant was developed. PCR amplification and HinfI restriction were performed using specific primer pairs, and eggplant genomic DNA was detected by polyacrylamide gel electrophoresis, achieving rapid and accurate phenotypic identification.

Benefits of technology

It improves the accuracy of selecting green-shouldered eggplant varieties and increases breeding efficiency, while shortening the breeding cycle.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119320843B_ABST
    Figure CN119320843B_ABST
Patent Text Reader

Abstract

The application discloses a dCAPS molecular marker for identifying green shoulder of eggplant, wherein the nucleotide sequence of the dCAPS molecular marker is shown as SEQ ID NO. 1, and the Y at the 25th position of the sequence represents polymorphism, which is T or C. The molecular marker can be used for identifying and screening the green shoulder phenotype of eggplant, and can be used for quickly, accurately and effectively breeding the eggplant varieties with the green shoulder characteristics of eggplant, so that the crop breeding process is accelerated, and the efficiency and success rate of breeding are improved.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a dCAPS molecular marker for identifying green shoulder of eggplant and application thereof. BACKGROUND

[0002] Eggplant (Solanum melongena L., 2n = 24) is a Solanaceae vegetable with important economic and nutritional value, which originated in Asia and is cultivated all over the world. China is the largest eggplant producing country, with a planting area of 818,000 hectares and a yield of 38,319,000 tons in 2022, accounting for 43.23% and 64.60% of the global total (FAO, 2022), respectively. It is generally believed that China is the second origin and secondary evolution center of eggplant, with rich germplasm resources. In nature, most eggplant fruit peels are purple, green, white, etc., but eggplants with shoulder are not very common. Stripe patterns enhance the attractiveness of pollinators, which helps species diversity, and in production, they directly affect consumer preferences. The formation of eggplant shoulder is mainly due to the uneven distribution of anthocyanins, chlorophyll and carotenoids. Eggplant fruit appearance is a key commercial trait, so precise selection of excellent new varieties with unique appearance meets the current breeding goals.

[0003] The emergence of molecular markers provides a new breeding approach for eggplant, which helps to breed better varieties. The development of molecular markers that are co-segregated or tightly linked with target traits and are stable, convenient and fast to detect can greatly improve the accuracy and efficiency of selection in breeding, significantly shorten the breeding cycle, but the key is to develop efficient molecular markers, which is of great significance for eggplant variety improvement and new variety breeding.

[0004] The information disclosed in this BACKGROUND section is only for the purpose of increasing the understanding of the background of the present application and should not be taken as an acknowledgment or any form of suggestion that this information forms prior art with respect to the present application. SUMMARY

[0005] The purpose of the present application is to provide a dCAPS molecular marker for identifying green shoulder of eggplant and application thereof, which can quickly and accurately identify green shoulder of eggplant using the primer.

[0006] To achieve the above purpose, the present application provides a dCAPS molecular marker for identifying green shoulder of eggplant, the nucleotide sequence of the dCAPS molecular marker is shown as SEQ ID NO. 1, and the 25th Y of the sequence represents polymorphism, which is T or C.

[0007] The dCAPS molecular marker SEQ ID NO. 1 is as follows:

[0008] AACCTCCATCAATTGACAGTGAGTYGAAGGAATTACAACGTCATGAAATTACCAAAATACCCCCAACTTAATTTTATAATAATTTTAAGATATTTATTTTTCAAGGATTTTTTTGAATAAAACTTTTAAATTCAACGATATTTCTTGTACTTGATCTATATCTATAGATGAACTCAAATCATCTAAAGAAAAGGAATGG

[0009] A dCAPS molecular marker for identifying green shoulder of eggplant, wherein a 199bp band is amplified in eggplant genomic DNA using the dCAPS molecular marker primer pair, and wherein the amplified band of green shoulder variety is digested by HinfI to obtain a 174bp main band, and the amplified band of pure green fruit skin variety is digested by HinfI to obtain a 199bp main band.

[0010] The nucleotide sequence of the upstream primer of the dCAPS molecular marker primer pair is shown in SEQ ID NO. 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO. 3.

[0011] SEQ ID NO. 2, F: 5'-AACCTCCATCAATTGACAGTGAGT-3';

[0012] SEQ ID NO. 3, R: 5'-CCATTCCTTTTCTTTAGATGATTTG-3'.

[0013] The specific primer pair for detecting the dCAPS molecular marker of claim 1 or 2, wherein the nucleotide sequence of the upstream primer of the specific primer pair is shown in SEQ ID NO. 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO. 3.

[0014] The kit containing the specific primer pair described above.

[0015] Preferably, the kit contains HinfI enzyme in the above technical solution.

[0016] The application of the specific primer pair described above or the kit described above in identifying green shoulder of eggplant.

[0017] Preferably, the application of the dCAPS molecular marker for identifying green shoulder of eggplant includes:

[0018] (1) the application in identifying green shoulder of eggplant;

[0019] (2) The application in the molecular marker assisted breeding of green shoulder of eggplant.

[0020] A method for identifying green shoulder of eggplant, comprising the following steps:

[0021] (1) Taking the DNA of the eggplant material to be tested as a template, performing PCR amplification on the specific primer pair shown in SEQ ID NO. 2-3 to obtain a PCR product;

[0022] (2) Performing enzyme cutting on the PCR amplification product by HinfI enzyme, performing polyacrylamide gel electrophoresis on the enzyme cutting product, and observing the electrophoresis detection result.

[0023] Preferably, in the technical solution, the PCR reaction system in step (1) is as follows: 2 μL of DNA template liquid, 5 μL of 2×Taq Mix, 1 μL of forward primer and 1 μL of reverse primer, each with a concentration of 10 uM / L, and 3 μL of ddH2O is used to make up the total volume to 12 μL in a 12 μL reaction system.

[0024] The PCR amplification reaction program is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles; and 72℃ extension for 5 min.

[0025] The gel in step (2) is an 8% non-denaturing polyacrylamide gel.

[0026] The enzyme cutting reaction system is as follows: 1 μL of Hinf I, 2 μL of 10×H Buffer, and ≤1 μg of DNA, and the total volume is made up to 20 μL with ddH2O. The reaction condition is as follows: enzyme cutting at 37℃ for 1 h.

[0027] Preferably, in the technical solution, the judgment method of the electrophoresis detection result in step (2) is as follows:

[0028] After HinfI enzyme cutting, if the enzyme cutting product contains a 174 bp main band, it indicates that the eggplant sample to be tested is a green shoulder variety;

[0029] After HinfI enzyme cutting, if the enzyme cutting product contains a 199 bp main band, it indicates that the eggplant sample to be tested is a pure green fruit skin variety;

[0030] After HinfI enzyme cutting, if the enzyme cutting product contains two main bands of 199 bp and 174 bp, it indicates that the eggplant sample to be tested is a hybrid.

[0031] Compared with the prior art, the present application has the following beneficial effects: the dCAPS molecular marker primer for identifying green shoulder of eggplant and the application thereof, the dCAPS marker developed is screened for polymorphism by using the parents GS-01, WGS-02 and F1 thereof. After screening, it is found that the molecular marker GS-dCm4.02-2 has stable polymorphism between the parents, combined with the detection result of F1, it is judged that GS-dCm4.02-2 is a dominant marker, and the product amplified by the marker is clear after HinfI enzyme digestion, and the difference between the parents is obvious. According to the dCAPS molecular marker, the dCAPS molecular marker primer is designed, PCR amplification is carried out, the detection result is observed, and the green shoulder of eggplant is identified. The molecular marker of the present application can be used for the identification and screening of the green shoulder phenotype of eggplant, and the eggplant varieties with the characteristics of green shoulder of eggplant can be quickly, accurately and effectively selected, the crop breeding process is accelerated, and the efficiency and success rate of breeding are improved. BRIEF DESCRIPTION OF DRAWINGS

[0032] Figure 1 FIG. 1 is an electrophoretogram of the amplification product and the product after enzyme digestion of the dCAPS molecular marker primer according to the present application in the green shoulder eggplant inbred line GS-01, the pure green fruit skin eggplant inbred line WGS-02 and the F1 generation thereof; in the figure, P1 is GS-01; P2 is WGS-02; F1 is the hybrid generation of GS-01 and WGS-02.

[0033] Figure 2 FIG. 2 is an electrophoretogram of the verification result of the dCAPS molecular marker primer according to the present application in the detection of 22 eggplant germplasm materials with / without green shoulder phenotype of fruit skin. DETAILED DESCRIPTION

[0034] The specific embodiments of the present application are described in detail below with reference to the accompanying drawings, but it should be understood that the protection scope of the present application is not limited by the specific embodiments.

[0035] Unless otherwise clearly indicated otherwise, in the entire specification and claims, the term "comprise" or its variants such as "contain" or "include" and the like will be understood to include the stated element or component without excluding the other elements or components.

[0036] I. Obtaining of the molecular marker

[0037] 1. Construction of the mapping population

[0038] High generation inbred lines GS-01 and WGS-02 were selected as female (P1) and male (P2) parents, respectively, to construct genetic segregating populations (F1, BC1P1, BC1P2 and F2). GS-01 fruits are round with green shoulder, while WGS-02 fruits are long and strip with green peel. To identify the candidate gene of green shoulder in eggplant, we constructed F2 population (6,539 individuals) by self-pollination of F1 plants. High quality genomic DNA was isolated from leaves by CTAB method.

[0039] 2. Development of molecular markers

[0040] Based on the eggplant T2T genome assembled by our group, we fine-mapped the candidate gene Eggplant.04G07850 controlling green shoulder in eggplant. According to the BSA-seq results, we designed primers and performed PCR amplification on the stable variation sites on the sequence of Eggplant.04G07850, thereby developing dCAPS markers.

[0041] 3. Obtaining of molecular marker GS-dCm4.02-2

[0042] The dCAPS markers developed were screened for polymorphism using parents GS-01, WGS-02 and their F1. After screening, we found that molecular marker GS-dCm4.02-2 had stable polymorphism between parents, combined with the detection results of F1, we judged that GS-dCm4.02-2 was a dominant marker, and the product amplified by the marker was clear after Hinf I enzyme digestion, with obvious difference between parents. Figure 1 ) Figure P1 is GS-01; P2 is WGS-02; F1 is the hybrid generation of GS-01 and WGS-02.

[0043] Design of molecular marker GS-dCm4.02-2 primer pair:

[0044] SEQ ID NO. 2, F: 5'-AACCTCCATCAATTGACAGTGAGT-3';

[0045] SEQ ID NO. 3, R: 5'-CCATTCCTTTTCTTTAGATGATTTG-3'.

[0046] The PCR amplification product based on this primer pair is 199 bp, which is SEQ ID NO. 1, and the 25th position of the sequence is T / C, which is a polymorphic site. According to the recognition sequence 5'-GANTC-3' / 5'-CTNAG-3' of restriction enzyme Hinf I, if the SNP site is T, it cannot be cut; if the SNP site is C, it can be cut.

[0047] AsFigure 1 The results show that the product amplified by the molecular marker GS-dCm4.02-2 in the parents and their F1 is a 199bp fragment before HinfI enzyme digestion. After HinfI enzyme digestion, the product in the green shoulder eggplant inbred line GS-01 is a 174bp fragment, the product in the pure green fruit peel eggplant inbred line WGS-02 is a 199bp fragment, and the product in the F1 generation of the parent cross contains fragments of 199bp and 174bp.

[0048] The nucleotide sequence of the dCAPS is shown in SEQ ID NO. 1, wherein Y at position 25 represents a polymorphism, which is T or C.

[0049] AACCTCCATCAATTGACAGTGAGTYGAAGGAATTACAACGTCATGAAATTACCAAAATACCCCCAACTTAATTTTATAATAATTTTAAGATATTTATTTTTCAAGGATTTTTTTGAATAAAACTTTTAAATTCAACGATATTTCTTGTACTTGATCTATATCTATAGATGAACTCAAATCATCTAAAGAAAAGGAATGG

[0050] II. Application of the molecular marker GS-dCm4.02-2

[0051] 1. Test materials

[0052] The present application uses 7 green shoulder fruit peel and 15 pure green fruit peel eggplant germplasm to verify the molecular marker GS-IDm4.02-2. The germplasm materials used can be obtained from the College of Agriculture, Guangxi University.

[0053] 2. Test method

[0054] A method for identifying green shoulder eggplant, comprising the following steps:

[0055] (1) using the DNA of the eggplant material to be tested as a template, performing PCR amplification with the specific primer pair shown in SEQ ID NO. 2-3 to obtain a PCR product;

[0056] (2) performing enzyme digestion on the PCR amplification product with HinfI enzyme, performing polyacrylamide gel electrophoresis on the enzyme digestion product, and observing the electrophoresis detection results.

[0057] Specifically, the genotype of the above test materials is detected by using the molecular marker GS-dCm4.02-2, and the template is the genomic DNA of the above test materials.

[0058] PCR reaction system (12 μL): 2 μL of DNA template solution, 5 μL of 2* Taq Mix, 1 μL of forward primer and 1 μL of reverse primer, each with a concentration of 10 uM / L, and 3 μL of ddH2O to make up the total volume to 12 μL. PCR amplification reaction procedure: 94 ℃ pre-denaturation for 5 min; 94 ℃ denaturation for 30 s, 56 ℃ annealing for 30 s, 72 ℃ extension for 30 s, 30 cycles; 72 ℃ extension for 5 min.

[0059] Subsequently, the amplification product is subjected to 8% non-denaturing polyacrylamide gel electrophoresis, 1% silver nitrate staining for 5 min, color development with a sodium hydroxide and formaldehyde mixture, and finally observation and photography. When reading the band of the electrophoresis gel, the same band type as 'GS-01' is recorded as 'b', the same band type as 'WGS-02' is recorded as 'a', and the hybridization containing the band types of both parents is recorded as 'h'.

[0060] Enzymatic reaction system: 1 μL of Hinf I, 2 μL of 10*H Buffer, ≤1 μg of DNA, and ddH2O to make up the total volume to 20 μL. Reaction condition: enzyme cutting at 37 ℃ for 1 h.

[0061] 3. Test results

[0062] The electrophoresis results are shown in the table 2. Figure 2 Before Hinf I enzyme cutting, the PCR amplification product of the molecular marker GS-dCm4.02-2 in the 22 eggplant germplasms is a 199 bp fragment. After Hinf I enzyme cutting, the PCR amplification product of the molecular marker GS-dCm4.02-2 in the eggplant germplasms with green shoulder (1-7) contains a 174 bp fragment, and the PCR amplification product of the molecular marker GS-dCm4.02-2 in the eggplant germplasms with pure green skin (8-22) contains a 199 bp fragment, which is consistent with the phenotypic identification results of the tested materials (with / without) green shoulder.

[0063] The phenotypes and genotypes of the 22 eggplant germplasms with / without green shoulder are statistically analyzed, and the results are shown in the table 1.

[0064] Table 1 Phenotypes and genotypes of the 22 eggplant germplasms with / without green shoulder

[0065]

[0066]

[0067] The above results show that the molecular marker GS-dCm4.02-2 has strong specificity and can be used for the identification and screening of the phenotypes of eggplant with / without green shoulder.

[0068] The foregoing description of specific exemplary embodiments of the application has been presented for the purposes of illustration and description. It is not intended to be exhaustive or to limit the application to the precise forms disclosed, and obviously many modifications and variations are possible in light of the above teaching. It is intended that the scope of the application be limited not with this detailed description, but rather by the claims appended hereto.

Claims

1. A dCAPS molecular marker for identifying the green shoulder of eggplant, characterized in that, The nucleotide sequence of the dCAPS molecular marker is shown as SEQ ID NO. 1, and the Y at position 25 indicates polymorphism, which is T or C.

2. Use of a specific primer pair for detecting the dCAPS molecular marker of claim 1 or a kit containing the specific primer pair in identifying eggplant green shoulder varieties. The nucleotide sequence of the upstream primer of the specific primer pair is shown as SEQ ID NO. 2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.

3. The kit contains HinfI enzyme.

3. Use of the dCAPS molecular marker for identifying eggplant green shoulder according to claim 1, comprising: (1) use in identifying eggplant green shoulder; (2) use in eggplant green shoulder molecular marker assisted breeding.

4. A method of identifying green shoulders in eggplants, characterized by, Comprising the following steps: (1) using the DNA of the eggplant material to be tested as a template, performing PCR amplification with the specific primer pair shown as SEQ ID NO. 2-3 to obtain a PCR product; (2) performing enzyme digestion of the PCR amplification product with HinfI enzyme, performing polyacrylamide gel electrophoresis on the enzyme digestion product, and observing the electrophoresis detection result.

5. The method of claim 4, wherein, The PCR reaction system in step (1) is as follows: in a 12 μL reaction system, 2 μL of DNA template solution, 5 μL of 2×Taq Mix, 1 μL of forward primer and 1 μL of reverse primer, each at a concentration of 10 uM / L, and 3 μL of ddH2O to make up the total volume to 12 μL; The PCR amplification reaction program is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles; 72℃ extension for 5 min; The gel in step (2) is an 8% non-denaturing polyacrylamide gel; The enzyme digestion reaction system is as follows: Hinf I 1 μL, 10× H Buffer 2 μL, DNA ≤1 μg, and ddH2O to make up the total volume to 20 μL; the reaction conditions are as follows: enzyme digestion at 37℃ for 1 h.

6. The method of claim 4, wherein, The judgment method of the electrophoresis detection result in step (2) is as follows: After HinfI enzyme digestion, if the enzyme digestion product contains a 174 bp main band, it indicates that the eggplant sample to be tested is a green shoulder variety; After HinfI enzyme digestion, if the enzyme digestion product contains a 199 bp main band, it indicates that the eggplant sample to be tested is a pure green fruit skin variety; After HinfI enzyme digestion, if the enzyme digestion product contains 199 bp and 174 bp main bands, it indicates that the eggplant sample to be tested is a heterozygote.

Citation Information

Patent Citations

  • dCAPS molecular marker for identifying green fruit shoulders of tomatoes and application

    CN113215306A

  • SNP molecular marker and dCAPS molecular marker closely linked with eggplant pericarp color character and application of SNP molecular marker and dCAPS molecular marker

    CN115896331A