Streptococcus suis vaccine compositions comprising immunogenic fusion polypeptides

Abstract

The present disclosure relates to immunogenic fusion polypeptides, immunogenic compositions and vaccine compositions comprising said fusion polypeptides and their use for immunizing mammals susceptible to Streptococcus suis infection. The disclosure also relates to methods of making, formulating, and administering such compositions.

Description

Technical Field

[0001] The present disclosure relates to immunogenic polypeptides, immunogenic compositions and vaccine compositions and their use for immunization of mammals susceptible to infection by S. suis. The present disclosure also relates to methods of preparing, formulating and administering such compositions. Background Art

[0002] Streptococcus suis is the main pathogen causing bacterial diseases in pigs, causing huge economic losses to the pig industry. Streptococcus suis causes a variety of diseases in pigs, including meningitis, arthritis, pericarditis, polyserositis, sepsis, pneumonia and sudden death. In addition, it is also becoming a zoonotic pathogen for meningitis and streptococcal toxic shock syndrome, and Streptococcus suis (S.suis) human disease has a high prevalence in Southeast Asia and East Asia. However, some European countries, Australia, and North and South America have also reported human cases. In Western countries, Streptococcus suis infection is most often confined to people working in the pig industry, while in Southeast Asia and East Asia, Streptococcus suis infection is a major public health problem (Fittipaldi et al. (2012), Future Microbiol. [Future Microbiology] 7 (2); 259-279).

[0003] Streptococcus suis is a Gram-positive facultative anaerobic coccus, originally defined as Lancefield R, S, R / S or T groups. Later, a new typing system based on type-specific capsular polysaccharide antigens located in the cell wall was proposed. This resulted in a system of 35 serotypes (Rasmussen and Andresen (1998), Int. J. Syst. Bacteriol. [International Journal of Systematic Bacteriology] 48, 1063-1065) of which serotypes 2, 1, 9, 7 and 1 / 2 are the most prevalent. In particular, serotype 2 has been reported as a zoonotic pathogen.

[0004] The control of S. suis in swine herds is of great interest to the swine industry. Pigs may acquire S. suis through vertical and horizontal transmission, and colonized animals often harbor these bacteria in their tonsils. Although adult pigs are usually asymptomatic carriers, some piglets develop bacteremia, sepsis, and / or meningitis due to dissemination of the bacteria from the tonsils and / or other mucosal surfaces. This usually occurs when maternal antibodies decline around 4 weeks of age. To cause disease, the bacteria must breach the epithelial barrier, reach and survive in the blood, invade different organs, and cause severe inflammation. The actual early mechanisms that S. suis uses to colonize the host are not well understood, but several virulence factors have been proposed. The various S. suis virulence factors include: capsule, fibronectin / fibrinogen binding protein, serum opacity-like factor, and modifications of the cell wall lipoteichoic acid and peptidoglycan (Fittipaldi ibid.). Furthermore, different strains of the same serotype show great variation in the virulence factors shared between them (Berthelot-Herault et al. (2005) Can J Vet Res. [Canadian Journal of Veterinary Research] July;69(3):236-40; Quessy et al. (1995) Infect Immun. [Infection and Immunity] May;63(5):1975-9; Vecht et al. (1992) Infect Immun. [Infection and Immunity] February;60(2):550-6).

[0005] The development of vaccines has been focused on the above-mentioned virulence factors. For example, vaccine compositions comprising surface expressed proteins (such as Sao and hp0245) are described in TW 201412982, CN 104248754 and CN 102443053 and Li et al. (2011) FEMS Micro Letters [European Federation of Microbiological Societies Microbiology Express] 316: 115-122. So far, there is no vaccine with good effect against Streptococcus suis infection. In a recent study, the pan-surface group of Streptococcus suis was described, and 113 surface expressed proteins were identified (Gómez-Gascóna et al. (2012), Journal of Proteomics [Proteomics Magazine] October 22; 75 (18): 5654-66).

[0006] A common approach to making vaccines against bacterial diseases is to produce and test whole cell vaccine preparations. Strepsuis, an attenuated bacterial vaccine, is used to immunize healthy pigs against disease caused by S. suis serotype 2. In addition, vaccines containing Streptococcus mutants deficient in capsule expression and htpsA genes have been described in WO 0005378 and CN 103352015, respectively. However, it seems possible (Kebede et al. (1990), Vet. Microbiol. [Veterinary Microbiology] 22: 249-257) that the protection obtained with whole cell preparations is serotype specific. In addition, whole cell vaccines have other disadvantages. For example, adverse reactions at and around the injection site are common, and a large amount of non-specific protein is usually required to be administered compared to the amount of material actually responsible for inducing protection. The limited availability of effective vaccines is likely to be caused by the large number of existing serotypes, differences in virulence between strains, and the lack of understanding of the factors that contribute to virulence and protection. Protein Ide encoded by IgM-specific protease Ssuis It has been shown to induce protective activity when immunizing pigs (Seele et al. (2015) Vaccine, 33, 2207-2212). However, vaccines based on only one antigen may fail if the native proteins of the infectious S. suis strain mutate. WO2017005913 discloses a vaccine composition comprising the IgM-specific protease and a surface-anchored nucleotidase fragment.

[0007] The lack of an effective vaccine against S. suis infection is a major problem in modern pig production. Therefore, providing an effective and safe vaccine against S. suis infection has attracted great interest in the field. Summary of the invention

[0008] One object of the present disclosure is to provide an effective Streptococcus suis vaccine which overcomes the shortcomings of the prior art in terms of, for example, eliciting protection and cost-effectiveness.

[0009] One object of the present disclosure is to provide immunogenic polypeptides for use as medicaments, for example for the prophylactic treatment of S. suis infections.

[0010] Also provided are immunogenic polypeptide fragments and fusion polypeptides themselves.

[0011] Another object of the present invention is to provide related immunogenic compositions and vaccine compositions and related treatment methods.

[0012] Another object of the present invention is to provide an immunogenic mixture with adjuvant properties. Another object is to provide immunogenic compositions and vaccine compositions that can be used to treat piglets. In particular, immunogenic compositions and vaccine compositions for protecting piglets from Streptococcus suis infection, wherein the compositions are administered to pregnant sows or gilts.

[0013] These and other objects, which will be apparent to the skilled person from this disclosure, are achieved by the different aspects of the invention as claimed in the accompanying claims and as generally disclosed herein.

[0014] In short, the pan-surface group of S. suis has been described (Gómez-Gascóna supra). Gómez-Gascóna and colleagues obtained 39 S. suis strains from infected pigs, corresponding to the 19 most prevalent serotypes. They identified a group of 113 proteins corresponding to common and unique surface proteins in these strains and listed them as potential antigens for vaccine development. The inventors of the present invention have identified a subgroup of them that is particularly useful in the context of vaccines against S. suis infections. Therefore, the present disclosure is based on the following findings made by the inventors: recombinant variants in the form of fusion polypeptides comprising fragments of several different virulence factors are particularly useful in the context of prophylactic treatment of S. suis infections. In particular, the inventors have identified recombinant variants in the form of fusion polypeptides that contain unstructured (also called disordered) fragments and are particularly useful in the context. Without being bound by theory, it is envisioned that even if the bacterial strain acquires mutations in the natural protein subgroup on which the immunogenic composition and / or vaccine is based, the immunogenic composition and / or vaccine comprising fragments of several antigens is likely to be effective. Without being bound by theory, it is contemplated that in order to ensure the protective effect of the vaccine composition, for example, via inhibition of bacterial growth, it may be beneficial to induce antibodies against several native proteins (e.g., native proteins that may be involved in redundant systems that are important for bacterial function). As a non-limiting example, several zinc-binding proteins are present on the surface of Streptococcus suis, and therefore it may be beneficial to include several such proteins in the immunogenic composition or vaccine composition. In addition, it may be beneficial to include several different surface proteins in the immunogenic or vaccine composition to generate an antibody response. When the antibody binds to the bacterial surface, it marks the bacteria for stimulation by immune cells and the complement system. It is expected that certain surface proteins may be present in low amounts or only under specific conditions, and the availability of certain surface proteins may be limited. In addition, due to evolution, many surface proteins show mutations between different bacterial strains, which may limit the effect of a particular antibody to only certain strains. The inventors contemplate that including many proteins in the immunogenic or vaccine composition can overcome these potential obstacles.

[0015] In brief, below is a brief description of virulence factors, fragments of which have been used in the context of the present invention.

[0016] Proteases have been shown to be important virulence factors in many cases, but few have been tested as vaccine components. There are several reasons for this; proteases are difficult or almost impossible to express in active form, the size of the protease can cause problems, and they may also be unstable unless they are completely inactivated. The IgM-specific protease denoted IdeSsuis (Seele et al. (2013) Journal of Bacteriology, 195(5):930-940) is denoted M2 herein and corresponds to SEQ ID NO:9. Additional proteases used in the context of the present invention are P1, P8, P11 and IgdE, corresponding to SEQ ID NOs:6, 7, 8 and 10, respectively.

[0017] The proteins denoted SP2, SP4 and SP7 and corresponding to SEQ ID NOs: 11, 13 and 12, respectively, show homology to the nucleotidase family of proteins. The importance of nucleotidases to bacterial virulence has been shown in Streptococcus suis (Liu et al. (2014) The Journal of Infectious Diseases, Vol. 210, No. 1, pp. 35-45) and other bacteria.

[0018] Changes in the concentration of certain metal ions have a profound effect on cell physiology and gene expression. Recent studies have shown that zinc has an effect on bacterial physiology during infection. The zinc binding polypeptides utilized in the present disclosure are HtpS A (SEQ ID NO: 1), HtpS B (SEQ ID NO: 2), HtpS C (SEQ ID NO: 3), HtpS C2 (SEQ ID NO: 4), and AdcA (SEQ ID NO: 5).

[0019] Surface proteins of Gram-positive bacteria often play a role in bacterial adhesion to host tissues and are often required for virulence. A specific subset of extracellular proteins contains the cell wall sorting motif LPXTG, which is a target for cleavage and covalent coupling to peptidoglycan by enzymes called sortases. Proteins containing the LPXTG motif and used in the present invention are P6 (SEQ ID NO: 17), C5a (SEQ ID NO: 18) and Sao (SEQ ID NO: 19).

[0020] Other virulence factors of interest are Amid1Sa (SEQ ID NO: 14), 15BSa (SEQ ID NO: 15), and Hom17Sa (SEQ ID NO: 16).

[0021] In a first aspect of the present disclosure, an immunogenic composition is provided, the immunogenic composition comprising at least one first fusion polypeptide and a second fusion polypeptide, the first fusion polypeptide comprising fragments of at least three natural full-length polypeptides of Streptococcus suis. By providing an immunogenic composition comprising fusion polypeptides, each fusion polypeptide consisting of several different fragments derived from different natural full-length polypeptides of Streptococcus suis, the inventors have achieved successful vaccination of sows, which showed significant antibody responses. Importantly, the inventors also showed that antibodies were transferred to piglets via colostrum and resulted in a reduction in Streptococcus suis challenge symptoms in piglets after challenge at 4 weeks and 7 weeks of age, as discussed in the Examples section of the present application. As used herein, the term "piglet" refers to pigs aged 0-12 weeks, such as pigs aged 0-10 weeks. Therefore, the term "piglet" used herein covers what are commonly referred to as 0-4 week old piglets, 4-10 week old weaned piglets, and 10-12 week old early growing pigs.

[0022] In one embodiment, an immunogenic composition is provided, wherein the second fusion polypeptide comprises fragments of at least three native full-length polypeptides from Streptococcus suis.

[0023] As used herein, the term "fusion polypeptide" refers to a polypeptide comprising at least two, for example at least three units, which are derived from different natural polypeptides or proteins. As used herein, the wording "a fusion polypeptide comprises a fragment of at least three natural full-length polypeptides of Streptococcus suis" should be understood as each of the above-mentioned units being a fragment of a full-length natural polypeptide or protein (in other words, a part of a full-length natural polypeptide or protein). Therefore, the above-mentioned units of one or more fusion polypeptides disclosed herein are not full-length natural polypeptides, but parts thereof. In order to avoid any doubt, the term fragment therefore refers to a part of a full-length natural polypeptide. Therefore, the fusion polypeptide disclosed herein is not a fusion of several natural full-length polypeptides.

[0024] As an illustrative and non-limiting example, the fusion polypeptide may comprise the following: a fragment of a full-length native polypeptide A (in other words, a portion thereof); a fragment of a full-length native polypeptide B (in other words, a portion thereof); and a fragment of a full-length native polypeptide C (in other words, a portion thereof), wherein A, B and C are different full-length native polypeptides of Streptococcus suis.

[0025] The immunogenic composition may comprise additional fusion polypeptides. Thus, in one embodiment, the immunogenic composition further comprises a third fusion polypeptide. In another embodiment, the immunogenic composition may further comprise a fourth fusion polypeptide. In another embodiment, the immunogenic composition may further comprise a fifth fusion polypeptide.

[0026] For the sake of clarity, it should be understood that the names first, second, third, fourth and fifth associated with fusion polypeptides are merely intended to distinguish the fusion polypeptides from each other and are not limiting in terms of their presence in the composition or the order of addition to the composition. Thus, the compositions encompassed by the present disclosure may include three fusion polypeptides, such as represented by the first, second and fourth fusion polypeptides, or may include four fusion polypeptides, such as represented by the first, second, fourth and fifth fusion polypeptides.

[0027] In one embodiment, the third fusion polypeptide and / or the fourth fusion polypeptide and / or the fifth fusion polypeptide comprises fragments of at least three native full-length polypeptides from Streptococcus suis.

[0028] As discussed above, the inventors of the present invention have found that fusion polypeptides comprising fragments of virulence factors are particularly useful in the context of the present disclosure, such fragments being, for example, fragments of zinc-binding proteins from Streptococcus suis; fragments of proteases from Streptococcus suis, fragments of nucleotidase from Streptococcus suis, or fragments of proteins comprising the LPXTG motif from Streptococcus suis. Fragments of other virulence factors, such as Amid1Sa, 15BSa, and Hom17Sa are also suitable.

[0029] Therefore, in one embodiment, an immunogenic composition is provided, wherein the at least three native full-length polypeptides from Streptococcus suis are independently selected or selected from the group consisting of: a zinc-binding protein from Streptococcus suis; a protease from Streptococcus suis; a nucleotidase from Streptococcus suis; a protein from Streptococcus suis containing a LPXTG motif; Amid1Sa (SEQ ID NO: 14) and any polypeptide having at least 80% identity with SEQ ID NO: 14; 15BSa (SEQ ID NO: 15) and any polypeptide having at least 80% identity with SEQ ID NO: 15; and Hom17Sa (SEQ ID NO: 16) and any polypeptide having at least 80% identity with SEQ ID NO: 16.

[0030] As used herein, the phrase "independently selected" with respect to a group of specified items means that when more than one item is selected from the group of items, the decision to select a particular item is not affected by the decision to select any one or more preceding or following items.

[0031] As the skilled artisan will appreciate, the properties of a polypeptide (e.g., the immunogenicity of a polypeptide of the present disclosure) can depend on the sequence structure of the polypeptide and the presence and accessibility of immunogenic regions within the polypeptide. Thus, it is possible to make minor changes to the amino acid sequence in a polypeptide without affecting its function. Thus, the present disclosure encompasses modified variants of the immunogenic polypeptides described herein that retain immunogenic characteristics.

[0032] Thus, in some embodiments, the polypeptide may comprise a sequence that is at least 81%, such as at least 82%, such as at least 83%, such as at least 84%, such as at least 85%, such as at least 86%, such as at least 87%, such as at least 88%, such as at least 89%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 93%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98% or at least 99% identical to a sequence selected from any one of SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 16.

[0033] For example, it is possible that one or several amino acid residues belonging to a particular functional classification of amino acid residues (e.g., hydrophobic, hydrophilic, polar, etc.) can be exchanged for another amino acid residue from the same functional group. It is also possible that one or several amino acid residues can be exchanged for one or several amino acid residues belonging to a different functional group, provided that the resulting polypeptide retains its immunogenic properties.

[0034] The term "identity %" as used throughout the specification can be calculated, for example, as follows. The query sequence is aligned with the target sequence using the CLUSTAL W algorithm (Thompson et al., Nucleic Acids Research, 22: 4673-4680 (1994)). Comparison is made in a window corresponding to the shortest aligned sequence. In some cases, the shortest of the aligned sequences may be the target sequence. In other cases, the query sequence may constitute the shortest aligned sequence. The amino acid residues at each position are compared, and the percentage of positions in the query sequence that have the same correspondence with the target sequence is reported as the identity %.

[0035] For clarification, the text above relating to % identity is equally relevant to the second aspect of the disclosure and will not be repeated for the sake of brevity.

[0036] In one embodiment, the at least three native full-length polypeptides from Streptococcus suis are independently selected or selected from the group consisting of: a zinc binding protein from Streptococcus suis, a protease from Streptococcus suis; a nucleotidase from Streptococcus suis and a protein from Streptococcus suis comprising a LPXTG motif (SEQ ID NO: 102).

[0037] Therefore, the immunogenic composition according to the present disclosure may comprise a first fusion polypeptide, a second fusion polypeptide, a third fusion polypeptide, a fourth fusion polypeptide and / or a fifth fusion polypeptide, which fusion polypeptides comprise at least three full-length polypeptide fragments. The fragment may be selected from the following: a fragment of a zinc-binding protein from Streptococcus suis; a fragment of a protease from Streptococcus suis; a fragment of a nucleotidase from Streptococcus suis; a protein fragment comprising an LPXTG motif from Streptococcus suis; and / or a fragment of Amid1Sa (SEQ ID NO: 14), 15BSa (SEQ ID NO: 15) and Hom17Sa (SEQ ID NO: 16). In one embodiment, the first fusion polypeptide comprises at least three fragments selected from the following: a fragment of a zinc-binding protein from Streptococcus suis; a fragment of a protease from Streptococcus suis; a fragment of a nucleotidase from Streptococcus suis or a protein fragment comprising an LPXTG motif from Streptococcus suis. In one embodiment, the second fusion polypeptide comprises at least three fragments selected from the following: a fragment of a zinc-binding protein from Streptococcus suis; a fragment of a protease from Streptococcus suis; a fragment of a nucleotidase from Streptococcus suis or a protein fragment containing an LPXTG motif from Streptococcus suis. In one embodiment, the third fusion polypeptide comprises at least three fragments selected from the following: a fragment of a zinc-binding protein from Streptococcus suis; a fragment of a protease from Streptococcus suis; a fragment of a nucleotidase from Streptococcus suis or a protein fragment containing an LPXTG motif from Streptococcus suis. In one embodiment, the fourth fusion polypeptide comprises at least three fragments selected from the following: a fragment of a zinc-binding protein from Streptococcus suis; a fragment of a protease from Streptococcus suis; a fragment of a nucleotidase from Streptococcus suis or a protein fragment containing an LPXTG motif from Streptococcus suis. In one embodiment, the fifth fusion polypeptide comprises at least three fragments selected from the following: a fragment of a zinc-binding protein from Streptococcus suis; a fragment of a protease from Streptococcus suis; a fragment of a nucleotidase from Streptococcus suis or a protein fragment containing a LPXTG motif from Streptococcus suis. Specifically, at least two of the first, second, third, fourth and fifth fusion polypeptides may comprise a fragment of a zinc-binding protein from Streptococcus suis.

[0038] In a specific embodiment, the zinc binding protein, protease, nucleotidase, protein containing LPXTG motif and other virulence factors can be selected from the group consisting of: Htps A, Htps B, Htps C, Htps C2, AdcA, P1, P8, P11, M2, IdgE, SP2, SP7, SP4, P6, C5a, Sao, Amid1Sa, 15BSa and Hom17Sa (corresponding to SEQ ID NO: 1-19, respectively). More specifically, in one embodiment, an immunogenic composition as disclosed herein is provided, wherein the at least three natural full-length polypeptides from Streptococcus suis are independently selected or selected from the group consisting of: a polypeptide having an amino acid sequence according to any one of SEQ ID NO: 1-19 and any polypeptide having at least 80% identity with any one of SEQ ID NO: 1-19; for example, selected from the group consisting of: a polypeptide having an amino acid sequence according to any one of SEQ ID NO: 1-19. In some embodiments, the polypeptide may comprise a sequence that is at least 81%, such as at least 82%, such as at least 83%, such as at least 84%, such as at least 85%, such as at least 86%, such as at least 87%, such as at least 88%, such as at least 89%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 93%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, or such as at least 99% identical to any one of SEQ ID NOs: 1-19.

[0039] In particular, the at least three natural full-length polypeptides from Streptococcus suis can be independently selected or selected from the group consisting of: a polypeptide having an amino acid sequence according to any one of SEQ ID NOs: 1-12 and 17-19 and a polypeptide having at least 80% identity with any one of SEQ ID NOs: 1-12 and 17-19; for example, selected from the group consisting of: a polypeptide having an amino acid sequence according to any one of SEQ ID NOs: 1-12 and 17-19. In some embodiments, the polypeptide may comprise a sequence that is at least 81%, such as at least 82%, such as at least 83%, such as at least 84%, such as at least 85%, such as at least 86%, such as at least 87%, such as at least 88%, such as at least 89%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 93%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, or such as at least 99% identical to any one of SEQ ID NOs: 1-12 and 17-19.

[0040] In particular, the at least three natural full-length polypeptides from Streptococcus suis can be independently selected or selected from the group consisting of: a polypeptide having an amino acid sequence according to any one of SEQ ID NOs: 1-10 and 14-19 and a polypeptide having at least 80% identity with any one of SEQ ID NOs: 1-10 and 14-19; for example, selected from the group consisting of: a polypeptide having an amino acid sequence according to any one of SEQ ID NOs: 1-10 and 14-19. In some embodiments, the polypeptide may comprise a sequence that is at least 81%, such as at least 82%, such as at least 83%, such as at least 84%, such as at least 85%, such as at least 86%, such as at least 87%, such as at least 88%, such as at least 89%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 93%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, or such as at least 99% identical to any one of SEQ ID NOs: 1-10 and 14-19.

[0041] In particular, the at least three natural full-length polypeptides from Streptococcus suis can be independently selected or selected from the group consisting of: a polypeptide having an amino acid sequence according to any one of SEQ ID NOs: 1-13 and 17-19 and a polypeptide having at least 80% identity with any one of SEQ ID NOs: 1-13 and 17-19; for example, selected from the group consisting of: a polypeptide having an amino acid sequence according to any one of SEQ ID NOs: 1-13 and 17-19. In some embodiments, the polypeptide may comprise a sequence that is at least 81%, such as at least 82%, such as at least 83%, such as at least 84%, such as at least 85%, such as at least 86%, such as at least 87%, such as at least 88%, such as at least 89%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 93%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, or such as at least 99% identical to any one of SEQ ID NOs: 1-13 and 17-19.

[0042] It should be understood that one of the fusion polypeptides contained in the immunogenic composition as disclosed herein may comprise at least three fragments of zinc binding proteins, at least three fragments of proteases, or at least three fragments of nucleotidases and fragments of polypeptides exhibiting at least 80% identity therewith. It should be understood that one of the fusion polypeptides may be designated as the first, second, third, fourth or fifth polypeptide as described above. Therefore, in one embodiment, an immunogenic composition as disclosed herein is provided, wherein the first fusion polypeptide comprises at least three fragments selected from the group consisting of: a zinc-binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 1-5; a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 6-10; a nucleotidase having an amino acid sequence according to any one of SEQ ID NOs: 11-13 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 11-13; or a protein comprising a LPXTG motif according to any one of SEQ ID NOs: 17-19 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 17-19. In one embodiment, an immunogenic composition as disclosed herein is provided, wherein the second fusion polypeptide comprises at least three fragments selected from the group consisting of: a zinc-binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 1-5; a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 6-10; a nucleotidase having an amino acid sequence according to any one of SEQ ID NOs: 11-13 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 11-13, or a protein comprising a LPXTG motif according to any one of SEQ ID NOs: 17-19 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 17-19.

[0043] In one embodiment, an immunogenic composition as disclosed herein is provided, wherein the third fusion polypeptide comprises at least three fragments selected from the following: a zinc-binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 1-5; a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 6-10; a nucleotidase having an amino acid sequence according to any one of SEQ ID NOs: 11-13 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 11-13, or a protein comprising a LPXTG motif according to any one of SEQ ID NOs: 17-19 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 17-19.

[0044] In one embodiment, an immunogenic composition as disclosed herein is provided, wherein the fourth fusion polypeptide comprises at least three fragments selected from the following: a zinc-binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 1-5; a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 6-10; a nucleotidase having an amino acid sequence according to any one of SEQ ID NOs: 11-13 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 11-13; or a protein comprising a LPXTG motif according to any one of SEQ ID NOs: 17-19 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 17-19.

[0045] In one embodiment, an immunogenic composition as disclosed herein is provided, wherein the fifth fusion polypeptide comprises at least three fragments selected from the following: a zinc-binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 1-5; a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 6-10; a nucleotidase having an amino acid sequence according to any one of SEQ ID NOs: 11-13 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 11-13, or a protein comprising a LPXTG motif according to any one of SEQ ID NOs: 17-19 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 17-19.

[0046] Also encompassed are polypeptides that exhibit at least 80% identity to the zinc-binding protein, protease, nucleotidase, or protein comprising the LPXTG motif. Thus, fragments may be derived from such polypeptides. In one embodiment, the zinc-binding protein, protease, nucleotidase, and protein comprising the LPXTG motif may comprise a sequence that is at least 81%, such as at least 82%, such as at least 83%, such as at least 84%, such as at least 85%, such as at least 86%, such as at least 87%, such as at least 88%, such as at least 89%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 93%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, or at least 99% identical to the zinc-binding protein, protease, nucleotidase, and protein comprising the LPXTG motif. The skilled person will appreciate that the percent identity feature may apply to any of the first, second, third, fourth, or fifth polypeptides discussed above. It should be understood that the above description of % identity levels is equally applicable to any embodiment of the first and second aspects in which the % identity feature is described. For the sake of brevity, it will not be repeated each time.

[0047] To illustrate by way of non-limiting example, the immunogenic composition may comprise the following: a first fusion polypeptide comprising fragments of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3; a second fusion polypeptide comprising fragments of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10; a third fusion polypeptide comprising fragments of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5; a fourth fusion polypeptide comprising fragments of SEQ ID NO: 11, SEQ ID NO: 12, and SEQ ID NO: 13; and a fifth fusion polypeptide comprising fragments of SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 19. One or more of the first, second, third, fourth, or fifth fusion polypeptides may comprise additional fragments from polypeptides, such as fragments from one or more of SEQ ID NOs: 14, 15, and 16. For example, the third fusion polypeptide may comprise a fragment of one, two or three of SEQ ID NOs: 14, 15 and 16. For example, the third fusion polypeptide may comprise a fragment of SEQ ID NOs: 14 and 15; or a fragment of SEQ ID NOs: 14 and 16; or a fragment of SEQ ID NOs: 15 and 16. Thus, it is understood that any of the first, second, third, fourth and fifth polypeptides may comprise additional fragments from other virulence factors, for example, a fragment of any of SEQ ID NOs: 14, SEQ ID NOs: 15 and SEQ ID NOs: 16, or a polypeptide having at least 80% identity to any of SEQ ID NOs: 14-16.

[0048] In one embodiment, the first and second and optionally the third, fourth and / or fifth fusion polypeptides comprise different fragments. In one embodiment, the first and second and optionally the third, fourth and / or fifth fusion polypeptides comprise fragments of different native polypeptides from Streptococcus suis.

[0049] In a specific embodiment, the first fusion polypeptide comprises at least three fragments selected from the group consisting of: a fragment of a zinc binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5; a fragment of a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10; a fragment of a nucleotidase having an amino acid sequence according to any one of SEQ ID NOs: 11-13; and a protein from Streptococcus suis having an amino acid sequence according to any one of SEQ ID NOs: 17-19 comprising a LPXTG motif. In a specific embodiment, the second fusion polypeptide comprises at least three fragments selected from the group consisting of: a fragment of a zinc binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5; a fragment of a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10; a fragment of a nucleotidase having an amino acid sequence according to any one of SEQ ID NOs: 11-13; and a protein from Streptococcus suis having an amino acid sequence according to any one of SEQ ID NOs: 17-19 comprising a LPXTG motif. In one embodiment, the third fusion polypeptide comprises at least three fragments selected from the group consisting of: a fragment of a zinc binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5; a fragment of a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10; a fragment of a nucleotidase having an amino acid sequence according to any one of SEQ ID NOs: 11-13, and a protein from Streptococcus suis having an amino acid sequence according to any one of SEQ ID NOs: 17-19 comprising a LPXTG motif. In one embodiment, the fourth fusion polypeptide comprises at least three fragments selected from the group consisting of: a fragment of a zinc binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5; a fragment of a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10; a fragment of a nucleotidase having an amino acid sequence according to any one of SEQ ID NOs: 11-13; and a protein from Streptococcus suis having an amino acid sequence according to any one of SEQ ID NOs: 17-19 comprising a LPXTG motif. In one embodiment, the fifth fusion polypeptide comprises at least three fragments selected from the following: a fragment of a zinc binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5; a fragment of a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10; a fragment of a nucleotidase having an amino acid sequence according to any one of SEQ ID NOs: 11-13; and a protein from Streptococcus suis comprising a LPXTG motif having an amino acid sequence according to any one of SEQ ID NOs: 17-19.In one embodiment, the first, second, third, fourth and fifth fusion polypeptides do not comprise identical fragments. In one embodiment, the first, second, and optionally third, fourth and fifth fusion polypeptides comprise at least three fragments selected from the group consisting of a fragment of a zinc binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5; or a fragment of a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10; or a fragment of a nucleotidase having an amino acid sequence according to any one of SEQ ID NOs: 11-13; or a protein comprising a LPXTG motif having an amino acid sequence according to any one of SEQ ID NOs: 17-19.

[0050] To express this, in other words, the immunogenic composition disclosed herein can be such that each of the first, second, third, fourth and fifth fusion polypeptides comprises a fragment independently selected or selected from the following: a zinc binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 1-5; or a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 6-10; or a nucleotidase having an amino acid sequence according to any one of SEQ ID NOs: 11-13 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 11-13; or a protein comprising a LPXTG motif having an amino acid sequence according to any one of SEQ ID NOs: 17-19. In particular, the fragments may be independently selected or selected from the following: a fragment of a zinc binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5; or a fragment of a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10; or a fragment of a nucleotidase having an amino acid sequence according to any one of SEQ ID NOs: 11-13; or a protein comprising a LPXTG motif having an amino acid sequence according to any one of SEQ ID NOs: 17-19. In one embodiment, the first, second, third, fourth and fifth fusion polypeptides do not comprise the same fragment.

[0051] As shown in the above non-limiting examples, it is contemplated that the immunogenic compositions disclosed herein may include several fusion polypeptides comprising fragments of the same native full-length polypeptide from Streptococcus suis. For example, the fusion polypeptide may include different fragments from the same native full-length polypeptide. Alternatively, the fusion polypeptide may include a combination of the same fragment and fragments from different virulence factors. For example, the fusion polypeptide represented as 4Zn+3 (SEQ ID NO: 44) comprises five fragments of zinc-binding polypeptides. In addition, the fusion polypeptide further comprises three fragments of other virulence factors.

[0052] It is contemplated that in some embodiments, the fusion polypeptide may comprise more than one fragment from the same native full-length polypeptide, the fragments being identical or different. For example, two identical fragments may be present in the fusion polypeptide, or two different fragments (non-overlapping or partially overlapping) may be present in the fusion polypeptide, the fragments being derived from the same native full-length polypeptide. A non-limiting example of a fusion polypeptide comprising two fragments of the same native polypeptide is 5AsL (SEQ ID NO: 45), which comprises two different fragments of the M2 protein (SEQ ID NO: 9).

[0053] In one embodiment, an immunogenic composition as disclosed herein is provided, wherein at least one of the first, second, third, fourth and fifth fusion polypeptides comprises at least three or at least four or at least five fragments of a zinc-binding protein from Streptococcus suis, such as at least three fragments of different zinc-binding proteins from Streptococcus suis. In a specific embodiment, at least one of the first, second, third, fourth and fifth fusion polypeptides comprises a zinc-binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5 and at least three or at least four or at least five fragments of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 1-5, such as at least three or at least four or at least five fragments of a zinc-binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5. In one embodiment, at least one of the first, second, third, fourth and fifth fusion polypeptides comprises a zinc-binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-4 and at least three or at least four fragments of a polypeptide having at least 80% identity to any one of SEQ ID NOs: 1-4, such as at least three fragments of a zinc-binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-4. In one embodiment, at least one of the first, second, third, fourth and fifth fusion polypeptides comprises a zinc-binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-3 and at least three fragments of a polypeptide having at least 80% identity to any one of SEQ ID NOs: 1-3, such as at least three fragments of a zinc-binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-3.

[0054] In one embodiment, an immunogenic composition as disclosed herein is provided, wherein at least one of the first, second, third, fourth and fifth fusion polypeptides comprises at least three fragments of a protease from Streptococcus suis, such as at least three fragments of different proteases from Streptococcus suis. In particular, at least one of the first, second, third, fourth and fifth fusion polypeptides may comprise a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10 and at least three fragments of a polypeptide having at least 80% identity with any one of the amino acid sequences, such as at least three fragments of a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10. In one embodiment, the first, second, third, fourth and fifth fusion polypeptides may comprise at least four, such as at least five, such as at least six fragments of the protease.

[0055] In one embodiment, an immunogenic composition as disclosed herein is provided, wherein at least one of the first, second, third, fourth and fifth fusion polypeptides comprises at least three fragments of a nucleotidase protein from Streptococcus suis, such as at least three fragments of different nucleotidases from Streptococcus suis. In particular, at least one of the first, second, third, fourth and fifth fusion polypeptides may comprise a nucleotidase having an amino acid sequence according to any one of SEQ ID NOs: 11-13 and at least three fragments of a polypeptide having at least 80% identity with any one of the amino acid sequences, such as at least three fragments of a nucleotidase having an amino acid sequence according to any one of SEQ ID NOs: 11-13.

[0056] In one embodiment, an immunogenic composition as disclosed herein is provided, wherein at least one of the first, second, third, fourth and fifth fusion polypeptides comprises at least three fragments of a protein from Streptococcus suis comprising a LPXTG motif, such as at least three fragments of different proteins obtained from a protein from Streptococcus suis comprising a LPXTG motif. In particular, the at least one of the first, second, third, fourth and fifth fusion polypeptides may comprise a protein from Streptococcus suis comprising a LPXTG motif having an amino acid sequence according to any one of SEQ ID NOs: 17-19 and at least three fragments of a polypeptide having at least 80% identity to any of the amino acid sequences, such as at least three fragments of a protein from Streptococcus suis comprising a LPXTG motif having an amino acid sequence according to any one of SEQ ID NOs: 17-19.

[0057] As explained above, it is envisaged that the fusion polypeptides comprised in the immunogenic compositions as disclosed herein may comprise further fragments of virulence factors or other suitable factors as in any one of SEQ ID NOs: 1 to 19. In a particular embodiment, said at least one of said first, second, third, fourth and fifth fusion polypeptides further comprises at least one fragment, such as at least two fragments, such as at least three fragments, of at least one native full-length polypeptide having an amino acid sequence according to any one of SEQ ID NOs: 1 to 19 or any amino acid sequence having at least 80% identity with any one of SEQ ID NOs: 1 to 19.

[0058] In a specific embodiment, at least one of the first, second, third, fourth and fifth fusion polypeptides further comprises a fragment of at least one native full-length polypeptide having an amino acid sequence according to any one of SEQ ID NOs: 14-16, or any amino acid sequence with at least 80% identity to any one of SEQ ID NOs: 14-16; for example, a fragment of each of at least two native full-length polypeptides having an amino acid sequence according to any one of SEQ ID NOs: 14-16, or any amino acid sequence with at least 80% identity to any one of SEQ ID NOs: 14-16; for example, a fragment of each of all three native full-length polypeptides having an amino acid sequence according to any one of SEQ ID NOs: 14-16, or any amino acid sequence with at least 80% identity to any one of SEQ ID NOs: 14-16.

[0059] In one embodiment, at least one of the first, second, third, fourth and fifth fusion polypeptides further comprises a fragment of at least one native full-length polypeptide having an amino acid sequence according to any one of SEQ ID NOs: 14-16, such as a fragment of each of at least two native full-length polypeptides having an amino acid sequence according to any one of SEQ ID NOs: 14-16; for example, a fragment of each of all three native full-length polypeptides having an amino acid sequence according to any one of SEQ ID NOs: 14-16. For example, the fusion polypeptide may further comprise a fragment of SEQ ID NOs: 14 and 15; or a fragment of SEQ ID NOs: 14 and 16; or a fragment of SEQ ID NOs: 15 and 16.

[0060] In some embodiments, an immunogenic composition as disclosed herein is provided, wherein at least one of the first, second, third, fourth and fifth fusion polypeptides comprises at least two fragments of the same natural full-length polypeptide from Streptococcus suis, and wherein the fragments are different fragments of the same natural full-length polypeptide from Streptococcus suis. An example of such a fusion polypeptide is SEQ ID NO:45, which comprises two different fragments of SEQ ID NO:9, corresponding to the full-length M2 protein. Therefore, in one embodiment, the natural full-length polypeptide from Streptococcus suis is a protease from Streptococcus suis or a zinc-binding protein from Streptococcus suis. The fragments may be identical fragments that appear more than once in the fusion polypeptide, or fragments that exhibit at least 90%, such as at least 95%, such as at least 97% or higher identity to each other. Alternatively, the fragments may be different fragments of the same natural polypeptide, such as fragments that exhibit less than 10% identity to each other.

[0061] In a specific embodiment, the native full-length polypeptide is SEQ ID NO:9 or any amino acid sequence that is at least 80% identical to SEQ ID NO:9, such as wherein the native full-length polypeptide is SEQ ID NO:9.

[0062] In one embodiment of the immunogenic composition provided herein, at least two of the first, second, third, fourth and fifth fusion polypeptides comprise at least one fragment of the same natural full-length polypeptide from Streptococcus suis (such as the same two natural full-length polypeptides from Streptococcus suis, such as the same three natural full-length polypeptides from Streptococcus suis); and wherein these fragments are different fragments of the same natural full-length polypeptide from Streptococcus suis. For example, the fusion polypeptides according to SEQ ID NO:43 and SEQ ID NO:44 both comprise fragments of natural full-length polypeptides according to SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3. As described above, SEQ ID NO:1, 2 and 3 are zinc-binding proteins. Therefore, in one embodiment, the natural full-length polypeptide from Streptococcus suis is a zinc-binding protein from Streptococcus suis. In one embodiment, the natural full-length polypeptide from Streptococcus suis is a zinc-binding protein from Streptococcus suis.

[0063] It should be understood that the immunogenic compositions disclosed herein may comprise more than two fusion polypeptides. Without being bound by theory, as the total number of different antigens and / or immunogenic fragments included in the composition increases, it may be advantageous to have several fusion polypeptides in the composition. Although it is possible to include more fragments into fewer fusion polypeptides, it is preferred to maintain a balance between the number of fusion polypeptides and their lengths. For example, very long polypeptides may be more difficult to produce, while on the other hand, compositions comprising many small fragments may also be difficult to produce.

[0064] Therefore, in one embodiment, there is provided an immunogenic composition as disclosed herein, comprising three, four or five fusion polypeptides. The composition may comprise the first, second and third fusion polypeptides as defined herein; or the first, second and fourth fusion polypeptides as defined herein; or the first, second, third and fourth fusion polypeptides as defined herein. The composition may comprise the first, second, third and fourth fusion polypeptides; or the first, second, third and fifth fusion polypeptides; or the first, second, fourth and fifth fusion polypeptides; or the first, third, fourth and fifth fusion polypeptides; or the second, third, fourth and fifth fusion polypeptides. The composition may comprise all five of the first, second, third, fourth and fifth fusion polypeptides.

[0065] As explained above, the names first, second, third, fourth and fifth associated with the fusion polypeptides are merely for distinguishing the fusion polypeptides from each other and are not limiting in terms of their presence in the composition or the order of addition to the composition.

[0066] In one embodiment, the immunogenic composition comprises a fusion polypeptide having a length of less than 1000 amino acids, such as less than 800 amino acids, such as less than 600 amino acids. In particular, at least two or at least three fusion polypeptides may be less than 800 amino acids long, such as less than 600 amino acids long.

[0067] In one embodiment of the immunogenic composition provided herein, the fragment of the zinc-binding polypeptide is selected from the group consisting of: fragments of the amino acid sequence SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and any amino acid sequence having at least 80% identity thereto, such as the group consisting of: fragments of the amino acid sequence SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and any amino acid sequence having at least 80% identity thereto, such as the group consisting of: fragments of the amino acid sequence SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and any amino acid sequence having at least 80% identity thereto.

[0068] In particular, the fragment of the zinc-binding protein may be selected from the group consisting of: a polypeptide fragment comprising an amino acid sequence of SEQ ID NOs: 20-27 and any amino acid sequence having at least 80% identity with any one of SEQ ID NOs: 20-27 or consisting of them, such as selected from the group consisting of: a polypeptide fragment comprising an amino acid sequence of SEQ ID NOs: 20-27 or consisting of them. In particular, the fragment of the zinc-binding protein may be selected from the group consisting of: a polypeptide fragment comprising an amino acid sequence of SEQ ID NOs: 20, 21, 22, 23, 24, 25, 26 and 27 and any amino acid sequence having at least 80% identity with any one of SEQ ID NOs: 20, 21, 22, 23, 24, 25, 26 and 27 or consisting of them, such as selected from the group consisting of: a polypeptide fragment comprising an amino acid sequence of SEQ ID NOs: 20, 21, 22, 23, 24, 25, 26 and 27 or consisting of them.

[0069] In one embodiment, the fragment of the protease is selected from the group consisting of: fragments of the amino acid sequences SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, and any amino acid sequence having at least 80% identity with the fragment. In particular, the fragment of the protease can be selected from the group consisting of: an amino acid sequence comprising SEQ ID NO: 28-33, and any amino acid sequence having at least 80% identity with any one of SEQ ID NO: 28-33, or a polypeptide fragment consisting of them, such as a polypeptide fragment comprising an amino acid sequence comprising SEQ ID NO: 28-33 or consisting of them.

[0070] In particular, the fragment of the protease can be selected from the group consisting of: comprising the amino acid sequence of SEQ ID NO: 28, 29, 30, 31, 32 and 33 and any amino acid sequence having at least 80% identity with any one of SEQ ID NO: 28, 29, 30, 31, 32 and 33 or polypeptide fragments consisting of them, such as selected from the group consisting of: comprising the amino acid sequence of SEQ ID NO: 28, 29, 30, 31, 32 and 33 or polypeptide fragments consisting of them.

[0071] In one embodiment, the fragment of the nucleotidase is selected from the group consisting of: fragments of the amino acid sequences SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13 and any amino acid sequence having at least 80% identity with the fragments. In particular, the fragment of the nucleotidase may be selected from the group consisting of: a polypeptide fragment comprising an amino acid sequence of SEQ ID NO: 34-36 and any amino acid sequence having at least 80% identity with any one of SEQ ID NO: 34-36 or consisting of them, such as selected from the group consisting of: a polypeptide fragment comprising an amino acid sequence of SEQ ID NO: 34-36 or consisting of them. In particular, the fragment of the nucleotidase may be selected from the group consisting of: a polypeptide fragment comprising an amino acid sequence of SEQ ID NO: 34, 35 and 36 and any amino acid sequence having at least 80% identity with any one of SEQ ID NO: 34, 35 and 36 or consisting of them, such as selected from the group consisting of: a polypeptide fragment comprising an amino acid sequence of SEQ ID NO: 34, 35 and 36 or consisting of them.

[0072] In one embodiment, the fragment of the protein comprising the LPXTG motif is selected from the group consisting of: a fragment comprising the amino acid sequence SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19 or consisting thereof, and any amino acid sequence having at least 80% identity with the fragment.

[0073] In particular, the fragment of the protein comprising the LPXTG motif can be selected from the group consisting of: an amino acid sequence comprising SEQ ID NO:40-42 and any amino acid sequence having at least 80% identity with any one of SEQ ID NO:40-42 or a polypeptide fragment consisting of them, such as selected from the group consisting of: an amino acid sequence comprising SEQ ID NO:40-42 or a polypeptide fragment consisting of them.

[0074] In particular, the fragment of the protein comprising the LPXTG motif can be selected from the group consisting of: a polypeptide fragment comprising the amino acid sequences of SEQ ID NOs: 40, 41 and 42 and any amino acid sequence having at least 80% identity with any one of SEQ ID NOs: 40, 41 and 42 or consisting of them, such as selected from the group consisting of: a polypeptide fragment comprising the amino acid sequences of SEQ ID NOs: 40, 41 and 42 or consisting of them.

[0075] In one embodiment, the fragment is selected from the group consisting of: fragments of the amino acid sequences SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 and any amino acid sequence having at least 80% identity with the fragment. In particular, the fragment may be selected from the group consisting of: SEQ ID NO: 37-39 and any amino acid sequence having at least 80% identity with any one of SEQ ID NO: 37-39, such as the group consisting of: polypeptide fragments comprising the amino acid sequences of SEQ ID NO: 37-39. In particular, the fragment may be selected from the group consisting of: polypeptide fragments comprising or consisting of the amino acid sequences SEQ ID NO: 37, 38 and 39 and any amino acid sequence having at least 80% identity with any one of SEQ ID NO: 37, 38 and 39, such as the group consisting of: polypeptide fragments comprising or consisting of the amino acid sequences SEQ ID NO: 37, 38 and 39.

[0076] In one embodiment, an immunogenic composition as disclosed herein is provided, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises at least one, such as at least two, such as at least three, of any amino acid sequences having at least 80% identity with any one of SEQ ID NOs: 20, 21 and 22. In one embodiment, one of the first, second, third, fourth or fifth fusion polypeptides comprises SEQ ID NOs: 20 and 22, SEQ ID NOs: 20 and 21; or SEQ ID NOs: 21 and 22. In one embodiment, one of the first, second, third, fourth or fifth fusion polypeptides comprises SEQ ID NOs: 20, 21 and 22.

[0077] In one embodiment, an immunogenic composition as disclosed herein is provided, wherein one of the first, second, third, fourth or fifth fusion polypeptides comprises or consists of SEQ ID NO:43 or an amino acid sequence having at least 80% identity with SEQ ID NO:43.

[0078] In one embodiment, an immunogenic composition is provided, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises or consists of: SEQ ID NO: 43, wherein independently of each other, the amino acid residue at position 303 may be absent, present or not G, and the amino acid residue at position 304 may be absent, present or not S. In a specific embodiment, the fusion polypeptide further comprises one or several additional N-terminal and / or C-terminal amino acids, such as N-terminal M or MT or MTG or MTGS (SEQ ID NO: 103), and optionally comprises a C-terminal His tag, such as HHHHHH. For example, the one of the first, second, third, fourth or fifth fusion polypeptides may comprise SEQ ID NO: 43, wherein independently of each other, the amino acid residue at position 303 may be absent, present or not G, and the amino acid residue at position 304 may be absent, present or not S, and the fusion polypeptide may comprise additional N-terminal and / or C-terminal amino acids. In other words, the one of the first, second, third, fourth or fifth fusion polypeptides comprising SEQ ID NOs: 20, 21 and 22 may have an amino acid sequence as shown in SEQ ID NO: 106, wherein the above-mentioned positions are indicated by X, wherein the X represents the presence or absence of any amino acid residue in the position. In a specific embodiment, the one of the first, second, third, fourth or fifth fusion polypeptides comprises or consists of SEQ ID NO: 106, or an amino acid sequence having at least 80% identity with SEQ ID NO: 106. In a specific embodiment, the one of the first, second, third, fourth or fifth fusion polypeptides comprises or consists of SEQ ID NO: 49 or an amino acid sequence having at least 80% identity with SEQ ID NO: 49. In one embodiment, the one of the first, second, third, fourth or fifth fusion polypeptides comprises or consists of SEQ ID NO: 49, wherein independently of each other, the amino acid residue at position 304 may be absent, present or not G, and the amino acid residue at position 305 may be absent, present or not S. In other words, the one of the first, second, third, fourth or fifth fusion polypeptides comprising SEQ ID NOs: 20, 21 and 22 may have an amino acid sequence as shown in SEQ ID NO: 109, wherein the above-mentioned positions are indicated by X, wherein the X represents the presence or absence of any amino acid residue in the position.In a specific embodiment, said one of said first, second, third, fourth or fifth fusion polypeptide comprises or consists of SEQ ID NO:109, or an amino acid sequence at least 80% identical to SEQ ID NO:109.

[0079] In one embodiment, an immunogenic composition as disclosed herein is provided, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises at least one of SEQ ID NOs: 23-27 and SEQ ID NOs: 37-39 and any amino acid sequence having at least 80% identity with any one of SEQ ID NOs: 23-27 and SEQ ID NOs: 37-39, such as at least two, such as at least three, such as at least four, such as at least five, such as at least six, such as at least seven, such as all. In one embodiment, the first, second, third, fourth or fifth fusion polypeptide comprises SEQ ID NOs: 23-27 and SEQ ID NOs: 37-39. In a specific embodiment, one of the first, second, third, fourth or fifth fusion polypeptides comprises or consists of: SEQ ID NO: 44, or an amino acid sequence having at least 80% identity with SEQ ID NO: 44. In a specific embodiment, the SEQ ID NO: 44 further comprises one or more additional N-terminal and / or C-terminal amino acids. In one embodiment, the SEQ ID NO:44 further comprises an N-terminal M, such as an N-terminal amino acid residue MT or MTG or MTGS. In a specific embodiment, the one of the first, second, third, fourth or fifth fusion polypeptides comprises or consists of SEQ ID NO:50, or an amino acid sequence having at least 80% identity with SEQ ID NO:50. In other words, the one of the first, second, third, fourth or fifth fusion polypeptides comprising SEQ ID NOs:23-27 and SEQ ID NOs:37-39 may have an amino acid sequence as shown in SEQ ID NO:110, wherein the above-mentioned positions are indicated by X, wherein the X represents any amino acid residue or the absence of an amino acid residue. In a specific embodiment, the one of the first, second, third, fourth or fifth fusion polypeptides comprises or consists of SEQ ID NO:110, or an amino acid sequence having at least 80% identity with SEQ ID NO:110.

[0080] In one embodiment, an immunogenic composition as disclosed herein is provided, wherein one of the first, second, third, fourth or fifth fusion polypeptides comprises at least one of SEQ ID NOs: 28-33 or an amino acid sequence having at least 80% identity with any one of SEQ ID NOs: 28-33, such as at least two, such as at least three, such as at least four, such as at least five, such as at least six. In one embodiment, one of the first, second, third, fourth or fifth fusion polypeptides comprises SEQ ID NOs: 28-33. In a specific embodiment, the one of the first, second, third, fourth or fifth fusion polypeptides comprises or consists of: SEQ ID NO: 45, or an amino acid sequence having at least 80% identity with SEQ ID NO: 45. In a specific embodiment, the fusion polypeptide further comprises one or several additional N-terminal and / or C-terminal amino acids. In one embodiment, the fusion polypeptide further comprises an N-terminal M, such as an N-terminal amino acid residue MT, MTG or MTGS. In a specific embodiment, the one of the first, second, third, fourth or fifth fusion polypeptides comprises or consists of SEQ ID NO:51, or an amino acid sequence having at least 80% identity with SEQ ID NO:51. In other words, the one of the first, second, third, fourth or fifth fusion polypeptides comprising SEQ ID NO:28-33 may have an amino acid sequence as shown in SEQ ID NO:111, wherein the above-mentioned positions are indicated by X, wherein the X represents any amino acid residue or the absence of an amino acid residue in the position. In a specific embodiment, the one of the first, second, third, fourth or fifth fusion polypeptides comprises or consists of SEQ ID NO:111, or an amino acid sequence having at least 80% identity with SEQ ID NO:111.

[0081] In one embodiment, an immunogenic composition as disclosed herein is provided, wherein one of the first, second, third, fourth or fifth fusion polypeptides comprises at least one, such as at least two, such as at least three, of SEQ ID NOs: 34-36 or an amino acid sequence having at least 80% identity with any one of SEQ ID NOs: 34-36. In one embodiment, one of the first, second, third, fourth or fifth fusion polypeptides comprises SEQ ID NOs: 30-32. In a specific embodiment, the one of the first, second, third, fourth or fifth fusion polypeptides comprises or consists of: SEQ ID NO: 46, or an amino acid sequence having at least 80% identity with SEQ ID NO: 46; or one of the first, second, third, fourth or fifth fusion polypeptides comprises or consists of: SEQ ID NO: 47 or an amino acid sequence having at least 80% identity with SEQ ID NO: 47. In one embodiment, an immunogenic composition is provided, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises or consists of: SEQ ID NO: 46 or 47, wherein independently of each other, the amino acid residue at position 317 may be absent, present or not E; the amino acid residue at position 318 may be absent, present or not F; the amino acid residue at position 608 may be absent, present or not G; the amino acid residue at position 609 may be absent, present or not T; the amino acid residue at position 944 may be absent, present or not L; and the amino acid residue at position 945 may be absent, present or not E. For clarity, the above-mentioned positions 317, 318, 608 and 609 refer to both SEQ ID NO: 46 and 47, while positions 944 and 945 refer to SEQ ID NO: 47. In a specific embodiment, the fusion polypeptide further comprises one or several additional N-terminal and / or C-terminal amino acids. In other words, the one of the first, second, third, fourth or fifth fusion polypeptides comprising SEQ ID NOs: 34-36 may have an amino acid sequence as shown in SEQ ID NOs: 107 or 108, wherein the above-mentioned positions are indicated by X, wherein the X represents any amino acid residue or the absence of an amino acid residue in the position. In one embodiment, the fusion polypeptide further comprises an N-terminal M, such as an N-terminal amino acid residue MT or MTG or MTGS. In one embodiment, SEQ ID NO: 46 further comprises a C-terminal SL2 tag (SEQ ID NO: 80).

[0082] In a specific embodiment, the one of the first, second, third, fourth or fifth fusion polypeptide comprises or consists of SEQ ID NO: 52 or 53, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 52 or 53. In one embodiment, the one of the first, second, third, fourth or fifth fusion polypeptide comprises or consists of SEQ ID NO: 52 or 53, wherein independently of each other, the amino acid residue at position 321 may be absent, present, or other than E; the amino acid residue at position 322 may be absent, present, or other than F; the amino acid residue at position 612 may be absent, present, or other than G; the amino acid residue at position 613 may be absent, present, or other than T; the amino acid residue at position 948 may be absent, present, or other than L; and the amino acid residue at position 949 may be absent, present, or other than E. For the sake of clarity, the above-mentioned positions 321, 322, 612, 613 refer to both SEQ ID NOs: 52 and 53, while positions 948 and 949 refer to SEQ ID NO: 47. In other words, the one of the first, second, third, fourth or fifth fusion polypeptides comprising SEQ ID NOs: 34-36 may have an amino acid sequence as shown in SEQ ID NOs: 112 or 113, wherein the above-mentioned positions are indicated by X, wherein the X represents the presence or absence of any amino acid residue in the position. In a specific embodiment, the one of the first, second, third, fourth or fifth fusion polypeptides comprises or consists of SEQ ID NOs: 112 or 113, or an amino acid sequence having at least 80% identity with SEQ ID NOs: 112 or 113.

[0083] In one embodiment, an immunogenic composition as disclosed herein is provided, wherein one of the first, second, third, fourth or fifth fusion polypeptides comprises at least one, such as at least two, such as at least three, of SEQ ID NOs: 40-42 or an amino acid sequence having at least 80% identity with any one of SEQ ID NOs: 40-42. In one embodiment, one of the first, second, third, fourth or fifth fusion polypeptides comprises SEQ ID NOs: 40-42. In a specific embodiment, the one of the first, second, third, fourth or fifth fusion polypeptides comprises or consists of: SEQ ID NO: 48, or an amino acid sequence having at least 80% identity with SEQ ID NO: 48. In a specific embodiment, the fusion polypeptide comprising SEQ ID NO: 48 further comprises one or several additional N-terminal and / or C-terminal amino acids. In one embodiment, the fusion polypeptide comprising SEQ ID NO: 48 further comprises an N-terminal M, such as an N-terminal amino acid residue MT or MTG or MTGS, or comprises an N-terminal GPLGS. The N-terminal amino acid residue may be G, GP, GLP or GLPG. In a specific embodiment, said one of the first, second, third, fourth or fifth fusion polypeptides comprises SEQ ID NO: 54 or 55, or an amino acid sequence at least 80% identical to SEQ ID NO: 54 or 55. In a specific embodiment, said one of the first, second, third, fourth or fifth fusion polypeptides comprises or consists of SEQ ID NO: 114 or 115, or an amino acid sequence at least 80% identical to SEQ ID NO: 114 or 115. Herein, positions indicated with an X represent any or no amino acid residue in said position.

[0084] In certain embodiments, the at least two, at least three, four, or all five of the first, second, third, fourth, or fifth fusion polypeptides are selected from the group consisting of:

[0085] a fusion polypeptide comprising SEQ ID NOs: 20, 21 and 22, or an amino acid sequence at least 80% identical to any one of SEQ ID NOs: 20, 21 and 22;

[0086] A fusion polypeptide comprising SEQ ID NOs:23-27 and SEQ ID NOs:37-39 or an amino acid sequence that is at least 80% identical to any one of SEQ ID NOs:23-27 and SEQ ID NOs:37-39;

[0087] a fusion polypeptide comprising SEQ ID NO: 28-33 or an amino acid sequence at least 80% identical to any one of SEQ ID NO: 28-33;

[0088] A fusion polypeptide comprising SEQ ID NO:34-36 or an amino acid sequence at least 80% identical to any one of SEQ ID NO:34-36; and

[0089] A fusion polypeptide comprising SEQ ID NO:40-42 or an amino acid sequence at least 80% identical to any one of SEQ ID NO:40-42.

[0090] In one embodiment, the at least two, at least three, four or all five of the first, second, third, fourth and fifth fusion polypeptides are selected from:

[0091] A fusion polypeptide comprising SEQ ID NOs: 20-22;

[0092] A fusion polypeptide comprising SEQ ID NOs: 23-27 and SEQ ID NOs: 37-39;

[0093] A fusion polypeptide comprising SEQ ID NOs: 28-33;

[0094] A fusion polypeptide comprising SEQ ID NOs: 34-36; and

[0095] A fusion polypeptide comprising SEQ ID NOs: 40-42.

[0096] In one embodiment of the immunogenic composition disclosed herein, the composition comprises two fusion polypeptides. Thus, the composition may comprise: a fusion polypeptide comprising SEQ ID NOs: 20-22 and a fusion polypeptide comprising SEQ ID NOs: 23-27 and 37-39; or a fusion polypeptide comprising SEQ ID NOs: 20-22 and a fusion polypeptide comprising SEQ ID NOs: 28-33; or a fusion polypeptide comprising SEQ ID NOs: 20-22 and a fusion polypeptide comprising SEQ ID NOs: 34-36; or a fusion polypeptide comprising SEQ ID NOs: 20-22 and a fusion polypeptide comprising SEQ ID NOs: 40-42; or a fusion polypeptide comprising SEQ ID NOs: 23-27 and 37-39 and a fusion polypeptide comprising SEQ ID NOs: 28-33; or a fusion polypeptide comprising SEQ ID NOs: 23-27 and 37-39 and a fusion polypeptide comprising SEQ ID NOs: 34-36; or a fusion polypeptide comprising SEQ ID NOs: 23-27 and 37-39 and a fusion polypeptide comprising SEQ ID NOs: 40-42; or a fusion polypeptide comprising SEQ ID NOs: 23-27 and 37-39 and a fusion polypeptide comprising SEQ ID NOs: 40-42. NO:28-33 and a fusion polypeptide comprising SEQ ID NO:34-36; or a fusion polypeptide comprising SEQ ID NO:28-33 and a fusion polypeptide comprising SEQ ID NO:40-42; or a fusion polypeptide comprising SEQ ID NO:34-36 and a fusion polypeptide comprising SEQ ID NO:40-42.

[0097] In one embodiment of the immunogenic composition disclosed herein, the composition comprises three fusion polypeptides. Therefore, the composition may include: a fusion polypeptide comprising SEQ ID NOs: 20-22, a fusion polypeptide comprising SEQ ID NOs: 23-27 and 37-39, and a fusion polypeptide comprising SEQ ID NOs: 28-33; or a fusion polypeptide comprising SEQ ID NOs: 20-22, a fusion polypeptide comprising SEQ ID NOs: 23-27 and 37-39, and a fusion polypeptide comprising SEQ ID NOs: 34-36; or a fusion polypeptide comprising SEQ ID NOs: 20-22, a fusion polypeptide comprising SEQ ID NOs: 23-27 and 37-39, and a fusion polypeptide comprising SEQ ID NOs: 40-42; or a fusion polypeptide comprising SEQ ID NOs: 20-22, a fusion polypeptide comprising SEQ ID NOs: 28-33, and a fusion polypeptide comprising SEQ ID NOs: 34-36; or a fusion polypeptide comprising SEQ ID NOs: 20-22, a fusion polypeptide comprising SEQ ID NOs: 28-33, and a fusion polypeptide comprising SEQ ID NOs: 40-42; or a fusion polypeptide comprising SEQ ID NOs: 20-22, a fusion polypeptide comprising SEQ ID NOs: 28-33, and a fusion polypeptide comprising SEQ ID NOs: 40-42; NO:20-22 and a fusion polypeptide comprising SEQ ID NO:34-36 and a fusion polypeptide comprising SEQ ID NO:40-42; or a fusion polypeptide comprising SEQ ID NO:23-27 and 37-39, a fusion polypeptide comprising SEQ ID NO:28-33 and a fusion polypeptide comprising SEQ ID NO:34-36; or a fusion polypeptide comprising SEQ ID NO:23-27 and 37-39, a fusion polypeptide comprising SEQ ID NO:28-33 and a fusion polypeptide comprising SEQ ID NO:40-42; or a fusion polypeptide comprising SEQ ID NO:23-27 and 37-39, a fusion polypeptide comprising SEQ ID NO:34-36 and a fusion polypeptide comprising SEQ ID NO:40-42, or a fusion polypeptide comprising SEQ ID NO:28-33, a fusion polypeptide comprising SEQ ID NO:34-36 and a fusion polypeptide comprising SEQ ID NO:40-42.

[0098] In one embodiment of the immunogenic composition disclosed herein, the composition comprises four fusion polypeptides. Therefore, the composition may include: a fusion polypeptide comprising SEQ ID NOs: 20-22, a fusion polypeptide comprising SEQ ID NOs: 23-27 and 37-39, a fusion polypeptide comprising SEQ ID NOs: 28-33, and a fusion polypeptide comprising SEQ ID NOs: 34-36; or a fusion polypeptide comprising SEQ ID NOs: 20-22, a fusion polypeptide comprising SEQ ID NOs: 23-27 and 37-39, a fusion polypeptide comprising SEQ ID NOs: 28-33, and a fusion polypeptide comprising SEQ ID NOs: 40-42; or a fusion polypeptide comprising SEQ ID NOs: 20-22, a fusion polypeptide comprising SEQ ID NOs: 23-27 and 37-39, a fusion polypeptide comprising SEQ ID NOs: 34-36, and a fusion polypeptide comprising SEQ ID NOs: 40-42; or a fusion polypeptide comprising SEQ ID NOs: 20-22, a fusion polypeptide comprising SEQ ID NOs: 28-33, a fusion polypeptide comprising SEQ ID NOs: 34-36, and a fusion polypeptide comprising SEQ ID NOs: or a fusion polypeptide comprising SEQ ID NOs: 23-27 and 37-39, a fusion polypeptide comprising SEQ ID NOs: 28-33, a fusion polypeptide comprising SEQ ID NOs: 34-36, and a fusion polypeptide comprising SEQ ID NOs: 40-42.

[0099] In one embodiment of the immunogenic composition disclosed herein, the composition comprises five fusion polypeptides. Thus, the composition may comprise: a fusion polypeptide comprising SEQ ID NOs: 20-22, a fusion polypeptide comprising SEQ ID NOs: 23-27 and 37-39, a fusion polypeptide comprising SEQ ID NOs: 28-33, a fusion polypeptide comprising SEQ ID NOs: 34-36, and a fusion polypeptide comprising SEQ ID NOs: 40-42.

[0100] The skilled person will understand that the % identity feature applies to any of the fusion polypeptides described above, but is not repeated here for brevity only. Thus, immunogenic compositions comprising fusion polypeptides comprising fragments that exhibit at least 80% identity to the recited fragments are also contemplated, for example, such as fusion polypeptides comprising SEQ ID NOs: 28-33 or an amino acid sequence that is at least 80% identical to any one of SEQ ID NOs: 28-33, fusion polypeptides comprising SEQ ID NOs: 34-36 or an amino acid sequence that is at least 80% identical to any one of SEQ ID NOs: 34-36, and immunogenic compositions comprising SEQ ID NOs: 40-42 or an amino acid sequence that is at least 80% identical to any one of SEQ ID NOs: 40-42.

[0101] In one embodiment, an immunogenic composition as disclosed herein is provided, wherein at least two, at least three or all four of the first, second, third, fourth or fifth fusion polypeptides are selected from:

[0102] A fusion polypeptide comprising SEQ ID NO:43 or an amino acid sequence at least 80% identical to SEQ ID NO:43;

[0103] A fusion polypeptide comprising SEQ ID NO:44 or an amino acid sequence at least 80% identical to SEQ ID NO:44;

[0104] A fusion polypeptide comprising SEQ ID NO:45 or an amino acid sequence at least 80% identical to SEQ ID NO:45;

[0105] A fusion polypeptide comprising SEQ ID NO:46 or an amino acid sequence having at least 80% identity to SEQ ID NO:46, and

[0106] A fusion polypeptide comprising SEQ ID NO:48 or an amino acid sequence at least 80% identical to SEQ ID NO:48;

[0107] or selected from the group consisting of:

[0108] A fusion polypeptide comprising SEQ ID NO:43 or an amino acid sequence at least 80% identical to SEQ ID NO:43;

[0109] A fusion polypeptide comprising SEQ ID NO:44 or an amino acid sequence at least 80% identical to SEQ ID NO:44;

[0110] A fusion polypeptide comprising SEQ ID NO:45 or an amino acid sequence at least 80% identical to SEQ ID NO:45; and

[0111] A fusion polypeptide comprising SEQ ID NO: 47 or an amino acid sequence having at least 80% identity to SEQ ID NO: 47, and

[0112] A fusion polypeptide comprising SEQ ID NO:48 or an amino acid sequence at least 80% identical to SEQ ID NO:48.

[0113] In one embodiment, an immunogenic composition as disclosed herein is provided, wherein at least two, at least three or all four of the first, second, third, fourth or fifth fusion polypeptides are selected from:

[0114] a fusion polypeptide comprising SEQ ID NO: 106 or an amino acid sequence at least 80% identical to SEQ ID NO: 106;

[0115] A fusion polypeptide comprising SEQ ID NO:44 or an amino acid sequence at least 80% identical to SEQ ID NO:44;

[0116] A fusion polypeptide comprising SEQ ID NO:45 or an amino acid sequence at least 80% identical to SEQ ID NO:45;

[0117] A fusion polypeptide comprising SEQ ID NO: 107 or an amino acid sequence at least 80% identical to SEQ ID NO: 107, and

[0118] A fusion polypeptide comprising SEQ ID NO:48 or an amino acid sequence at least 80% identical to SEQ ID NO:48;

[0119] or selected from the group consisting of:

[0120] a fusion polypeptide comprising SEQ ID NO: 106 or an amino acid sequence at least 80% identical to SEQ ID NO: 106;

[0121] A fusion polypeptide comprising SEQ ID NO:44 or an amino acid sequence at least 80% identical to SEQ ID NO:44;

[0122] A fusion polypeptide comprising SEQ ID NO:45 or an amino acid sequence at least 80% identical to SEQ ID NO:45; and

[0123] A fusion polypeptide comprising SEQ ID NO: 108 or an amino acid sequence having at least 80% identity to SEQ ID NO: 108, and

[0124] A fusion polypeptide comprising SEQ ID NO:48 or an amino acid sequence at least 80% identical to SEQ ID NO:48.

[0125] In one embodiment, an immunogenic composition as disclosed herein is provided, wherein at least two, at least three, at least four or all five of the first, second, third, fourth or fifth fusion polypeptides are selected from the above-mentioned groups.

[0126] In one embodiment, the immunogenic composition comprises the following: a fusion polypeptide comprising SEQ ID NO:43 or an amino acid sequence that is at least 80% identical to SEQ ID NO:43; a fusion polypeptide comprising SEQ ID NO:44 or an amino acid sequence that is at least 80% identical to SEQ ID NO:44; a fusion polypeptide comprising SEQ ID NO:45 or an amino acid sequence that is at least 80% identical to SEQ ID NO:45; a fusion polypeptide comprising SEQ ID NO:47 or an amino acid sequence that is at least 80% identical to SEQ ID NO:47, and a fusion polypeptide comprising SEQ ID NO:48 or an amino acid sequence that is at least 80% identical to SEQ ID NO:48. In one embodiment, the immunogenic composition comprises the following: a fusion polypeptide comprising SEQ ID NO:43 or an amino acid sequence that is at least 80% identical to SEQ ID NO:43; a fusion polypeptide comprising SEQ ID NO:44 or an amino acid sequence that is at least 80% identical to SEQ ID NO:44; a fusion polypeptide comprising SEQ ID NO:45 or an amino acid sequence that is at least 80% identical to SEQ ID NO:45; a fusion polypeptide comprising SEQ ID NO:46 or an amino acid sequence that is at least 80% identical to SEQ ID NO:46, and a fusion polypeptide comprising SEQ ID NO:48 or an amino acid sequence that is at least 80% identical to SEQ ID NO:48. In one embodiment, the immunogenic composition comprises the following: a fusion polypeptide comprising SEQ ID NO:43 or an amino acid sequence that is at least 80% identical to SEQ ID NO:43; a fusion polypeptide comprising SEQ ID NO:44 or an amino acid sequence that is at least 80% identical to SEQ ID NO:44; a fusion polypeptide comprising SEQ ID NO:45 or an amino acid sequence that is at least 80% identical to SEQ ID NO:45, and a fusion polypeptide comprising SEQ ID NO:46 or an amino acid sequence that is at least 80% identical to SEQ ID NO:46. In one embodiment, the immunogenic composition comprises the following: a fusion polypeptide comprising SEQ ID NO:43 or an amino acid sequence that is at least 80% identical to SEQ ID NO:43; a fusion polypeptide comprising SEQ ID NO:44 or an amino acid sequence that is at least 80% identical to SEQ ID NO:44; a fusion polypeptide comprising SEQ ID NO:45 or an amino acid sequence that is at least 80% identical to SEQ ID NO:45, and a fusion polypeptide comprising SEQ ID NO:47 or an amino acid sequence that is at least 80% identical to SEQ ID NO:47.

[0127] In a specific embodiment, the at least two, at least three, four or all five of the first, second, third, fourth or fifth fusion polypeptides may be selected from the group consisting of:

[0128] A fusion polypeptide comprising SEQ ID NO:43; a fusion polypeptide comprising SEQ ID NO:44; a fusion polypeptide comprising SEQ ID NO:45;

[0129] A fusion polypeptide comprising SEQ ID NO:46; and a fusion polypeptide comprising SEQ ID NO:48

[0130] or selected from the group consisting of: a fusion polypeptide comprising SEQ ID NO: 43; a fusion polypeptide comprising SEQ ID NO: 44; a fusion polypeptide comprising SEQ ID NO: 45; a fusion polypeptide comprising SEQ ID NO: 47; and a fusion polypeptide comprising SEQ ID NO: 48. In a specific embodiment, the immunogenic composition comprises the following: a fusion polypeptide comprising SEQ ID NO: 43; a fusion polypeptide comprising SEQ ID NO: 44; a fusion polypeptide comprising SEQ ID NO: 45; a fusion polypeptide comprising SEQ ID NO: 47; and a fusion polypeptide comprising SEQ ID NO: 48. In a specific embodiment, the immunogenic composition comprises the following: a fusion polypeptide comprising SEQ ID NO: 43; a fusion polypeptide comprising SEQ ID NO: 44; a fusion polypeptide comprising SEQ ID NO: 45; a fusion polypeptide comprising SEQ ID NO: 46; and a fusion polypeptide comprising SEQ ID NO: 48. In a specific embodiment, the immunogenic composition comprises the following: a fusion polypeptide comprising SEQ ID NO: 43; a fusion polypeptide comprising SEQ ID NO: 44; a fusion polypeptide comprising SEQ ID NO: 45 and a fusion polypeptide comprising SEQ ID NO: 47. In a specific embodiment, the immunogenic composition comprises the following: a fusion polypeptide comprising SEQ ID NO: 43; a fusion polypeptide comprising SEQ ID NO: 44; a fusion polypeptide comprising SEQ ID NO: 45 and a fusion polypeptide comprising SEQ ID NO: 46.

[0131] It should be understood that the SEQ ID NO:43 may also be such a SEQ ID NO:43: wherein, independently of each other, the amino acid residue at position 303 may be absent, present, or not G, and the amino acid residue at position 304 may be absent, present, or not S, and the SEQ ID NO:43 may contain additional N-terminal and / or C-terminal amino acids.

[0132] Therefore, the skilled person understands that in the embodiments listed herein, the amino acid sequence of SEQ ID NO:43 (wherein the amino acid residues may be present or absent or different at position 303 and position 304 as indicated above) may be replaced by SEQ ID NO:106, wherein the above-mentioned positions are indicated by X, wherein the X represents the presence or absence of any amino acid residue at the position.

[0133] It should be understood that the SEQ ID NO: 46 and / or 47 can also be such SEQ ID NO: 46 and / or 47: wherein, independently of each other, the amino acid residue at position 317 may be absent, present, or not E; the amino acid residue at position 318 may be absent, present, or not F; the amino acid residue at position 608 may be absent, present, or not G; the amino acid residue at position 609 may be absent, present, or not T; the amino acid residue at position 944 may be absent, present, or not L; and the amino acid residue at position 945 may be absent, present, or not E. Therefore, the skilled person understands that in the embodiments listed herein, the amino acid sequence of SEQ ID NO: 46 (wherein the amino acid residues may be present, absent, or different at position 317, position 318, position 608, and position 609 as indicated above) can be replaced by SEQ ID NO: 107, wherein the X represents the presence or absence of any amino acid residue at the position. Therefore, the skilled person understands that the amino acid sequence of SEQ ID NO:47 (in which the amino acid residues may be present or absent or different at position 317, position 318, position 608, position 609, position 944 and position 945 as indicated above) can be replaced by SEQ ID NO:108.

[0134] In one embodiment, the fusion polypeptide comprising SEQ ID NO: 48 is SEQ ID NO: 54 or SEQ ID NO: 55. In one embodiment, the fusion polypeptide comprising SEQ ID NO: 48 is SEQ ID NO: 114 or SEQ ID NO: 115.

[0135] In one embodiment of the immunogenic composition disclosed herein, the composition comprises two fusion polypeptides. Thus, the composition may comprise: SEQ ID NO: 43, wherein independently of each other, the amino acid residue at position 303 may be absent, present, or not G, and the amino acid residue at position 304 may be absent, present, or not S, and SEQ ID NO: 44;

[0136] or SEQ ID NO:43, wherein, independently of each other, the amino acid residue at position 303 may be absent, present, or other than G, and the amino acid residue at position 304 may be absent, present, or other than S, and SEQ ID NO:45;

[0137] or SEQ ID NO:43, wherein, independently of one another, the amino acid residue at position 303 may be absent, present, or other than G, and the amino acid residue at position 304 may be absent, present, or other than S, and SEQ ID NO:46, wherein, independently of one another, the amino acid residue at position 317 may be absent, present, or other than E, the amino acid residue at position 318 may be absent, present, or other than F, the amino acid residue at position 608 may be absent, present, or other than G and the amino acid residue at position 609 may be absent, present, or other than T;

[0138] or SEQ ID NO:43, wherein, independently of each other, the amino acid residue at position 303 may be absent, present, or other than G, and the amino acid residue at position 304 may be absent, present, or other than S, and SEQ ID NO:48;

[0139] or SEQ ID NO:44 and SEQ ID NO:45;

[0140] or SEQ ID NO:44 and SEQ ID NO:46, wherein, independently of each other, the amino acid residue at position 317 may be absent, present, or other than E, the amino acid residue at position 318 may be absent, present, or other than F, the amino acid residue at position 608 may be absent, present, or other than G and the amino acid residue at position 609 may be absent, present, or other than T;

[0141] or SEQ ID NO:44 and SEQ ID NO:48;

[0142] or SEQ ID NO:45 and SEQ ID NO:46, wherein, independently of each other, the amino acid residue at position 317 may be absent, present, or other than E, the amino acid residue at position 318 may be absent, present, or other than F, the amino acid residue at position 608 may be absent, present, or other than G and the amino acid residue at position 609 may be absent, present, or other than T;

[0143] or SEQ ID NO:45 and SEQ ID NO:48;

[0144] or SEQ ID NO:46, wherein, independently of each other, the amino acid residue at position 317 may be absent, present, or other than E, the amino acid residue at position 318 may be absent, present, or other than F, the amino acid residue at position 608 may be absent, present, or other than G and the amino acid residue at position 609 may be absent, present, or other than T, and SEQ ID NO:48.

[0145] In one embodiment of the immunogenic composition disclosed herein, the composition comprises three fusion polypeptides. Thus, the composition may comprise: SEQ ID NO: 43, wherein independently of each other, the amino acid residue at position 303 may be absent, present, or not G, and the amino acid residue at position 304 may be absent, present, or not S, and SEQ ID NO: 44 and SEQ ID NO: 45;

[0146] or SEQ ID NO:43, wherein, independently of each other, the amino acid residue at position 303 may be absent, present, or other than G, and the amino acid residue at position 304 may be absent, present, or other than S, and SEQ ID NO:44 and SEQ ID NO:46, wherein, independently of each other, the amino acid residue at position 317 may be absent, present, or other than E, the amino acid residue at position 318 may be absent, present, or other than F, the amino acid residue at position 608 may be absent or other than G and the amino acid residue at position 609 may be absent, present, or other than T;

[0147] or SEQ ID NO:43, wherein, independently of each other, the amino acid residue at position 303 may be absent, present, or other than G, and the amino acid residue at position 304 may be absent, present, or other than S, and SEQ ID NO:44 and SEQ ID NO:48;

[0148] or SEQ ID NO:43, wherein, independently of each other, the amino acid residue at position 303 may be absent, present, or other than G, and the amino acid residue at position 304 may be absent, present, or other than S, and SEQ ID NO:45 and SEQ ID NO:46, wherein, independently of each other, the amino acid residue at position 317 may be absent, present, or other than E, the amino acid residue at position 318 may be absent, present, or other than F, the amino acid residue at position 608 may be absent or other than G and the amino acid residue at position 609 may be absent, present, or other than T;

[0149] or SEQ ID NO:43, wherein, independently of each other, the amino acid residue at position 303 may be absent, present, or other than G, and the amino acid residue at position 304 may be absent, present, or other than S, and SEQ ID NO:45 and SEQ ID NO:48;

[0150] or SEQ ID NO:43, wherein, independently of one another, the amino acid residue at position 303 may be absent, present, or other than G, and the amino acid residue at position 304 may be absent, present, or other than S, and SEQ ID NO:46, wherein, independently of one another, the amino acid residue at position 317 may be absent, present, or other than E, the amino acid residue at position 318 may be absent, present, or other than F, the amino acid residue at position 608 may be absent or other than G and the amino acid residue at position 609 may be absent, present, or other than T, and SEQ ID NO:48;

[0151] or SEQ ID NO:44 and SEQ ID NO:45 and SEQ ID NO:46, wherein, independently of each other, the amino acid residue at position 317 may be absent, present, or other than E, the amino acid residue at position 318 may be absent, present, or other than F, the amino acid residue at position 608 may be absent, present, or other than G and the amino acid residue at position 609 may be absent, present, or other than T;

[0152] or SEQ ID NO:44 and SEQ ID NO:45 and SEQ ID NO:48;

[0153] or SEQ ID NO:44 and SEQ ID NO:46, wherein, independently of each other, the amino acid residue at position 317 may be absent, present, or other than E; the amino acid residue at position 318 may be absent, present, or other than F; the amino acid residue at position 608 may be absent, or other than G, and the amino acid residue at position 609 may be absent, present, or other than T, and SEQ ID NO:48;

[0154] or SEQ ID NO:45 and SEQ ID NO:46, wherein, independently of each other, the amino acid residue at position 317 may be absent, present, or other than E, the amino acid residue at position 318 may be absent, present, or other than F, the amino acid residue at position 608 may be absent, present, or other than G and the amino acid residue at position 609 may be absent, present, or other than T, and SEQ ID NO:48.

[0155] In one embodiment of the immunogenic composition disclosed herein, the composition comprises four fusion polypeptides. Thus, the composition may comprise: SEQ ID NO: 43, wherein independently of each other, the amino acid residue at position 303 may be absent, present, or not G, and the amino acid residue at position 304 may be absent, present, or not S, and SEQ ID NO: 44 and SEQ ID NO: 45 and SEQ ID NO: 46, wherein independently of each other, the amino acid residue at position 317 may be absent, present, or not E, the amino acid residue at position 318 may be absent, present, or not F, the amino acid residue at position 608 may be absent or not G, and the amino acid residue at position 609 may be absent, present, or not T;

[0156] or

[0157] SEQ ID NO:43, wherein, independently of each other, the amino acid residue at position 303 may be absent, present, or other than G, and the amino acid residue at position 304 may be absent, present, or other than S, and SEQ ID NO:44 and SEQ ID NO:45 and SEQ ID NO:48;

[0158] or SEQ ID NO:43, wherein, independently of each other, the amino acid residue at position 303 may be absent, present, or other than G, and the amino acid residue at position 304 may be absent, present, or other than S, and SEQ ID NO:44 and SEQ ID NO:46, wherein, independently of each other, the amino acid residue at position 317 may be absent, present, or other than E, the amino acid residue at position 318 may be absent, present, or other than F, the amino acid residue at position 608 may be absent or other than G and the amino acid residue at position 609 may be absent, present, or other than T, and SEQ ID NO:48;

[0159] or SEQ ID NO:43, wherein, independently of each other, the amino acid residue at position 303 may be absent, present, or other than G, and the amino acid residue at position 304 may be absent, present, or other than S, and SEQ ID NO:45 and SEQ ID NO:46, wherein, independently of each other, the amino acid residue at position 317 may be absent, present, or other than E, the amino acid residue at position 318 may be absent, present, or other than F, the amino acid residue at position 608 may be absent or other than G and the amino acid residue at position 609 may be absent, present, or other than T, and SEQ ID NO:48;

[0160] or SEQ ID NO:44 and SEQ ID NO:45 and SEQ ID NO:46, wherein, independently of each other, the amino acid residue at position 317 may be absent, present, or other than E, the amino acid residue at position 318 may be absent, present, or other than F, the amino acid residue at position 608 may be absent, present, or other than G and the amino acid residue at position 609 may be absent, present, or other than T, and SEQ ID NO:48.

[0161] In one embodiment, the composition comprises SEQ ID NO:43, wherein, independently of each other, the amino acid residue at position 303 may be absent, present, or other than G, and the amino acid residue at position 304 may be absent, present, or other than S, SEQ ID NO:44 and SEQ ID NO:45 and SEQ ID NO:46, wherein, independently of each other, the amino acid residue at position 317 may be absent, present, or other than E, the amino acid residue at position 318 may be absent, present, or other than F, the amino acid residue at position 608 may be absent or other than G and the amino acid residue at position 609 may be absent, present, or other than T, and SEQ ID NO:48.

[0162] The skilled artisan will appreciate that the % identity feature applies to any of the fusion polypeptides described above, but is not repeated here simply for the sake of brevity.

[0163] It should also be understood that the identity % feature is applicable to any one of the first, second, third, fourth or fifth polypeptide discussed above.Especially, also encompassed with the native protein of the Streptococcus suis mentioned in the above embodiment or the narrated fragment of the fusion polypeptide at least 81%, such as at least 82%, such as at least 83%, such as at least 84%, such as at least 85%, such as at least 86%, such as at least 87%, such as at least 88%, such as at least 89%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 93%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98% or such as at least 99% identical amino acid sequence.Technicians will appreciate that the above % identity level of statement for wherein narrating % identity feature this first aspect and any embodiment of the second aspect are equally applicable.For the sake of brevity, no longer repeat every time.

[0164] The fusion polypeptides of the present disclosure may be unstructured, comprising partially or completely unstructured regions of a native polypeptide, in other words, regions lacking a well-defined tertiary structure.

[0165] As used herein, the term "unstructured" or "disordered" in relation to a polypeptide, protein or fragment thereof refers to a polypeptide, protein or fragment thereof that does not have a single well-defined tertiary structure under native conditions. Several different computer programs are available for predicting the unstructured features of a polypeptide, protein or fragment thereof. Examples of such programs are IUPred, IUPred2 and IUPred2A. The skilled person is familiar with the programs and how to use them to predict the structural features of a polypeptide, protein or fragment thereof. In general, unstructured regions are characterized by a compositional bias in their amino acid sequences in that they contain a significantly greater proportion of small hydrophilic amino acids and proline residues than structured regions.

[0166] In one embodiment of the immunogenic composition as disclosed herein, at least one of the fusion polypeptides (such as at least two or at least three) is not denatured and / or does not precipitate when heated to about 100°C. In the context of the present disclosure, the lack of heating effect may be related to the tertiary structure of the fusion polypeptide. Thus, heating to about 100°C does not result in a denaturing effect on the structural properties (especially the tertiary structural properties) of the fusion polypeptide and / or does not result in precipitation of the fusion polypeptide. In particular, the fusion polypeptide may advantageously comprise an unstructured (also referred to as disordered) fragment of the native polypeptide, so that the fusion polypeptide is also largely unstructured or completely unstructured.

[0167] Without being bound by theory, unstructured or disordered proteins have been described as important antigens in a range of infectious diseases, and it has been reported that disordered epitopes are likely to be recognized by antibodies as ordered epitopes (MacRaild C et al., Structure [Structure] January 5, 2016; 24 (1): 148-157). In addition, studies have shown that disordered epitopes are smaller than their ordered counterparts, but more effective in their interaction with antibodies, and antibody recognition of disordered epitopes is particularly sensitive to epitope variation. Without being bound by theory, unstructured protein parts can be combined into fusion proteins in all possible ways. That is, since the fusion protein used as an antigen or the native protein on the surface of the bacteria does not have a definite structure, the inventors believe that the antibodies obtained are most likely to recognize the native protein. Therefore, compared with structured proteins, it may be advantageous to use unstructured proteins or fragments as antigens in immunogenic compositions or vaccines. Structured proteins must contain complete domains to fold correctly, otherwise the antibodies obtained will not be able to recognize the natural target. In addition, it may be advantageous to use unstructured proteins or unstructured fragments of proteins to prepare fusion proteins, because shorter fragments of about 20-30 amino acids can be used, and therefore more different protein parts can be included in the fusion polypeptide than if structured proteins or structured fragments are used. It is envisioned that the higher number of bacterial proteins included in the immunogenic composition can generate a wider range of immune responses, which can interfere with the functions of multiple proteins important to the course of disease, provide enhanced targeting of pathogens to kill by immune response, explain the complexity of bacterial pathogens and their multiple ways of causing disease, and / or prevent strain variation effects (which is a special problem for Streptococcus suis). It is believed that the combination of unstructured protein parts in the fusion polypeptide makes it possible to obtain antibodies against a large number of bacterial proteins.

[0168] As explained above in the context of the first aspect relating to the immunogenic composition, in particular, fragments of zinc binding proteins, proteases, proteins comprising the LPXTG motif and other polypeptides from Streptococcus suis can be provided in the form of a fusion polypeptide. The fusion polypeptide can be used in an immunogenic composition and / or vaccine composition for preventing Streptococcus suis infection. Therefore, in a second aspect of the present disclosure, a fusion polypeptide is provided, which comprises fragments of at least 3, such as at least 4, such as at least 5, such as at least 6, such as at least 7 natural full-length polypeptides from Streptococcus suis, wherein the natural full-length polypeptides are independently selected or selected from the group consisting of: amino acid sequences according to SEQ ID NOs: 1-10 and SEQ ID NOs: 14-19 and amino acid sequences having at least 80% identity with any one of SEQ ID NOs: 1-10 and SEQ ID NOs: 14-19, such as selected from the group consisting of: amino acid sequences according to SEQ ID NOs: 1-10 and SEQ ID NOs: 14-19.

[0169] In one embodiment, the native full-length polypeptide is independently selected or selected from the group consisting of: an amino acid sequence according to SEQ ID NO: 1-3 and an amino acid sequence having at least 80% identity with any one of SEQ ID NO: 1-3, such as selected from the group consisting of: an amino acid sequence according to SEQ ID NO: 1-3. In one embodiment, the native full-length polypeptide is independently selected or selected from the group consisting of: an amino acid sequence according to SEQ ID NO: 1-5 and 14-16 and an amino acid sequence having at least 80% identity with any one of SEQ ID NO: 1-5 and 14-16, such as selected from the group consisting of: an amino acid sequence according to SEQ ID NO: 1-5 and 14-16. In one embodiment, the native full-length polypeptide is independently selected or selected from the group consisting of: an amino acid sequence according to SEQ ID NO: 6-10 and an amino acid sequence having at least 80% identity with any one of SEQ ID NO: 6-10, such as selected from the group consisting of: an amino acid sequence according to SEQ ID NO: 6-10. In one embodiment, the native full-length polypeptide is independently selected or selected from the group consisting of: an amino acid sequence according to SEQ ID NO: 17-19 and an amino acid sequence having at least 80% identity with any one of SEQ ID NO: 17-19, such as selected from the group consisting of: an amino acid sequence according to SEQ ID NO: 17-19, such as wherein the native full-length polypeptide is SEQ ID NO: 17-19.

[0170] In particular, in one embodiment, the fragments are independently selected or selected from the group consisting of: fragments having amino acid sequences according to SEQ ID NOs: 20-33 and 37-42 and amino acid sequences having at least 80% identity with any one of SEQ ID NOs: 20-33 and 37-42, such as selected from the group consisting of: amino acid sequences according to SEQ ID NOs: 20-33 and 37-42.

[0171] In one embodiment, the fragment is selected from the group consisting of SEQ ID NOs: 20-22 and an amino acid sequence having at least 80% identity to any one of SEQ ID NOs: 20-22. In a specific embodiment, the fragment has an amino acid sequence according to SEQ ID NOs: 20-22.

[0172] In one embodiment, a fusion polypeptide is provided, comprising or consisting of the amino acid sequence of SEQ ID NO: 43 or an amino acid sequence having 80% identity with SEQ ID NO: 43. In one embodiment, the fusion polypeptide comprises or consists of the amino acid sequence of SEQ ID NO: 43.

[0173] In one embodiment, the fusion polypeptide comprises SEQ ID NO: 43, wherein independently of each other, the amino acid residue at position 303 may be absent, present, or other than G, and the amino acid residue at position 304 may be absent, present, or other than S. In other words, the fusion polypeptide comprises or consists of SEQ ID NO: 106.

[0174] In a specific embodiment, the fusion polypeptide further comprises one or several additional N-terminal and / or C-terminal amino acids, such as an N-terminal M or MT, such as M or MT or MTG or MTGS, and optionally comprises a C-terminal His tag, such as HHHHHH. For example, the fusion polypeptide may comprise the SEQ ID NO:43, wherein independently of each other, the amino acid residue at position 303 may be absent, present, or not G, and the amino acid residue at position 304 may be absent, present, or not S, and the fusion polypeptide may comprise additional N-terminal and / or C-terminal amino acids. In a specific embodiment, the fusion polypeptide comprises or consists of: SEQ ID NO:49 or an amino acid sequence having at least 80% identity with SEQ ID NO:49. In one embodiment, the fusion polypeptide comprises or consists of: SEQ ID NO:49, wherein independently of each other, the amino acid residue at position 304 may be absent, present, or not G, and the amino acid residue at position 305 may be absent, present, or not S. In other words, the fusion polypeptide comprises or consists of SEQ ID NO: 109 or an amino acid sequence at least 80% identical thereto.

[0175] In one embodiment, a fusion polypeptide is provided, wherein the fragment is selected from the group consisting of fragments having amino acid sequences according to SEQ ID NOs: 23-27 and 37-39 and amino acid sequences having at least 80% identity to any one of SEQ ID NOs: 23-27 and 37-39. In one embodiment, the fragment is selected from the group consisting of fragments having amino acid sequences according to SEQ ID NOs: 23-27 and 37-39. In a specific embodiment, the fusion polypeptide comprises or consists of the amino acid sequence SEQ ID NO: 44 or an amino acid sequence having 80% identity to SEQ ID NO: 44. In one embodiment, the fusion polypeptide comprises or consists of the amino acid sequence SEQ ID NO: 44. In a specific embodiment, the fusion polypeptide further comprises one or several additional N-terminal and / or C-terminal amino acids. In one embodiment, the fusion polypeptide further comprises an N-terminal M, such as an N-terminal amino acid residue MT or MTG or MTGS. In a specific embodiment, the fusion polypeptide comprises or consists of SEQ ID NO: 50 or an amino acid sequence having at least 80% identity to SEQ ID NO: 50. In other words, the fusion polypeptide comprises or consists of SEQ ID NO: 110 or an amino acid sequence having at least 80% identity thereto.

[0176] In one embodiment, a fusion polypeptide as disclosed herein is provided, wherein the fragment is selected from the group consisting of fragments having an amino acid sequence according to SEQ ID NO: 28-33 and an amino acid sequence having at least 80% identity with any one of SEQ ID NO: 28-33. In one embodiment, the fragment is selected from the group consisting of fragments having an amino acid sequence according to SEQ ID NO: 28-33. In a specific embodiment, the fusion polypeptide comprises or consists of the amino acid sequence SEQ ID NO: 45 or an amino acid sequence having 80% identity with SEQ ID NO: 45. In one embodiment, the fusion polypeptide comprises or consists of the amino acid sequence SEQ ID NO: 45. In a specific embodiment, the fusion polypeptide further comprises one or several additional N-terminal and / or C-terminal amino acids. In one embodiment, the fusion polypeptide further comprises an N-terminal M, such as an N-terminal amino acid residue MT or MTG or MTGS. In a specific embodiment, the fusion polypeptide comprises or consists of SEQ ID NO: 51 or an amino acid sequence having at least 80% identity with SEQ ID NO: 51. In other words, the fusion polypeptide comprises or consists of SEQ ID NO: 111 or an amino acid sequence having at least 80% identity thereto.

[0177] In one embodiment, a fusion polypeptide as disclosed herein is provided, wherein the fragment is selected from the group consisting of: a fragment having an amino acid sequence according to SEQ ID NO: 17-19 and an amino acid sequence having at least 80% identity with any one of SEQ ID NO: 17-19, for example, a group consisting of: an amino acid sequence according to SEQ ID NO: 17-19, for example, wherein the native full-length polypeptide is SEQ ID NO: 17-19.

[0178] In a specific embodiment, the fusion polypeptide comprises or consists of an amino acid sequence. In a specific embodiment, the fusion polypeptide comprises or consists of the amino acid sequence SEQ ID NO:48 or an amino acid sequence with 80% identity to SEQ ID NO:48. In a specific embodiment, the fusion polypeptide further comprises one or several additional N-terminal and / or C-terminal amino acids. In one embodiment, the fusion polypeptide further comprises an N-terminal M, such as an N-terminal amino acid residue MT or MTG or MTGS. In one embodiment, the fusion polypeptide further comprises an N-terminal G, such as an N-terminal amino acid residue GPLGS. The N-terminal amino acid residue may be G, GP, GPL or GPLG. In one embodiment, the fusion polypeptide comprises or consists of SEQ ID NO:54, or SEQ ID NO:55, or an amino acid sequence with at least 80% identity to SEQ ID NO:54 or SEQ ID NO:55. In other words, the fusion polypeptide comprises or consists of SEQ ID NO:114 or 115 or an amino acid sequence with at least 80% identity thereto.

[0179] Again, it should be understood that the identity% feature is applicable to any one of the fusion polypeptides disclosed above. In particular, the present disclosure covers at least 81% of the fusion polypeptides mentioned in the above embodiments, such as at least 82%, such as at least 83%, such as at least 84%, such as at least 85%, such as at least 86%, such as at least 87%, such as at least 88%, such as at least 89%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 93%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, or such as at least 99% identical fusion polypeptides. It should be understood that the narration of the above identity% level is equally relevant for any embodiment in which the identity% feature is narrated. For the sake of brevity, it is no longer repeated every time.

[0180] As discussed in the context of the first aspect of the present disclosure, the fusion polypeptide of the present disclosure can be unstructured, comprising a partially or completely unstructured region of a native polypeptide, in other words, a region lacking a tertiary structure. In general, unstructured regions are characterized by a compositional bias in their amino acid sequences, in that they contain a significantly greater proportion of small hydrophilic amino acids and proline residues than structured regions.

[0181] In this regard, a specific fragment according to any one of SEQ ID NOs: 20-29 and SEQ ID NOs: 33-35 is an unstructured region of its respective native polypeptide. Such unstructured regions are not affected by heating to high temperatures, which usually denature structured polypeptides and structured fragments thereof. Even boiling at 100° C. does not affect its structure. Therefore, in one embodiment of a fusion polypeptide as disclosed herein, a fusion polypeptide as defined herein is provided, wherein the tertiary structure of the fusion polypeptide is not denatured and / or the fusion polypeptide is not precipitated by heating to about 100° C.

[0182] In the context of the present disclosure, the lack of effect may be related to the tertiary structure of the fusion polypeptide. Thus, heating to about 100° C. has no effect on the structural properties of the fusion polypeptide. In particular, the fusion polypeptide may advantageously comprise an unstructured fragment of a native polypeptide, so that the fusion polypeptide is also largely unstructured or completely unstructured. The advantages of unstructured proteins or fragments are discussed in the context of the first aspect disclosed herein, and are not repeated merely for the sake of brevity. The skilled person understands that the advantages are equally relevant to the second aspect.

[0183] In one embodiment, the fusion polypeptide comprising SEQ ID NOs: 20-22, the fusion polypeptide comprising SEQ ID NOs: 23-27 and 37-39; and / or the fusion polypeptide comprising SEQ ID NOs: 28-33 disclosed herein comprises or consists of an unstructured fragment.

[0184] It should be understood that the fusion polypeptide contained in the immunogenic composition according to the first aspect as described herein and the fusion polypeptide according to the second aspect as described herein itself can further include additional amino acid residues at the N-terminus and / or C-terminus. For the sake of brevity, this is not repeated or only briefly mentioned. For the sake of clarity, the presence of additional amino acid residues at the N-terminus and / or C-terminus of the fusion polypeptide does not exclude the presence of additional N-terminal or C-terminal extensions (e.g., in the form of "tags" for purification, as described below).

[0185] It will be appreciated by the skilled artisan that various modifications and / or additions may be made to the fusion polypeptides as defined herein without departing from the scope of the present disclosure, so as to customize the polypeptides for specific applications. For example, for the purpose of improving the in vivo or in vitro production, purification and / or stabilization of the fusion polypeptides, the fusion polypeptides as defined herein may include additional amino acid residues. Therefore, the fusion polypeptides may include any suitable number of additional amino acid residues, such as at least one additional amino acid residue. Each additional amino acid residue may be added individually or collectively, such as to improve in vivo or in vitro production, purification, solubility and / or stability. Such additional amino acid residues may also provide a "tag" for purification, such as a His-tag (e.g., a His6-tag or a His7-tag), or a "myc" (c-myc) tag, or a "FLAG" tag, to interact with antibodies specific for tags or immobilized metal affinity chromatography (IMAC) (in the case of a His-tag). Additional amino acid residues may further include an SL2 tag or an LSL tag as described herein.

[0186] Therefore, in one embodiment, a fusion polypeptide as described herein is provided, wherein the fusion polypeptide further comprises additional amino acid residues at the N-terminus and / or the C-terminus. Such fusion polypeptides should be understood as polypeptides having one or more additional amino acid residues at the first and / or last position in the polypeptide chain (i.e., at the N-terminus and / or the C-terminus). In one embodiment, the fusion polypeptide comprises a methionine M residue at the N-terminus. In one embodiment, the fusion polypeptide comprises amino acid residues MT, MTG or MTGS at the N-terminus. In one embodiment, the fusion polypeptide comprises amino acid residues LE at the C-terminus.

[0187] In one embodiment, a fusion polypeptide as described herein is provided, wherein the one or more additional amino acid residues at the N-terminus and / or C-terminus, or at the N-terminus and / or C-terminus, improve the in vivo or in vitro production, purification and / or stabilization of the immunogenic polypeptide. In one embodiment, the additional one or more amino acid residues comprise a tag or several tags, for example, a tag selected from the group consisting of: His-tag (SEQ ID NO: 81), "myc" (c-myc) tag (SEQ ID NO: 84), SL2-tag (SEQ ID NO: 80), LSL-tag (SEQ ID NO: 82) and "FLAG" tag (SEQ ID NO: 83). In one embodiment, the fusion polypeptide comprises an amino acid sequence capable of binding to silica. In one embodiment, the fusion polypeptide comprises an amino acid sequence selected from SEQ ID NO: 80, SEQ ID NO: 82, and an amino acid sequence having at least 80% identity with SEQ ID NO: 80 or 82, for example, wherein the amino acid sequence is SEQ ID NO: 80 or 82. In one embodiment, the amino acid sequence is capable of binding to silica SEQID NO: 80. In another embodiment, the amino acid sequence is capable of binding to silicon dioxide SEQ ID NO:82.

[0188] As the skilled artisan will appreciate, the construction of fusion polypeptides often, but not always, involves the use of linkers between the functional parts to be fused. The skilled artisan is aware of different types of linkers with different properties, such as flexible amino acid linkers, rigid amino acid linkers, and cleavable amino acid linkers. Linkers have been used, for example, to increase the stability of fusion polypeptides or improve their folding, increase expression, improve biological activity, achieve targeting, and alter the pharmacokinetics of fusion polypeptides.

[0189] Thus, in one embodiment of the first aspect, there is provided an immunogenic composition comprising a fusion polypeptide as disclosed herein, or in one embodiment of the second aspect, there is provided a fusion polypeptide comprising at least one linker selected from the group consisting of a flexible amino acid linker, a rigid amino acid linker and a cleavable amino acid linker. It should be understood that in the immunogenic composition, any one or more fusion polypeptides present may comprise at least one linker. The skilled person will understand that the presence of a linker disposed between two polypeptide fragments does not exclude the presence of additional linkers between other polypeptide fragments.

[0190] Flexible linkers are often used in the art when the linked domains require a certain degree of mobility or interaction, and can be used in some embodiments of fusion polypeptides as described herein. Such linkers are typically composed of small, non-polar (e.g., G) or polar (e.g., S or T) amino acids. Some flexible linkers are composed primarily of stretches of G and S residues, such as (GGGGS) p and (SSSSG) p (wherein GGGGS corresponds to SEQ ID NO: 104, and SSSSG corresponds to SEQ ID NO: 105). Adjusting the copy number "p" allows optimization of the linker to achieve appropriate separation between functional parts or to maintain necessary inter-part interactions. In addition to G and S linkers, other flexible linkers are known in the art, such as G and S linkers containing additional amino acid residues (e.g., T, A, K, and E) to maintain flexibility, and polar amino acid residues to improve solubility.

[0191] Additional non-limiting examples of linkers include GGGGSLVPRGSGGGGS (SEQ ID NO:85), (GS)3 (SEQ ID NO:86), (GS)4 (SEQ ID NO:87), (GS)8 (SEQ ID NO:88), GGSGGMGSGG (SEQ ID NO:89), GGSGGSGGSGG (SEQ ID NO:90), GGSGG (SEQ ID NO:90) NO:91), GGSGGGGG (SEQ ID NO:92), GGGSEGGGSEGGGSEGGG (SEQ ID NO:93), AAGAATAA (SEQ ID NO:94), GGGGG (SEQ ID NO:95), GGSSG (SEQ ID NO:96), GSGGGTGGGSG (SEQ ID NO:97), GSGGGTGGGSG (SEQ ID NO:97) NO:98), GT, GSGSGSGSGGSG (SEQ ID NO:99), GSGGSGGSGGSGGS (SEQ ID NO: 100) and GSGGSGSGGSGGSG (SEQ ID NO: 101). The skilled person will know other suitable linkers.

[0192] In one embodiment, the linker is a flexible linker comprising glycine (G), serine (S) and / or threonine (T) residues. In one embodiment, the linker has a n S m ) p and (S m G n ) pwherein independently, n=1-7, m=0-7, n+m≤8 and p=1-7. In one embodiment, n=1-5. In one embodiment, m=0-5. In one embodiment, p=1-5. In a more specific embodiment, n=4, m=1, and p=1-4. In one embodiment, the linker is selected from the group consisting of S4G, (S4G)3 and (S4G)4. In one embodiment, the linker is selected from the group consisting of G4S and (G4S)3. In a specific embodiment, the linker is G4S, and in another embodiment, the linker is (G4S)3. In one embodiment, the linker has the general formula (G e T f ) q , wherein independently, e=1-3, f=1-3, and q=1-4. In one embodiment, q=1-3. In a more specific embodiment, e=1, f=1 and q=1-3. In one embodiment, the linker is selected from the group consisting of: GT, (GT)2 and (GT)3. In one embodiment, the linker is GT. In one embodiment, the linker is EF.

[0193] In a third aspect of the present disclosure, a polynucleotide encoding an immunogenic polypeptide for use as defined herein, an immunogenic polypeptide fragment as described herein, or a fusion polypeptide as described herein is provided. The present disclosure also encompasses expression vectors comprising the polynucleotide and host cells comprising the expression vector. Also encompassed is a method of producing an immunogenic polypeptide, an immunogenic polypeptide fragment, or a fusion polypeptide, the method comprising: culturing the host cell under conditions that allow expression of the polypeptide from its expression vector, and isolating the polypeptide. Alternatively, the immunogenic polypeptide, immunogenic polypeptide fragment, or fusion polypeptide of the present disclosure may alternatively be produced by non-biological peptide synthesis using amino acids and / or amino acid derivatives having protected reactive side chains, the non-biological peptide synthesis comprising

[0194] - stepwise coupling of amino acids and / or amino acid derivatives to form a polypeptide according to the first, second or third aspect with protected reactive side chains,

[0195] - Remove protecting groups from reactive side chains of polypeptides, thereby

[0196] - Obtaining the polypeptide in aqueous solution.

[0197] It should be understood that due to the unstructured nature of the fusion polypeptide according to the second aspect, the method for producing the polypeptide may include, for example, a step comprising heating the polypeptide, such as a step for isolating or purifying the fusion polypeptide. Therefore, in one embodiment, a method for producing a fusion polypeptide as defined herein is provided, wherein the method comprises heating the fusion polypeptide to about 100°C.

[0198] It should be understood that the polypeptide components of the immunogenic compositions described herein can be separated or purified from Streptococcus suis. Alternatively, they can be produced according to recombinant technology. Therefore, in one embodiment, an immunogenic composition is provided, which comprises one or more recombinantly produced fusion polypeptides. The technician should understand that for the purpose of recombinant production, it may be beneficial to produce shorter polypeptides (e.g., fragments of full-length proteins or fragments derived from full-length proteins) compared to polypeptides corresponding to the full-length proteins in terms of cost. In addition, it should be understood that in order to reduce production costs, it may also be beneficial to produce a polypeptide chain instead of two or more polypeptide chains. For example, it may be beneficial to produce a polypeptide chain comprising a fusion of several immunogenic polypeptide fragments instead of producing the several immunogenic polypeptide fragments separately.

[0199] The skilled person will appreciate that the fusion polypeptides described herein according to the second aspect can be used in an immunogenic composition. Such a composition may comprise one, two, three or all four of the fusion polypeptides according to the second aspect. In addition, the immunogenic composition may further comprise an additional fusion polypeptide comprising at least one, such as at least two, such as at least three of SEQ ID NOs: 34-36 or an amino acid sequence having at least 80% identity with any one of SEQ ID NOs: 34-36. For example, the additional fusion polypeptide may comprise SEQ ID NO: 46 or an amino acid sequence having at least 80% identity with SEQ ID NO: 46; or may comprise SEQ ID NO: 47 or an amino acid sequence having at least 80% identity with SEQ ID NO: 47. The additional fusion polypeptide may comprise SEQ ID NO: 107 or an amino acid sequence having at least 80% identity with SEQ ID NO: 107; or may comprise SEQ ID NO: 108 or an amino acid sequence having at least 80% identity with SEQ ID NO: 108. The further fusion polypeptide may be as defined as disclosed in the context of the first aspect, the details of which are not repeated here for the sake of brevity but will be understood to be relevant herein.

[0200] It will be appreciated by the skilled artisan that the fusion polypeptides described herein or the immunogenic compositions disclosed herein can be used as medicines, for example, as medicines for the preventive treatment of Streptococcus suis infection, for example, in vaccination. Therefore, in the fourth aspect of the present disclosure, a fusion polypeptide as defined herein is provided, which is used as a medicine. In another embodiment, the fusion polypeptide can be used for the preventive treatment of Streptococcus suis infection. In one embodiment, the preventive treatment is for Streptococcus suis infection selected from the group consisting of: infection caused by any of 35 identified serotypes of Streptococcus suis. In another embodiment, the infection is selected from the group consisting of: infection caused by any of serotypes 1, 2, 7, 9 and 1 / 2, for example, selected from the group consisting of: infection caused by any of serotypes 1, 2 and 7, for example, selected from the group consisting of: infection caused by serotypes 2 and 7. In one embodiment, the infection is caused by Streptococcus suis serotype 2, and in another embodiment, the infection is caused by Streptococcus suis serotype 7. In one embodiment, a fusion polypeptide as described herein for use in the prophylactic treatment of Streptococcus suis infection is provided, which fusion polypeptide is effective in the prophylactic treatment of infection caused by any one of the following: at least 2, such as at least 3, such as at least 5, such as at least 7, such as at least 10 of the 35 identified serotypes.

[0201] The skilled person will appreciate that any of the above fusion polypeptides may be used in an immunogenic composition, for example in an immunogenic composition according to the first aspect as disclosed herein. Specifically, the immunogenic composition may comprise at least one, for example two or three, fusion polypeptides as disclosed in the second aspect of the present invention. In one embodiment, an immunogenic composition is provided, comprising at least one fusion polypeptide according to the second aspect disclosed herein. As explained in more detail above, the fusion polypeptide is isolated or purified. The fusion polypeptide may be recombinantly produced.

[0202] It will be appreciated that the selection of suitable immunogenic polypeptides and fragments thereof is by no means trivial, and in addition, the selection of their combination in a fusion polypeptide adds an additional degree of complexity. Immunogenic polypeptides and immunogenic polypeptide fragments must be selected taking into account the identity of the polypeptide, the identity of its fragments, the individual functionality of the polypeptides and fragments thereof (e.g., protease activity), their potential interactions (e.g., in terms of degradation), their in vivo and in vitro stability in the form of fusion polypeptides, their in vivo and in vitro solubility in the form of fusion polypeptides, their immunogenic properties, their ability to elicit an antibody response of the desired kind, and their protective properties, to name a few.

[0203] The skilled person is aware of the fact that, in order to induce an immune response in a subject, an agent having adjuvant properties may be provided to the subject together with one or more immunogenic polypeptides, fragments or fusion polypeptides. Therefore, in one embodiment, the immunogenic composition described herein further comprises an agent having an adjuvant effect. In particular, the agent having an adjuvant effect may be present in an immunologically effective amount.

[0204] It should be understood that the immunogenic compositions disclosed herein can be used as medicines. Therefore, the related aspects of the present disclosure provide immunogenic compositions for use as medicines. In one embodiment, the immunogenic composition can be used for the prophylactic treatment of Streptococcus suis infection. In one embodiment, the prophylactic treatment is for Streptococcus suis infection selected from the group consisting of: infection caused by any of the 35 identified serotypes of Streptococcus suis. In another embodiment, the infection is selected from the group consisting of: infection caused by any one of serotypes 1, 2, 7, 9 and 1 / 2, for example, selected from the group consisting of: infection caused by any one of serotypes 1, 2 and 7, for example, selected from the group consisting of: infection caused by serotypes 2 and 7. In one embodiment, the infection is caused by Streptococcus suis serotype 2, and in another embodiment, the infection is caused by Streptococcus suis serotype 7. In one embodiment, a fusion polypeptide as described herein for use in the prophylactic treatment of Streptococcus suis infection is provided, which fusion polypeptide is effective in the prophylactic treatment of infection caused by any one of the following: at least 2, such as at least 3, such as at least 5, such as at least 7, such as at least 10 of the 35 identified serotypes.

[0205] Therefore, in a fifth aspect of the present disclosure, a vaccine composition comprising an immunogenic composition as defined herein and a pharmaceutically acceptable carrier or excipient is provided. The vaccine can be used for preventive treatment of Streptococcus suis infection, as described above for the immunogenic composition. In one embodiment, the vaccine composition further comprises an adjuvant. In one embodiment, the vaccine composition further comprises an immunologically effective amount of an adjuvant.

[0206] As used herein, the term "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drug stabilizers, binders, excipients, disintegrants, lubricants, sweeteners, flavorings, dyes, etc. and combinations thereof as will be known to those skilled in the art (see, e.g., Alfonso R Gennaro, Remington: The Science and Practice of Pharmacy. 20th edition, ISBN: 0683306472). Examples of pharmaceutically acceptable carriers include, but are not limited to, sugars such as lactose, glucose and sucrose; starches (e.g., corn starch and potato starch); cellulose and its derivatives such as sodium carboxymethylcellulose, ethylcellulose, cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, soybean oil; glycols such as propylene glycol; esters such as ethyl oleate, ethyl laurate; agar; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethanol and phosphate buffer solutions, and other nontoxic compatible lubricants such as sodium lauryl sulfate and magnesium stearate.

[0207] As used herein, the term "immunologically effective" refers to an amount of an adjuvant sufficient to increase the immunogenicity of a vaccine to a level sufficient to effectively vaccinate a typical patient.

[0208] As described above, the immunogenic compositions disclosed herein and / or the vaccine compositions disclosed herein may include an immunologically effective amount of an agent with an adjuvant effect. Suitably, the adjuvant stimulates systemic or mucosal immunity. The technician knows suitable adjuvants. Non-limiting examples of suitable adjuvants in the context of the present disclosure include polymers of acrylic acid or methacrylic acid, maleic anhydride and alkenyl derivative polymers, immunostimulatory sequences (ISS), oil-in-water emulsions, cationic lipids containing quaternary ammonium salts, cytokines, aluminum hydroxide or aluminum phosphate, saponin or nanoparticles, or any combination or mixture thereof. Further examples of suitable adjuvants can also be found in the literature cited in WO 2007 / 115059.

[0209] Suitable adjuvants for use according to the present invention are adjuvants Matrix V, Abisco / Matrix M, Matrix C or Matrix Q from Novavax, Sweden. Another suitable adjuvant is ginseng. Ginseng is a dry extract prepared from the root of the plant ginseng (Panaxginseng, CA Meyer). Ginseng contains a variety of active substances, called ginsenosides, which are a class of saponins, triterpene glycosides of the dammarane series chemically. Ginsenosides have adjuvant properties, and one of the most active adjuvants is a component called Rb1. It has been shown that fraction Rb1 triggers balanced Th1 and Th2 immune responses, as determined by measuring the levels of cytokines IFN-γ, IL-2, IL-4, and IL-10 secreted after vaccination with Rb1 adjuvanted vaccines. In addition, ginseng and Rb1 fractions can stimulate strong antigen-specific antibody responses.

[0210] In one embodiment, the agent having an adjuvant effect is selected from the group consisting of: polymers of acrylic acid or methacrylic acid, polymers of maleic anhydride and alkenyl derivatives, immunostimulatory sequences (ISS), oil-in-water emulsions, cationic lipids containing quaternary ammonium salts, cytokines, aluminum hydroxide, aluminum phosphate, saponin, nanoparticles, silica, Matrix V, Abisco / Matrix M, Matrix C, Matrix Q and silica. In a specific embodiment, the agent having an adjuvant effect is Matrix V.

[0211] In a specific embodiment, the agent having an adjuvant effect is selected from the group consisting of: polymers of acrylic acid or methacrylic acid, polymers of maleic anhydride and alkenyl derivatives, immunostimulatory sequences (ISS), oil-in-water emulsions, cationic lipids containing quaternary ammonium salts, cytokines, aluminum hydroxide, aluminum phosphate, saponin, nanoparticles and silica. In one embodiment, the agent is selected from the group consisting of: Matrix V, Abisco / Matrix M, Matrix C and Matrix Q. In a specific embodiment, the agent having an adjuvant effect is Matrix V.

[0212] The vaccine compositions of the present disclosure are formulated in a form suitable for physiological administration. Thus, in one embodiment, there is provided a vaccine composition as described herein, formulated for intramuscular, subcutaneous, intradermal or intranasal administration, for example for intramuscular administration.

[0213] In one embodiment, a vaccine composition as described herein is capable of eliciting a serum and / or mucosal antibody response in a mammalian subject (e.g., a pig or human subject, e.g., a pig subject) after administration. In one embodiment, the antibody response is in the form of IgG, IgA, and / or IgM antibodies in serum and / or mucosa and / or colostrum.

[0214] In one embodiment of this aspect, a vaccine composition as described above is provided, which is used for prophylactic treatment of a mammalian subject, such as a human subject or a porcine subject, such as a porcine subject, susceptible to infection by S. suis. According to one embodiment, the vaccine composition is a vaccine that protects susceptible mammalian subjects (such as humans or porcine subjects) from infection caused by S. suis.

[0215] Suitably, the vaccine compositions of the invention stimulate serum, mucosal and / or bronchial antibody responses against S. suis antigens in a mammalian subject susceptible to these bacteria, for example in a human or porcine subject (eg a pig subject).

[0216] As described above, the present disclosure provides a vaccine composition comprising a fusion polypeptide, which has been prepared according to the present method using Escherichia coli as a host cell (however, other host cells can be used). If a method for expressing and purifying it is developed, the source of the fusion polypeptide can also be natural bacteria. Alternatively, a fusion strategy in which various parts of the corresponding antigens are recombined can be used to produce a fusion polypeptide consisting of parts from different immunogenic polypeptides as described herein. This fusion strategy can also be suitable for introducing one or more immunoreactive parts, such as T cell epitopes or attenuated toxins (or parts thereof), thereby introducing other features suitable for optimizing antigen presentation or positioning.

[0217] In a sixth aspect, the present disclosure also relates to a method for producing antiserum or colostrum, the method comprising: administering an immunogenic composition as described herein to a mammalian host to produce antibodies in the host, and recovering antiserum or colostrum containing the antibodies produced in the animal host. Antiserum or colostrum obtainable by the method is also within the scope of the present disclosure. It is envisioned that antiserum or colostrum can be administered to a subject in need, such as a mammalian subject susceptible to Streptococcus suis infection. For example, the colostrum can be administered by feeding piglets from unvaccinated sows, wherein the piglets do not receive protective antibodies against Streptococcus suis infection by sucking milk from the sows that gave birth to them.

[0218] In addition, as will be appreciated by those skilled in the art, antibodies may be recovered from the antiserum or colostrum. Therefore, the disclosure also encompasses an antibody or fragment thereof that can bind to a fusion polypeptide as defined herein, the antibody or fragment thereof being polyclonal or monoclonal. Antibody preparations comprising an antibody or several antibodies or fragments thereof are also encompassed. And the antibody preparations used as medicines, for example, for preventive treatment of mammalian subjects susceptible to infection by Streptococcus suis.

[0219] The scope of the present disclosure also encompasses antibody preparations comprising at least one, and suitably at least two, antibodies specific for a component of an immunogenic composition as described herein, the antibody / antibodies being polyclonal or monoclonal; or the preparations comprising fragments of said antibodies. It is contemplated that the preparations may be used prophylactically against Streptococcus suis and provide passive immunity when administered to a mammalian subject susceptible to Streptococcus suis infection.

[0220] Therefore, in one embodiment of the seventh aspect of the present disclosure, an antibody or fragment thereof is provided, which is specific for a fusion polypeptide as described herein, and the antibody or fragment thereof is polyclonal or monoclonal. In another embodiment, an antibody preparation comprising one of several of the antibodies is provided.

[0221] Related hereto is a method for prophylactically treating an infection with Streptococcus suis in a mammalian subject, the method comprising: passively immunizing the mammalian subject in need thereof by administering the antibody preparation.

[0222] Therefore, in one aspect, an immunologically effective amount of an immunogenic composition as described above, a fusion polypeptide as described above, a vaccine composition as described above, an antiserum or colostrum obtainable by the above method, or an antibody preparation as described above is provided for use as a medicament. In particular, an immunologically effective amount of an immunogenic composition as described above, a fusion polypeptide as described above, a vaccine composition as described above, an antiserum or colostrum obtainable by the above method, or an antibody preparation as described above is provided for prophylactic treatment of a mammalian subject, such as a human subject or a pig subject, such as a pig subject, susceptible to infection by Streptococcus suis.

[0223] In one embodiment, the use comprises administration at a single occasion or at multiple independent occasions. Specifically, the use can include administration to a piglet, a gilt, or a sow. In one embodiment, the administration is administration to a gilt or a sow. In one embodiment, the administration is administration to a piglet.

[0224] The administration may be intramuscular, intradermal, subcutaneous or intranasal. Thus, in one embodiment, the administration is selected from the group consisting of: intramuscular, intradermal, subcutaneous or intranasal. In one embodiment, the administration is intramuscular.

[0225] In some embodiments, after the administration of the immunogenic composition as described above, the fusion polypeptide as described above, or the vaccine composition as described above, a serum and / or mucosal antibody response is elicited in the mammalian subject. In particular, the antibody response may be in the form of IgG, IgA, and / or IgM antibodies in the serum and / or mucosa. Thus, in some embodiments of the use, the use comprises administering an immunologically effective amount of the immunogenic composition, the fusion polypeptide, the vaccine composition, the antiserum, the colostrum, or the antibody preparation on a single occasion.

[0226] In other embodiments, the use includes administering an immunologically effective amount of the immunogenic composition, the fusion polypeptide, the vaccine composition, the antiserum, the colostrum or the antibody preparation at multiple independent opportunities (e.g., two, three, four or more independent opportunities). In one embodiment, use includes administering at two independent opportunities. In one embodiment, the administration is the administration of the immunogenic composition or the vaccine composition, such as the administration of the vaccine composition. In one embodiment, the multiple independent opportunities are at least 2 weeks apart, such as 3-6 weeks apart, such as 3-5 weeks apart, such as 3-4 weeks apart, such as 3 weeks or 4 weeks apart. In one embodiment, the administration is performed at two or three independent opportunities. The opportunity can be, for example, at least about one week apart, such as at least about two weeks apart, such as at least about three weeks apart, such as at least about four weeks apart. In a specific embodiment, the administration is about three weeks apart.

[0227] In one embodiment, the administration is an effective amount of the immunogenic composition, the fusion polypeptide or the vaccine composition, which elicits an immune response that leads to protection. In one embodiment, the administration is an antiserum, colostrum or antibody preparation in an amount that produces protection. The immunogenic composition or vaccine composition can be administered in a dose so that the amount of each fusion polypeptide is immune effective. In a specific embodiment, the dosage range of the administration is about 4 μg-300 μg per fusion polypeptide. For example, the administration can be in the range of about 10 μg to 300 μg per fusion polypeptide, for example, in the range of about 10 μg to 250 μg per fusion polypeptide, for example, in the range of about 10 μg to 200 μg per fusion polypeptide, for example, in the range of about 50 μg to 150 μg per fusion polypeptide, for example, in the range of about 60 μg to 140 μg per fusion polypeptide, for example, in the range of about 70 μg to 130 μg per fusion polypeptide, for example, in the range of about 80 μg to 120 μg per fusion polypeptide. In one embodiment, the dosage is in the range of about 90 μg-110 μg per fusion polypeptide, such as about 100 μg.

[0228] In one embodiment, the administration is to a piglet, gilt or sow, such as a pregnant gilt or sow. In one embodiment, at least one administration is to a non-pregnant gilt or sow. In one embodiment, at least one administration is to a pregnant gilt or sow.

[0229] In the case where a single priming dose induces sufficient immune protection levels, the administration to the piglet can be between days 1-28 after birth. For example, the administration can be during the first week after birth, for example, on day 4 after birth. Alternatively, the administration can also be performed during weeks 2, 3 or 4 after birth. Therefore, in one embodiment, the administration to the piglet at a single opportunity is during any week of 1-4 weeks postpartum, for example, any week of 2-4 weeks postpartum, for example, any week of 3-4 weeks postpartum, for example, during week 3 or week 4 postpartum. In one embodiment, the administration is performed during the first week after birth.

[0230] In embodiments where a priming dose and a booster dose are administered, the first administration to the piglet may be during the 2nd to 4th week after birth, e.g., during the 3rd to 4th week after birth. In one embodiment, the administration is performed during the 1st week after birth. In such embodiments, the second administration to the piglet is at least 2 weeks, e.g., 3 or 4 or 5 weeks, after the first administration as described above. For example, the second administration to the piglet may be performed during the 6th to 8th week after birth.

[0231] Utilizing immunogenic composition as described herein, fusion polypeptide or vaccine composition can be beneficial, wherein to sow or gilt, apply described immunogenic composition, fusion polypeptide or vaccine composition, to protect piglet from infection caused by Streptococcus suis by taking colostrum from described sow or gilt.Therefore, in another embodiment of purposes disclosed herein, described application is to apply to gestation or non-gestation sow or gilt at one, or two, or three opportunities, for example, to obtain immune response in colostrum at parturition.For example, such application can be carried out twice or three times.In one embodiment, applying for the first time is to apply to gestation sow or gilt about 6-8 weeks before parturition, and applying for the second time is about 2-4 weeks before parturition.In one embodiment, applying for the first time is to apply to gestation sow or gilt about 9-10 weeks before parturition, and applying for the second time is about 7-6 weeks before parturition, and applying for the third time is about 4-3 weeks before parturition. In one embodiment, the first administration is to a pregnant sow or gilt about 9 weeks before farrowing, the second administration is about 6 weeks before farrowing, and the third administration is about 3 weeks before farrowing. "About" with respect to the administration time points discussed herein should be interpreted as meaning within the range of less than 1 week, such as less than 4 days, of the weeks before farrowing.

[0232] In one embodiment, the purposes include administering an immunologically effective amount of the immunogenic composition, the fusion polypeptide or the vaccine composition to a sow or a gilt (e.g., a pregnant sow or a gilt) to preventively treat a piglet susceptible to infection with Streptococcus suis. In one embodiment, the administration is performed at three separate times. In this way, an immune response in colostrum during parturition is obtained. In one embodiment, the piglet obtains protective antibodies through colostrum after birth. In one embodiment, the antibody is a protective antibody that confers protection against infection with Streptococcus suis, such as antibodies to one or more antigens in the antigens present in the immunogenic composition, fusion polypeptide or the vaccine composition as defined herein.

[0233] In one embodiment, the piglet is protected at least at 3 weeks of age, for example at 4 weeks of age, for example at 6 weeks of age, for example at 7 weeks of age, for example at 8 weeks of age, for example at 9 weeks of age, for example at 10 weeks of age or longer.Piglet is usually infected with Streptococcus suis from birth, but becomes the most susceptible to disease impact after 3 to 4 weeks of age weaning, and when 10-12 weeks of age, this animal suffers much less problem of infecting associated with Streptococcus suis usually.Therefore, at about 4-12 weeks of age or about 4-10 weeks of age, piglet is particularly susceptible to infection.As shown in the attached example, compared with control animals, the piglet that stands the stimulation of Streptococcus suis at 4 weeks of age or 7 weeks of age shows the protection of significant level and the clinical score of improvement.

[0234] Non-pregnant gilts or sows can receive vaccination with at least one dose (e.g., two doses), and then booster doses can be provided to pregnant gilts or sows 2 weeks before farrowing. Therefore, vaccination (first and potential first booster dose) is applied to non-pregnant animals, and once pregnancy, the same animal is made to receive booster doses (as the first or second booster doses) before farrowing. It is expected that this will maximize the immune response of piglets in colostrum, and reduce the shedding of Streptococcus suis in sows. For example, gilts can be inoculated with a primary immunization dose when about 6 months old, and then inoculated with a booster dose after 3 to 6 weeks. Gilts or sows can then be inseminated, and will receive a third vaccination (the second booster dose) after about 3 months and 1 week (which corresponds to about 2 weeks before farrowing). Therefore, in one embodiment, the immunogenic composition, the fusion polypeptide or the vaccine composition for use as described herein is provided, wherein the use comprises: administering an immunologically effective dose of the immunogenic composition, the fusion polypeptide or the vaccine composition to a gilt or sow in a non-pregnant state at least once, and administering an additional immunologically effective dose to a gilt or sow in a pregnant state at least once. In one embodiment, the use comprises administering twice to a gilt or sow in a non-pregnant state. In one embodiment, when the first effective dose is administered, the non-pregnant gilt is about 4-8 months, such as 5-7 months, such as about 6 months. In one embodiment, the second dose is administered approximately after about 3-7 weeks, such as after about 3, 4, 5, 6 or 7 weeks. In one embodiment, the use comprises administering an additional effective dose after insemination of a gilt or sow, thereby administering to a gilt or sow in a pregnant state. The administration of the additional effective dose can be about 2 weeks before farrowing. In this way, an immune response in colostrum at parturition is obtained. In one embodiment, the piglets obtain protective antibodies after birth via colostrum.

[0235] As described above, the dosage range of the administration is about 4 μg-300 μg per fusion polypeptide. For example, the administration can be in the range of about 10 μg to 300 μg per fusion polypeptide, for example, in the range of about 10 μg to 250 μg per fusion polypeptide, for example, in the range of about 10 μg to 200 μg per fusion polypeptide, for example, in the range of about 50 μg to 150 μg per fusion polypeptide, for example, in the range of about 60 μg to 140 μg per fusion polypeptide, for example, in the range of about 70 μg to 130 μg per fusion polypeptide, for example, in the range of about 80 μg to 120 μg per fusion polypeptide. In one embodiment, the dosage is in the range of about 90 μg-110 μg per fusion polypeptide, for example, about 100 μg.

[0236] In an eighth aspect of the present disclosure, a method for prophylactically treating Streptococcus suis infection in a mammalian subject is provided, the method comprising: administering an immunologically effective amount of an immunogenic composition as described above, a fusion polypeptide as described above, a vaccine composition as described above, an antiserum or colostrum as obtainable by the above method, or an antibody preparation as described above to the mammalian subject in need thereof. In one embodiment, the mammalian subject is a pig or human subject, such as a pig subject.

[0237] Technicians will appreciate that many vaccines need to be administered more than one dose to elicit a protective immune response. The first dose administered to a naive subject is commonly referred to as a primary immunization dose, which guides the immune system to recognize foreign antigens. In some cases, a single primary immunization dose can cause enough protective immunity levels. However, in other cases, a primary immunization dose may not cause a protective immunity level. Therefore, after the primary immunization dose, the same vaccine may be administered once or several times to increase the intensity of the antigen-specific immune response. These subsequently administered doses are referred to as booster doses. Suitably, the immune response elicited is in the form of IgG, IgA and / or IgM antibodies in the mucus and / or serum of a piglet or sow / gilt and / or sow colostrum.

[0238] In related aspects as disclosed herein, a method for preventive treatment of Streptococcus suis infection in a mammalian subject is provided, the method comprising: administering an immunologically effective amount of an immunogenic composition, fusion polypeptide, vaccine composition, antiserum or colostrum, or antibody preparation as disclosed herein to the mammalian subject in need. It should be understood that the embodiments disclosed in the context of the first or second medical use according to this disclosure are equally relevant for the method for preventive treatment of Streptococcus suis infection, and will not be repeated for the sake of brevity but only briefly mentioned. In one embodiment, a method for preventive treatment is provided, wherein the mammalian subject is a pig or human subject, such as a pig subject.

[0239] In one embodiment, the method includes administration at a single opportunity or at multiple independent opportunities. In one embodiment, the administration is administered to a piglet, a gilt or a sow, such as a pregnant gilt or a sow or a non-pregnant gilt or a sow. The administration can be intramuscular, intradermal, subcutaneous or intranasal administration, such as intramuscular administration. In one embodiment, wherein the administration is the administration of an immunogenic composition, a fusion polypeptide or a vaccine composition, after which serum and / or mucosal antibody responses are elicited in the mammalian subject. In particular, the antibody response is in the form of IgG, IgA and / or IgM antibodies in serum and / or mucosa and / or colostrum. In one embodiment, the method includes administering an effective amount of the immunogenic composition, the fusion polypeptide or the vaccine composition to a sow or a gilt (such as a pregnant sow or a gilt) to preventively treat a piglet susceptible to infection by Streptococcus suis. In one embodiment, the administration is performed at three independent opportunities.

[0240] In a specific embodiment, a method for the preventive treatment of piglets susceptible to Streptococcus suis infection is provided, the method comprising the following steps: administering an immunologically effective amount of the immunogenic composition as described above, the fusion polypeptide as described above, and the vaccine composition as described above to pregnant gilts or sows at least two (e.g., at least three) independent times. In this way, an immune response in colostrum during delivery is obtained. In one embodiment, the piglets obtain protective antibodies through colostrum after birth. In addition, a method for the preventive treatment of piglets susceptible to Streptococcus suis infection is provided, the method comprising the following steps: administering an immunologically effective amount of the immunogenic composition as described above, the fusion polypeptide as described above, and the vaccine composition as described above to gilts or sows in a non-pregnant state at least one or at least two independent times, and administering an immunologically effective amount of the immunogenic composition as described above, the fusion polypeptide as described above, and the vaccine composition as described above to the gilts or sows in a pregnant state at least once before farrowing. For example, for example, about 4-1 weeks before farrowing, for example, about 3-2 weeks. The immunogenic composition or vaccine composition can be administered in a certain dose so that the amount of each fusion polypeptide is immune effective. Therefore, in one embodiment, the dosage range of the administration is about 4 μg-300 μg per fusion polypeptide. For example, the administration can be in the range of about 10 μg to 300 μg per fusion polypeptide, such as about 10 μg to 250 μg per fusion polypeptide, such as about 10 μg to 200 μg per fusion polypeptide, such as about 50 μg to 150 μg per fusion polypeptide, such as about 60 μg to 140 μg per fusion polypeptide, such as about 70 μg to 130 μg per fusion polypeptide, such as about 80 μg to 120 μg per fusion polypeptide. In one embodiment, the dosage is in the range of about 90 μg-110 μg per fusion polypeptide, such as about 100 μg.

[0241] Furthermore, a method for prophylactically treating Streptococcus suis infection in a mammalian subject is provided, the method comprising: passive immunization by administering to the mammalian subject in need thereof an antibody preparation as disclosed herein or an antiserum or colostrum comprising the antibody as described herein.

[0242] In related aspects, a method for immunizing a mammalian subject against Streptococcus suis infection is provided, the method comprising: administering an immunologically effective amount of an immunogenic composition as defined herein, a fusion polypeptide as defined herein, a vaccine composition as defined herein, an antiserum or colostrum as defined herein, or an antibody preparation as defined herein to the mammalian subject in need. In one embodiment, the method comprises: administering an immunologically effective amount of an immunogenic composition as defined herein, a fusion polypeptide as defined herein, or a vaccine composition as defined herein to the mammalian subject in need. It should be understood that all embodiments defined above regarding aspects of the method for prophylactic treatment of Streptococcus suis infection in a mammalian subject are equally relevant to the method for immunization according to this aspect.

[0243] In yet another aspect of the present disclosure, there is provided the use of an immunogenic composition, fusion polypeptide, vaccine composition, antiserum, colostrum or antibody preparation as described herein for the manufacture of a medicament for the prophylactic treatment of a mammalian subject susceptible to infection by Streptococcus suis. The skilled person will appreciate that the embodiments discussed with respect to the fourth to eighth aspects disclosed herein are equally relevant to this aspect.

[0244] Although the present invention has been described with reference to various exemplary aspects and embodiments, it will be appreciated by those skilled in the art that various changes may be made and its elements may be replaced with equivalents without departing from the scope of the present invention. In addition, many modifications may be made to adapt specific situations or molecules to the teachings of the present invention without departing from the essential scope of the present invention. Therefore, it is intended that the present invention is not limited to any particular embodiment contemplated, but that the present invention will include all embodiments falling within the scope of the appended claims.

[0245] Reference List

[0246] Mészáros et al. (2018) Nucleic Acids Research; 46(W1):W329-W337.

[0247] and Dosztányi(2020)Current Protocols in Bioinformatics;70(1):e99.

[0248] Fittipaldi et al.(2012),Future Microbiol.7(2);259-279.

[0249] Rasmussen and Andresen(1998),Int.J.Syst.Bacteriol.48,1063-1065,

[0250] Berthelot-Herault et al. (2005)Can J Vet Res.Jul;69(3):236-40.

[0251] Quessy et al. (1995) Infect Immun. May; 63(5):1975-9.

[0252] Vecht et al. (1992) Infect Immun. Feb; 60(2):550-6.

[0253] Li et al. (2011) FEMS Micro Letters 316:115-122.

[0254] Gómez-Gascóna et al. (2012), Journal of Proteomics Oct 22;75(18):5654-66.

[0255] Seele et al.(2015)Vaccine,33,2207-2212.

[0256] MacRaild C et al.(2016)Structure,Jan 5;24(1):148-157.

[0257] Kebede et al. (1990), Vet. Microbiol. 22: 249-257

[0258] Liu et al.(2014)The Journal of Infectious Diseases,Vol 210,Issue 1,p.35-45 BRIEF DESCRIPTION OF THE DRAWINGS

[0259] Figure 1 is a schematic diagram of the five fusion peptides selected as vaccine candidates.

[0260] Figure 2A -E shows the results of stability studies of fusion polypeptides SP274C-S, BCA, 4Zn+3, 5AsL and 3PCS corresponding to SEQ ID NOs: 52, 49, 50, 51 and 54, respectively.

[0261] FIG3 shows the results of immunizing rabbits with SP274C-S, BCA, 4Zn+3, and 5AsL corresponding to SEQ ID NOs: 52, 49, 50, and 51. Figure 3A SDS PAGE gels of fusion polypeptides and single proteins are shown; Figure 3B and 3C Western blot results of pre- and post-immune sera are shown.

[0262] Figure 4 . Shown are the results of sow immunization, transfer of immunoglobulins to piglets, and piglet immunization by measuring the amount of antibodies against components of Piggivac4.

[0263] Figure 5 Figure 2 is the Kaplan-Meier survival curve for piglets from Group 3 and Group 4. The data showed that more piglets from Piggivac4-vaccinated sows reached the study endpoint 7 days after challenge.

[0264] Figure 6 is a graph of the mean rectal temperatures of piglets from Groups 3 and 4. Arrows indicate the time of challenge and significant differences are highlighted. The data show that piglets from Piggivac4-vaccinated sows had significantly lower rectal temperatures on days 1 and 2 post-challenge.

[0265] Figure 7 are Kaplan-Meier survival curves for piglets without fever (defined as rectal temperature ≥ 40°C for two of three consecutive observations) in Groups 3 and 4. The data show that the onset of rectal temperature rise was also significantly delayed in piglets from Piggivac4-vaccinated sows compared to the control group.

[0266] Figure 8 is a graph showing a comparison of the behavior scores of piglets from Group 3 and Group 4 after challenge. The arrow indicates the time of challenge. The data show that piglets from sows vaccinated with Piggivac4 had lower behavior scores after challenge.

[0267] Fig. 9 are the Kaplan-Meier survival curves for piglets in groups 3 and 4 with demeanor scores below 2 (two out of three consecutive observations).

[0268] Fig.10 is a graph showing a comparison of CNS scores of piglets from Group 3 and Group 4 after challenge. Arrows indicate the time of challenge. The data show that piglets from sows vaccinated with Piggivac4 had lower CNS scores after challenge.

[0269] Fig.11are the Kaplan-Meier survival curves for piglets in groups 3 and 4 with CNS scores less than 1 (two out of three consecutive observations).

[0270] Fig.12 is a graph showing a comparison of activity scores of piglets from Group 3 and Group 4 after challenge. Arrows indicate the time of challenge. The data show that piglets from sows vaccinated with Piggivac4 had lower activity scores after challenge.

[0271] Fig.13 are the Kaplan-Meier survival curves for piglets in groups 3 and 4 with activity scores below 1 (two out of three consecutive observations).

[0272] Fig.14 is a graph showing a comparison of total clinical scores of piglets from Group 3 and Group 4 after challenge. Arrows indicate the time of challenge. The data show that piglets from sows vaccinated with Piggivac4 had lower total clinical scores after challenge.

[0273] Fig.15 are the Kaplan-Meier survival curves for piglets in groups 3 and 4 with a total score below 5 (two out of three consecutive observations).

[0274] Fig.16 Kaplan-Meier survival curves for piglets from Groups 3 and 4 are shown. Piglets were euthanized after reaching the humane endpoint. The data showed that piglets from sows vaccinated with Piggivac5 tended to take longer to reach the humane endpoint.

[0275] Fig.17 Mean rectal temperatures are shown for piglets from Groups 3 and 4. Significant differences are highlighted. The data show that piglets from Piggivac5-vaccinated sows had significantly lower body temperatures up to 6 days post-challenge.

[0276] Fig.18 are Kaplan-Meier survival curves showing the proportion of piglets without fever (defined as rectal temperature ≥ 40.5°C) over time in Groups 3 and 4. The data showed that piglets from Piggivac5-vaccinated sows had a significant delay in the onset of fever (P=0.00003).

[0277] Fig.19 Comparison of behavior scores of piglets from Group 3 and Group 4 after challenge is shown. Significant differences are highlighted. The data show that piglets from Piggivac5 vaccinated sows had significantly lower behavior scores up to 12 days after challenge.

[0278] Fig. 20are Kaplan-Meier survival curves showing the proportion of piglets with demeanor scores less than 1 in Groups 3 and 4 over time. The data show that piglets from Piggivac5-vaccinated sows had a highly significant delay in the onset of demeanor changes (P=0.000004).

[0279] Fig.21 Comparison of CNS scores of piglets from Group 3 and Group 4 after challenge is shown. Significant differences are highlighted. The data show that piglets from Piggivac5 vaccinated sows had significantly lower CNS scores up to 10 days after challenge.

[0280] Fig. 22 are Kaplan-Meier survival curves showing the proportion of piglets with a CNS score less than 1 in Groups 3 and 4. The data show that piglets from Piggivac5-vaccinated sows had a highly significant delay in the onset of changes in CNS signs (P=0.0005).

[0281] Fig.23 Comparison of activity scores of piglets from Group 3 and Group 4 after challenge is shown. Significant differences are highlighted. The data show that piglets from Piggivac5 vaccinated sows had significantly lower activity scores after challenge.

[0282] Fig.24 are Kaplan-Meier survival curves for the proportion of piglets with activity scores < 2 in groups 3 and 4. The data show that piglets from Piggivac5-vaccinated sows had a highly significant delay in the onset of changes in activity signs (P=0.003).

[0283] Fig.25 Comparison of total clinical scores of piglets from Group 3 and Group 4 post-challenge is shown. Significant differences are highlighted. The data show that piglets from Piggivac5 vaccinated sows had significantly lower total clinical scores up to 10 days post-challenge.

[0284] Fig.26 are Kaplan-Meier survival curves for the proportion of piglets with a total score below 5 in Groups 3 and 4. The data show that piglets from Piggivac5-vaccinated sows had a highly significant delay in the onset of changes in gross clinical signs (P=0.00006).

[0285] Fig. 27 Comparison of weights of piglets from Group 3 and Group 4 after challenge is shown. Significant differences are highlighted. The data show that piglets from Piggivac5 vaccinated sows gained significantly more weight within 14 days after challenge (P=0.03).

[0286] Fig.28 Kaplan-Meier survival curves for piglets from Groups 5 and 6 are shown. Piglets were euthanized after reaching the humane endpoint. The data showed that piglets from sows vaccinated with Piggivac5 tended to take longer to reach the humane endpoint.

[0287] Fig.29 Shown are the mean rectal temperatures of piglets from Groups 5 and 6. The data show that piglets from Piggivac5-vaccinated sows tended to have lower body temperatures after challenge.

[0288] Fig.30 are Kaplan-Meier survival curves showing the proportion of piglets without fever (defined as rectal temperature ≥ 41°C) over time in groups 5 and 6. The data show that the onset of fever tends to be delayed in piglets from sows vaccinated with Piggivac5.

[0289] Fig.31 Comparison of behavior scores of piglets from Group 5 and Group 6 post-challenge is shown. Significant differences are highlighted. The data show that piglets from Piggivac5 vaccinated sows had significantly lower behavior scores at 10 days post-challenge.

[0290] Fig.32 are Kaplan-Meier survival curves showing the proportion of piglets with demeanor scores below 3 in Groups 5 and 6 over time. The data show that piglets from Piggivac5-vaccinated sows had a significant delay in the onset of demeanor changes (P=0.01).

[0291] Fig.33 Comparison of CNS scores of piglets from Group 5 and Group 6 post-challenge is shown. Significant differences are highlighted. The data show that piglets from Piggivac5 vaccinated sows had significantly lower CNS scores on day 2 post-challenge.

[0292] Fig.34 are Kaplan-Meier survival curves showing the proportion of piglets with CNS scores less than 1 in Groups 5 and 6. The data show that piglets from Piggivac5-vaccinated sows had a significant delay in the onset of CNS sign changes (P=0.005).

[0293] Fig.35 Comparison of activity scores of piglets from Group 5 and Group 6 post-challenge is shown. Significant differences are highlighted. The data show that piglets from Piggivac5 vaccinated sows had significantly lower activity scores at 11 days post-challenge.

[0294] Fig.36 are Kaplan-Meier survival curves for the proportion of piglets with activity scores < 3 in Groups 5 and 6. The data show that piglets from Piggivac5-vaccinated sows had a significant delay in the onset of changes in activity signs (P=0.02).

[0295] Fig.37 Comparison of total clinical scores of piglets from Group 5 and Group 6 post-challenge is shown. Significant differences are highlighted. The data show that piglets from Piggivac5 vaccinated sows had significantly lower total clinical scores at 10 days post-challenge.

[0296] Fig.38 are Kaplan-Meier survival curves for the proportion of piglets with a total score below 7 in Groups 5 and 6. The data show that piglets from Piggivac5-vaccinated sows had a significant delay in the onset of changes in total clinical signs (P=0.03).

[0297] Fig.39 Shown is a comparison of the weights of piglets from Group 5 and Group 6 at day 23 post-challenge. The data show that piglets from Piggivac5 vaccinated sows gained more weight during the 14 days post-challenge, but this did not reach statistical significance (P=0.19).

[0298] Figure 40 shows the amino acid sequences of the polypeptides disclosed herein. Specifically, SEQ ID NOs 1-19 show full-length polypeptides, SEQ ID NOs: 20-42 show fragments thereof and SEQ ID NOs: 43-55 show fusion polypeptides disclosed herein. In particular, SEQ ID NOs: 49-53 and 55 show fusion polypeptides translated from the first methionine to the stop codon. Note that the amino acid residues in bold are derived from the vector and / or cloning site, and the amino acid residues in italics represent tags, such as His tags or SL2 tags. Importantly, please note that the bold amino acids are derived from the construction work of the fusion polypeptide and / or from the expression vector utilized, and these amino acids may be altered or even absent if another fusion strategy is used. Example

[0299] In the following examples, the identification, cloning and purification of antigenic fragments and the construction of fusion polypeptides comprising the fragments for use in vaccines against S. suis infection are disclosed. Data from vaccine studies conducted in porcine subjects using the fusion polypeptides are also disclosed.

[0300] General Materials and Methods

[0301] Molecular work was performed according to "Molecular Cloning: A Laboratory Manual" by J. Sambrook, EF Fritsch, T. Maniatis. The different methods used are briefly described below.

[0302] Electroporation of E. coli : In all cases, strain E. coli BL21 has been used as recipient for plasmids. 1 μl of plasmid was added to 50 μl of electrocompetent cells (on ice) and the mixture was transferred to a cold cuvette (1 mm gap). The conditions for electroporation were: 200–400 ohm, 25 microfarads and 2.5 kV. After electroporation, cells were resuspended in 1 ml of LB medium and incubated at 37°C for one hour (phenotype expression), after which cells were plated on LB plates with appropriate antibiotics.

[0303] connect : Ligation was performed for at least one hour using T4 DNA ligase (New England Laboratories) at a DNA concentration of approximately 20–50 μg / ml. Thereafter, the DNA was precipitated with EtOH, washed with 70% EtOH and dried. The precipitate was dissolved in H2O and used for electroporation.

[0304] DNA purification : For plasmid purification, an overnight culture of E. coli BL-21 was harvested, and 2–4 ml was used for plasmid preparation. Plasmids were purified using the QIAprep Spin Miniprep Kit (Qiagen) according to the supplier's instructions. PCR products were purified using the QIAquick PCR Purification Kit (Qiagen) after CIP treatment.

[0305] Cutting with restriction enzymes : An appropriate buffer is added to the DNA, and DTT (dithiothreitol; Amersham Biosciences) is added to a final concentration of 1 mM. Thereafter, one or more restriction enzymes (New England Laboratories) are added to a concentration of 2–10 units / μg, and the mixture is incubated for 2–3 hours.

[0306] CIP treatment of carriers All vectors used for cloning were treated with calf intestinal alkaline phosphatase (CIP) (New England Biolabs) for one hour in the same buffer used for restriction enzyme cleavage. Thereafter, the vectors were purified using the QIAquick PCR Purification Kit (Qiagen).

[0307] PCR conditionsFidelity Taq PCR Master Mix (USB, Affymetrix) was used according to the instructions. If not otherwise stated, the annealing temperature was 5°C to 10°C below the melting temperature of the primers, the number of cycles was 30 times, and the extension time was about 1 minute / 1 kbp of DNA.

[0308] DNA Sequencing : All DNA sequencing was performed by the Uppsala Genome Center Sequencing Service (Uppsala, Sweden).

[0309] SDS-PAGE analysis : SDS-PAGE analysis was performed using the PhastSystem (Cytiva). Samples were analyzed under reducing conditions using precast 8-25% gradient gels.

[0310] Expression of recombinant proteins :In general, similar conditions have been used for all proteins expressed in this application. Single colony is inoculated into 20–30 ml LB medium supplemented with kanamycin (25–50 μg / ml), and culture is incubated overnight with shaking at 25°C. Culture 10 ml to 20 ml overnight is inoculated into 1 l LB supplemented with kanamycin (25 μg / ml to 50 μg / ml), and culture is incubated with shaking at 25°C for several hours (5 to 7 hours). Induce the expression of recombinant protein by adding 1 l LB supplemented with kanamycin (25 μg / ml to 50 μg / ml) and 0.2 mM isopropyl β-D-1-thiogalactoside (IPTG), and culture is incubated overnight with shaking at 25°C.

[0311] Protein lysate : After the induction period, the culture was harvested by centrifugation and the cells were resuspended in lysis buffer (100 mM NaCl, 20 mM Tris (pH 7-7.5) and 0.05% Tween 20) and 10 μg / ml to 100 μg / ml lysozyme was added, after which the cells were lysed using a freeze / thaw cycle. The lysate was then sonicated (40–60% amplitude) in ice water for 2×10 minutes with a 1 second pulse. The lysate was centrifuged at 10K RPM for 20-30 minutes. The supernatant was collected and sterile filtered (using a 0.45 μm filter) and the lysate was then frozen in aliquots.

[0312] Plasmid vector The plasmid vector used in this example is as follows:

[0313] pBmKny, BmKSL2, pUC57-mini, and PGex6P-1.

[0314] The construction and details of pBmKny and BmKSL2 have been previously described in WO 2017 / 005913.

[0315] pUC57-mini vector and PGex6P-1 (both obtained from GenScript) were also used. For details on the vectors, see GenScript (http: / / genscript.com / ).

[0316] Primers : The primers used in the experiments described in the following examples are shown in Table 1 below.

[0317] SEQ ID NO:

[0318]

[0319] Table 1. List of primers / oligonucleotides used herein.

[0320] Example 1

[0321] General description of selected antigens

[0322] Schematic diagram of the fusion polypeptides BCA (SEQ ID NO: 49), 4Zn+3 (SEQ ID NO: 50), 5AsL (SEQ ID NO: 51) and SP274C (SP274C-ny (SEQ ID NO: 53) and SP724C-S (SEQ ID NO: 52) and 3PCS (3PCS (SEQ ID NO: 54) and 3PCS-ny (SEQ ID NO: 55)) (comprising SEQ ID NOs: 43, 44, 45, 46, 47, 48 and 49, respectively) is shown in FIG. Figure 1 The boundaries of each segment of the fusion polypeptide are indicated by bars in the figure. The sequence of the fusion polypeptide is shown in Figure 40. In Figure 40, the amino acids indicated in bold are derived from the construction work of the fusion polypeptide, and it should be noted that if another fusion strategy is used, these amino acids may be changed or even absent. Such amino acid residues are represented by X in SEQ ID NO: 106-115. In particular, the bold amino acids indicate amino acid residues derived from the vector and cloning site, and the italic amino acids indicate the relevant Hi s -tag, SL2-tag or LSL-tag sequence.

[0323] BCA, 4Zn+3 and 5AsL contain unstructured domains, while SP274C-S and 3PCS contain structured domains. In particular, 4Zn+3 and 5AsL contain only unstructured domains.

[0324] SP274C-S (SEQ ID NO: 47) and SP274C-ny (SEQ ID NO: 46) contain antigens that are fragments of three nucleotidases, SP2 (SEQ ID NO: 11), SP4 (SEQ ID NO: 13) and SP7 (SEQ ID NO: 12). SP274C-S contains SEQ ID NOs: 34, 35 and 36. The sequences of SP274C-S and SP274C-ny, including amino acid residues derived from the vector, cloning site and / or SL2 tag, are shown in bold and / or italics in SEQ ID NOs: 52 and 53.

[0325] 5AsL (SEQ ID NO: 45) comprises six fragments from five different putative proteases P1, P8, P11, M2 and IgdE (SEQ ID NO: 6-10). These six fragments comprise the amino acid sequences defined in SEQ ID NO: 28-33. The sequence of 5AsL including amino acid residues derived from the vector, cloning site and / or any tag is shown in bold and / or italics in SEQ ID NO: 51.

[0326] BCA (SEQ ID NO: 43) contains fragments of three proteins involved in zinc uptake; HtpsA (SEQ ID NO: 1), HtpsB (SEQ ID NO: 2) and HtpsC (SEQ ID NO: 3). These three fragments contain amino acid sequences as defined in SEQ ID NOs: 20, 21 and 22. The sequence of BCA, including amino acid residues derived from the vector, cloning site and / or any tags, is shown in bold and / or italics in SEQ ID NO: 49.

[0327] 4Zn+3 (SEQ ID NO:44) contains parts of eight different proteins; four proteins involved in zinc uptake, HtpsA (SEQ ID NO:1), HtpsB (SEQ ID NO:2), HtpsC (SEQ ID NO:3), HtpsC2 (SEQ ID NO:4) and AdcA (SEQ ID NO:5), and three unrelated proteins, Amid1Sa (SEQ ID NO:14), 15BSa (SEQ ID NO:15) and Hom17Sa (SEQ ID NO:16). 4Zn+3 contains fragments having amino acid sequences defined in SEQ ID NOs:23-26 and 37-39. The sequence of 4Zn+3, including amino acid residues derived from the vector, cloning site and / or any tag, is shown in bold and / or italics in SEQ ID NO:50.

[0328] 3PCS (SEQ ID NO:48) comprises fragments of three proteins containing the LPXTG motif; P6 (SEQ ID NO:17), C5a (SEQ ID NO:18) and Sao (SEQ ID NO:19). 3PCS comprises fragments having amino acid sequences as defined in SEQ ID NOs:40-42. The sequence of 3PCS comprising amino acid residues derived from the vector, cloning site and / or any tag is shown in bold and / or italics as SEQ ID NO:54 (3PCS) and SEQ ID NO:55 (3PCS-ny).

[0329] Determination of whether a protein is structured or not is predicted using IUPred2 (Mészáros et al., 2018 and et al., 2020).

[0330] Example 2

[0331] Cloning, expression and purification of SP2, SP4 and SP7 fragments

[0332] This example describes the cloning, expression and purification of fragments of antigens SP2, SP4 and SP7 in SP274C-S and SP274C-ny.

[0333] Materials and methods: The C-terminal fragments of SP2 (SEQ ID NO: 11), SP4 (SEQ ID NO: 13) and SP7 (SEQ ID NO: 12) and the indicated SP2 fragments, SP4 fragments, SP7 fragments corresponding to SEQ ID NO: 34, 36 and 35, respectively, were combined into a fusion polypeptide SP274C-S (SEQ ID NO: 52) with an SL2 tag as described herein and into a fusion polypeptide SP274-ny (SEQ ID NO: 53). For clarity, SEQ ID NO: 52 and 53 include SEQ ID NO: 46 (SEQ ID NO: 80) lacking the SL2 tag.

[0334] First, a gene fragment was obtained from an external provider as shown below, and the gene fragment was cloned into a BmKny vector fused with 6 histidines (indicated herein by the letter H (SEQ ID NO: 81)) according to the following essentially as described in WO 2017 / 005913. Briefly:

[0335] The gene encoding the SP2 fragment (encoding the amino acid sequence according to SEQ ID NO:34) is a codon-optimized order from GenScript and is flanked by restriction enzyme sites BamHI and XhoI. In addition, the fragment encodes six histidines after the BamHI site. The fragment is cloned into the vector BmKny using the sites BamHI and XhoI. The obtained SP2 fragment carries a His tag.

[0336] The gene encoding the SP4 fragment (encoding the amino acid sequence according to SEQ ID NO:36) is a codon optimized order from GenScript and is flanked by a restriction enzyme site NdeI in the N-terminus, followed by a DNA sequence encoding six histidines, followed by a BamHI site, and the C-terminus ends with a restriction site XhoI. The fragment was cut with NdeI and XhoI and cloned into the corresponding sites of the vector BmKny. The obtained SP4 fragment carries a His tag.

[0337] The gene encoding the SP7 fragment (encoding the amino acid sequence according to SEQ ID NO:35) is a codon optimized gene ordered from GenScript and flanked by a restriction enzyme site NdeI at the N-terminal end, followed by a DNA sequence encoding six histidines, followed by a BamHI site, and ending at the C-terminal end with a restriction site XhoI. The fragment was cut with NdeI and XhoI and cloned into the corresponding sites of the vector BmKny. The obtained SP7 fragment carries a His tag.

[0338] E. coli clones were grown and protein expression was induced, after which protein lysates were prepared and purified on Talon columns (as described in Example 4) and analyzed by SDS-PAGE as described above.

[0339] result In summary, the present inventors were able to successfully express and purify the SP2 fragment, SP4 fragment, SP7 fragment corresponding to SEQ ID NO: 34, 36 and 35, respectively, fused to a His-tag.

[0340] Example 3

[0341] Cloning of fusion peptides

[0342] In this example, the cloning of fusion polypeptides BCA (SEQ ID NO: 49), 4Zn+3 (SEQ ID NO: 50), 5AsL (SEQ ID NO: 51), SP274C-S (SEQ ID NO: 52), SP274C-ny (SEQ ID NO: 53), 3PCS (SEQ ID NO: 54) and 3PCS-ny (SEQ ID NO: 55) (comprising SEQ ID NOs: 43, 44, 45, 47, 46, 48 and 48, respectively) is described. In addition, the fusion of polypeptide SP274C (SEQ ID NO: 46) with SL2 tag (SEQ ID NO: 80) is disclosed herein to generate SP274C-S (SEQ ID NO: 47).

[0343] clone

[0344] Materials and methods: The gene fragments encoding the protein fragments contained in BCA, 4Zn+3, 5AsL, SP274C and 3PSC were cloned into the expression vectors described below. SP274 was cloned into the BmKny vector and fused to the SL2-tag (GLKTRNKKAKSDKLIVRRRNQK (SEQ ID NO: 80)), which is indicated by the letter S in this article and is located in the C-terminus according to the following:

[0345] SP274C-S: The nucleotide sequences of SP274C-S (SEQ ID NO: 60) and SP274C-ny (SEQ ID NO: 61) are fusions of gene fragments SP2C and SP74C, and contain portions of three genes SP2, SP4, and SP7, as described in WO 2017 / 005913. As described in Example 2, these genes were synthesized and codon optimized by GenScript. SP274C-S was constructed from SP74C and SP2C.

[0346] SP74C: The nucleotide sequence of SP74C-S (SEQ ID NO:59) is a fusion of gene fragments SP7C (SEQ ID NO:76 and SP4C (SEQ ID NO:75) (described above). The SP7C fragment was PCR amplified using clone SP7C-S (SEQ ID NO:78) as a template, and the primers used were Tac5 (SEQ ID NO:68) and NP7Kpn (SEQ ID NO:69). The SP4C fragment was PCR amplified using clone SP4C-S (SEQ ID NO:77) as a template, and the primers were SP4CKpnI (SEQ ID NO:70) and BmR2 (SEQ ID NO:71). The PCR conditions for both reactions were 50°C annealing temperature, 2 minutes extension, and 30 cycles.

[0347] Primers for SP7C

[0348] Tac5: GCCGACATCATAACGGTTCTGG (SEQ ID NO: 68), vector primer

[0349] NP7Kpn: TATAGGTACCGGTTTGGTTGCCACTTGC (SEQ ID NO: 69), template: SP7C-S (SEQ ID NO: 78)

[0350] Primers for SP4C

[0351] SP4CKpnI: ATATGGTACCGGCGAAACGACGGC (SEQ ID NO:70),

[0352] BmR2: GGTGGTCCCACCTGACGTC (SEQ ID NO: 71), vector primer

[0353] Template: SP4C-S (SEQ ID NO: 102)

[0354] The SP7C PCR product was cut with BamHI and KpnI, and the SP4C PCR product was cut with KpnI and XhoI. The cut fragments were ligated into the vector BmKSL2. Prior to ligation, the vector was prepared by cutting with BamHI and XhoI and treating with calf intestinal alkaline phosphatase (CIP). The fragment obtained was SP74C-S (SEQ ID NO: 59), which was sequence verified and encoded the amino acid sequence according to SEQ ID NO: 79.

[0355] SP274C: Gene fragment SP2C (SEQ ID NO:74) (described above) was PCR amplified using SP2C-S (SEQ ID NO:58) as a template, and primers were Tac5 (SEQ ID NO:68) and SP2Cr (SEQ ID NO:72). SP74C fragment was PCR amplified using SP74C-S (SEQ ID NO:59) as a template, and primers were SP74Cs (SEQ ID NO:73) and BmR2 (SEQ ID NO:71). PCR conditions for both reactions were 50°C annealing temperature, 2 minutes extension, and 30 cycles. The SP2C fragment was cut with BamHI and EcoRI, and the SP74C fragment was cut with EcoRI and XhoI. The two fragments were then ligated into the vector BmKSL2. Prior to ligation, the vector was prepared by cutting with BamHI and XhoI and treating with calf intestinal alkaline phosphatase (CIP). The construct obtained was SP274C-S (SEQ ID NO: 60) and its sequence was verified. The construct encodes the fusion polypeptide SEQ ID NO: 47, which comprises SEQ ID NO: 46. The amino acid sequence of the construct obtained from the first Met translation to the stop codon corresponds to SEQ ID NO: 52, wherein the amino acid residues derived from the vector used, the cloning site used and the SL2-tag are indicated.

[0356] Primers for SP2C

[0357] Tac5: GCCGACATCATAACGGTTCTGG (SEQ ID NO: 68), vector primer

[0358] SP2Cr: TATAGAATTCACCTGCTTTGGTCGTTTTTGC (SEQ ID NO:72)

[0359] Template: SP2C-S (SEQ ID NO: 58)

[0360] Primers for SP74C PCR

[0361] SP74Cs: ATATGAATTCGAAATTCAAGCCATTGTGGACG (SEQ ID NO:73)

[0362] BmR2: GGTGGTCCCACCTGACGTC (SEQ ID NO: 71), vector primer

[0363] Template: SP74C-S (SEQ ID NO: 59)

[0364] Use the PCR product through cutting identical with being used for processing SP274C-S to complete SP274C-ny construct, but PCR product is connected in the carrier BmKny of cutting with BamHI and XhoI.Before connecting, cut by BamHI and XhoI and prepare carrier with calf intestine alkaline phosphatase (CIP) treatment.Isolate kanamycin resistant bacterium colony.The clone that obtains is called SP274C-ny (SEQ ID NO:61), and sequence verification and its encoding fusion polypeptide SP274C-ny (SEQ ID NO:53) are carried out.The amino acid sequence of the construct that obtains from the first Met translation to the stop codon corresponds to SEQ ID NO:53, wherein indicates the amino acid residue that is derived from the carrier used and cloning site.SEQ ID NO:53 comprises SEQ ID NO:46.

[0365] BCA: BCA contains fragments of genes encoding HtpsA (SEQ ID NO: 1), HtpsB (SEQ ID NO: 2), and HtpsC (SEQ ID NO: 3), and is made from gene fragments Su219 (SEQ ID NO: 62) and Su302 (SEQ ID NO: 63) and is prepared as follows:

[0366] Su219: A codon-optimized DNA sequence containing a portion of the HtpsA gene, encoding a fragment according to SEQ ID NO:20, was cloned into the vector pUC57-mini (GenScript). The DNA contained a BamHI site at the 5' end and a stop codon and an XhoI site at the 3' end. The DNA was cut with BamHI and XhoI and ligated into the vector BmKny. Prior to ligation, the vector was prepared by cutting with BamHI and XhoI and treating with calf intestinal alkaline phosphatase (CIP). Kanamycin-resistant colonies were isolated and protein expression after IPTG induction was studied. A clone with high protein expression was selected and the DNA sequence was determined, showing the expected sequence. The new clone in the vector pBmKny was named pBm219.

[0367] Su302: A codon-optimized DNA sequence (GenScript) containing portions of the HtpsB and HtpsC genes, encoding fragments according to SEQ ID NOs: 21 and 22, respectively. It was cloned into the vector pUC57mini. The DNA clone contained an NdeI site at the 5' end and BamHI and XhoI sites at the 3' end.

[0368] BCA: Clone pBm219 was cut with NdeI and BamHI and then treated with CIP. Clone Su302 was cut with NdeI and BamHI. After purification, the two cut plasmids were mixed and ligated together. Kanamycin-resistant colonies were isolated and protein expression after IPTG induction was studied.

[0369] A clone with high protein expression was selected and the DNA sequence was determined, showing the expected sequence. Thus, a polynucleotide encoding a fusion polypeptide comprising SEQ ID NO:43, SEQ ID NO:64, was obtained.

[0370] The obtained amino acid sequence of the construct from the first Met translation to the stop codon corresponds to SEQ ID NO: 49, wherein the amino acid residues derived from the vector used, the cloning site used and the his-tag are indicated.

[0371] 5AsL: The ordered codon-optimized DNA sequence of 5AsL (SEQ ID NO:65) (ordered from GenScript) contains six fragments from five different putative proteases P1 (SEQ ID NO:6), P8 (SEQ ID NO:7), P11 (SEQ ID NO:8), M2 (SEQ ID NO:9) and IgdE (SEQ ID NO:10). The amino acid sequences of these six fragments are shown in SEQ ID NOs:28-33. The ordered DNA (wherein the 5' end contains a BamHI site and the 3' end contains a stop codon and an XhoI site) is cloned into pGex6P-1. The ordered DNA is cut with BamHI and XhoI and connected to the vector BmKny. Kanamycin-resistant colonies are isolated and protein expression after IPTG induction is studied. A clone with high protein expression is selected and its sequence is verified. Thus, a fusion polypeptide comprising SEQ ID NO:45 is obtained.

[0372] The obtained amino acid sequence of the construct translated from the first Met to the stop codon corresponds to SEQ ID NO: 51, wherein the amino acid residues derived from the vector used, the cloning site used and any tags are indicated.

[0373] 4Zn+3: The codon-optimized DNA sequence of 4Zn+3 (SEQ ID NO: 66) (purchased from GenScript) contains nucleotide sequences encoding fragments of the following eight different proteins: HtpsA (SEQ ID NO: 1), HtpsB (SEQ ID NO: 2), HtpsC (SEQ ID NO: 3), HtpsC2 (SEQ ID NO: 4), AdcA (SEQ ID NO: 5), Amid1Sa (SEQ ID NO: 14), 15BSa (SEQ ID NO: 15) and Hom17Sa (SEQ ID NO: 16). The amino acid sequences of these eight fragments are shown in SEQ ID NOs: 23-27 and 37-39.

[0374] The ordered 4Zn+3DNA (wherein the 5' end contains a BamHI site and the 3' end contains a stop codon and an XhoI site) is cloned into pGex6P-1. The DNA is cut with BamHI and XhoI and connected to the vector BmKny. Before connection, the vector is prepared by cutting BamHI and XhoI and performing CIP treatment. Isolate kanamycin-resistant colonies and study protein expression after IPTG induction. Select a clone with high protein expression and verify its sequence. Therefore, a clone encoding the fusion polypeptide SEQ ID NO:44 is obtained.

[0375] The obtained amino acid sequence of the construct translated from the first Met to the stop codon corresponds to SEQ ID NO: 50, wherein the amino acid residues derived from the vector used, the cloning site used and any tags are indicated.

[0376] 3PCS: An ordered codon-optimized DNA sequence (GenScript) contains parts of three different LPXTG proteins P6 (SEQ ID NO: 17), C5a (SEQ ID NO: 18) and Sao (SEQ ID NO: 19). These three fragments have amino acid sequences as defined in SEQ ID NOs: 40-42. The ordered DNA contains a BamHI site at the 5' end, a stop codon and an XhoI site at the 3' end, and is cloned into pGex6P-1. Ampicillin-resistant colonies were isolated, and a clone with high protein expression and containing 3PCS was selected. The clone corresponds to SEQ ID NO: 67 and its sequence was verified. Thus, a clone encoding a fusion polypeptide containing SEQ ID NO: 48 was obtained. The amino acid sequence of the obtained construct corresponds to SEQ ID NO: 54, in which the amino acid residues derived from the vector used, the cloning site used, and any tags are indicated.

[0377] 3PCS-ny: 3PCS was recloned into the vector BmKny. The ordered DNA was cut with BamHI and XhoI and ligated into the vector BmKny (BamHI / XhoI and CIP). Kanamycin-resistant colonies were isolated and protein expression after IPTG induction was studied.

[0378] A clone with high protein expression corresponding to SEQ ID NO: 67 was selected and its sequence verified. Thus, a clone encoding a fusion polypeptide comprising SEQ ID NO: 48 was obtained. The amino acid sequence of the obtained construct from the first Met translation to the stop codon corresponds to SEQ ID NO: 55, wherein the amino acid residues derived from the vector used, the cloning site used and any tags are indicated.

[0379] General conditions for E. coli growth and induction of protein expression E. coli BL21 cells containing different constructs were grown at 37°C to OD 0,5 to 1, after which an induction phase was performed by adding IPTG to 50 μg / ml and shaking overnight at 25°C. Electroporation of E. coli was performed as described in Example 1.

[0380] Example 4

[0381] Purification of fusion peptides

[0382] In this example, the purification of the polypeptides BCA (SEQ ID NO:49 comprising SEQ ID NO:43), 4Zn+3 (SEQ ID NO:50 comprising SEQ ID NO:44), 5AsL (SEQ ID NO:51 comprising SEQ ID NO:45), 3PCS (SEQ ID NO:54 comprising SEQ ID NO:48), 3PCS-ny (SEQ ID NO:55 comprising SEQ ID NO:48), SP274C-S (SEQ ID NO:52 comprising SEQ ID NO:47, which in turn comprises SEQ ID NO:46) and SP274C-ny (SEQ ID NO:53 comprising SEQ ID NO:46) as described in Example 3 is disclosed.

[0383] SP274C-S (SEQ ID NO: 52)

[0384] The induced E. coli cells were centrifuged and resuspended in a solution containing 100 mM NaCl, 20 mM Tris pH 7.4 and 0.05% Tween 20. Lysozyme was then added to a final concentration of 20 μg / ml and cells were repeatedly frozen / thawed until lysis occurred. The lysate was sonicated and debris was removed by centrifugation. The clarified lysate was sterile filtered (0.45 μm filter) and frozen in aliquots until protein purification was performed. Purification was performed as described below.

[0385] SP274C-ny (SEQ ID NO: 53)

[0386] The induced E. coli cells were centrifuged and resuspended in a solution containing 100 mM NaCl, 20 mM Tris pH 7.4 and 0.05% Tween 20. Lysozyme was then added to 20 μg / ml and cells were repeatedly frozen / thawed until lysis. The lysate was sonicated and debris was removed by centrifugation. The clarified lysate was sterile filtered (0.45 μm filter) and aliquoted and frozen until the protein was purified.

[0387] 80 ml of the clarified lysate was shaken with 2.4 g of allantoin to bind endotoxin, and allantoin crystals bound to endotoxin were removed by centrifugation. Purification was performed as described below.

[0388] BCA, 5AsL, 4Zn+3, and 3PCS (SEQ ID NOs: 49, 51, 50, and 54)

[0389] The induced E. coli cells were centrifuged and resuspended in a solution containing 100mM NaCl, 20mM Tris pH 7.4 and 0.05% Tween 20. Thereafter, lysozyme was added to a final concentration of 100 μg / ml (BCA and 3PCS) or 20 μg / ml (5AsL and 4Zn+3), and the cells were repeatedly frozen / thawed until lysis occurred. The solution of the lysed cells containing protein BCA, 5AsL and 4Zn+3 was boiled for 15 minutes. Thereafter, the solution was cooled to room temperature and the cell debris including denatured proteins was removed by centrifugation. The lysed cells containing 3PCS were centrifuged and the supernatant was collected after lysis occurred. The clarified lysate was sterile filtered (0.45 μm filter) and frozen in equal parts until protein purification was performed. Purification was performed as described below.

[0390] 3PCS-ny (SEQ ID NO: 55)

[0391] Lysate was E. coli cell lysate prepared essentially as described in 3PCS.

[0392] Purification of fusion polypeptides on columns.

[0393] Materials and methods: To obtain soluble protein for use with adjuvants, the fusion polypeptide is purified.

[0394] Protein purification on Talon: For proteins SP2, SP4 and SP7, Talon was used. Pre-made columns with 1 ml Talon (Situofan) were used. All proteins were purified as described below (steps 1-11). These columns were reused, but only the same protein was purified on each column.

[0395] 1. Wash the column with 10 ml TN0.4 buffer (10 mM Tris pH 7.1, 0.4 M NaCl).

[0396] 2. Apply 10-15 ml of lysate to the column twice.

[0397] 3. Wash the column with 2×5-10 ml TN0.4 buffer.

[0398] 4. An additional washing step was sometimes performed using 5 ml of 5 mM imidazole in TN 0.4 buffer.

[0399] 5. Elute the recombinant protein with 0.1 M imidazole in TN 0.4 buffer.

[0400] 6. Wash the column with 5 ml 8M urea.

[0401] 7. The column was regenerated with 10 ml MES (20 mM) + NaCl (0.4 M).

[0402] 8. Wash the column with 20 ml of H2O and save it for the next purification of the same protein.

[0403] 9. The eluted protein sample was dialyzed against PBS (2 x 5 l).

[0404] 10. The samples were sterile filtered (0.2 μm).

[0405] 11. Measure the absorbance and freeze the sample.

[0406] Protein purification by ion exchange chromatography: For purification of SP274C-S, BCA, 5AsL and 4Zn+3, ion exchange chromatography (Q Sepharose, Stovam) was used.

[0407] Protein purification of SP274C-S

[0408] Binding was performed in 150 nM NaCl, 20 mM Tris pH 7.4 and 0.05% Tween 20.

[0409] • Wash with 0.25 mM NaCl and 20 mM Tris pH 7.4.

[0410] • Elution was performed in 0.4 mM NaCl and 20 mM Tris pH 7.4.

[0411] The eluted protein was diluted with H2O to a NaCl concentration of 150 mM and re-purified on Q Sepharose using the same conditions as above.

[0412] • The eluted protein was dialyzed against 20 mM Tris-HCl pH 7.5 and 100 mM NaCl.

[0413] • Finally, the protein was sterile filtered using a 0.20 μm filter and frozen until use.

[0414] Protein purification of SP274C-ny

[0415] Binding was performed in 100 nM NaCl, 20 mM Tris pH 7.4 and 0.05% Tween 20.

[0416] • Wash with 150 mM NaCl and 20 mM Tris pH 7.4.

[0417] Elution was performed in two steps, first with 0.25 mM NaCl and 20 mM Tris pH 7.4, then with 0.3 mM NaCl and 20 mM Tris pH 7.4

[0418] • The eluted protein was dialyzed against 20 mM Tris-HCl pH 7.5 and 100 mM NaCl.

[0419] • Finally, the protein was sterile filtered using a 0.20 μm filter and frozen until use.

[0420] Protein purification of BCA, 5AsL and 4Zn+3

[0421] • Binding was performed in 50 mM NaCl and 20 mM Tris pH 7.4.

[0422] • Elution was performed in 300 mM NaCl (for BCA), 250 mM NaCl (for 5AsL) or 200 mM NaCl (for 4Zn+3) and 20 mM Tris pH 7.4.

[0423] • The eluted protein was dialyzed against 20 mM Tris-HCl pH 7.5 and 100 mM NaCl (for BCA) or 10 mM Tris-HCl pH 7.4 (for 5AsL, 4Zn+3).

[0424] • Finally, the protein was sterile filtered using a 0.20 μm filter and frozen until use.

[0425] Protein purification of 3PCS

[0426] 3PCS purification was performed using affinity chromatography (Glutathione Sepharose 4B). 3PCS was purified in batches, and after careful washing;

[0427] • Use precision proteases to cleave 3PCS from the GST tag.

[0428] • Dialysis was performed in 20 mM Tris-HCl pH 7.4 and 100 mM NaCl.

[0429] • Finally, the protein was sterile filtered using a 0.20 μm filter and frozen until use.

[0430] Protein purification of 3PCS-ny

[0431] 3PCS-ny was purified and the protein was sterile filtered using a 0.20 μm filter and frozen until use.

[0432] result : Therefore, the fusion polypeptides BCA, 4Zn+3, 5AsL, SP274C-S, SP274C-ny and 3PCS corresponding to SEQ ID NO:49, 50, 51, 52, 53 and 54 disclosed herein were successfully cloned, expressed and purified. It is expected that 3PCS-ny corresponding to SEQ ID NO:55 was also successfully cloned, expressed and purified.

[0433] Example 5

[0434] Stability of fusion peptides

[0435] The stability of the purified fusion polypeptide obtained in Example 4 was tested. The fusion polypeptide was aliquoted and incubated as follows. Analysis was performed by SDS-PAGE.

[0436] Aliquots of the fusion polypeptide SP274C-S (SEQ ID NO: 52) were incubated at 37°C, room temperature (+20°C), or frozen (-20°C) for 26 days. The fusion antigen showed a high degree of stability ( Figure 2A ).

[0437] Aliquots of the fusion polypeptide BCA (SEQ ID NO: 49) were incubated at 37°C, room temperature (+20°C), +5°C or frozen (-20°C). Stability was assessed after 1, 2, 3, 7 and 9 months. The fusion antigen showed a high degree of stability ( Figure 2B ).

[0438] Aliquots of the fusion polypeptide 4Zn+3 (SEQ ID NO: 50) were incubated at 37°C, room temperature (+20°C), +5°C or frozen (-20°C). Stability was assessed after 1 week, 3 weeks, 2 months, 12 months and 14 months. The fusion antigen showed good stability ( Figure 2C ).

[0439] Aliquots of the fusion polypeptide 5AsL (SEQ ID NO: 51) were incubated at 37°C, room temperature (+20°C), +5°C or frozen (-20°C). Stability was assessed after 1 week, 3 weeks, 2 months and 14 months. The fusion antigen showed good stability ( Figure 2D ).

[0440] Aliquots of the fusion polypeptide 3PSC (SEQ ID NO: 54) were incubated at 37°C, room temperature (+20°C), +5°C or frozen (-20°C). Stability was assessed after 1 week. The fusion antigen showed good stability ( Figure 2E ).

[0441] Example 6

[0442] Rabbit immune response

[0443] In this example, BCA, 4Zn+3, 5AsL and SP274C-S corresponding to SEQ ID NOs: 49, 50, 51 and 52, respectively, and comprising SEQ ID NOs: 43, 44, 45 and 47 (which in turn comprise SEQ ID NO: 46) were injected into rabbits and the antibody response thereto was studied.

[0444] Materials and methods:Immunization of rabbits: Prior to immunization, blood was collected from rabbits and pre-immune serum was prepared and stored for later analysis. Rabbits were immunized three times at Capra Science Antibodies AB using a mixture of four fusion proteins (10 μg of each fusion protein); BCA, 4Zn+3, 5AsL and SP274C-S, corresponding to SEQ ID NOs: 49, 50, 51 and 52. The first immunization was performed using FCA (Freund's complete adjuvant), and the second and third immunizations were performed using FIA (Freund's incomplete adjuvant). The second immunization was performed 4 weeks after the first immunization, and the third immunization was performed 4 weeks after the second immunization. Blood was collected two weeks after the last immunization to prepare serum.

[0445] Protein blotting: Fusion polypeptides (BCA, SP274C-S, 4Zn+3 and 5AsL) and polypeptides HtpsA, HtpsB, HtpsC, SP2C, SP4C and SP7C (corresponding to SEQ ID NO: 1, 2, 3, 74, 75 and 76, respectively) were loaded into wells and run on precast 8% to 25% gradient gels from Cytiva (PhastGel; GE17-0542-01) using SDS buffer (PhastGel; GE17-0516-01) on the PhastSystem.

[0446] The gel was stained with Coomassie blue according to standard protocols.

[0447] After 20 min SDS-PAGE, the proteins were transferred to Amersham Hybond-C Extra filters (RPN303E, Stovam) for 30 min at 65° C. To prevent nonspecific binding, the filters were blocked with ovalbumin at a final concentration of 150 μg / ml for at least 30 min at room temperature.

[0448] Next, serum was added to the filter. Serum was diluted 200-fold and incubated overnight at room temperature. Before adding 5 μg of protein G horseradish peroxidase (HRP) conjugate (P21041; Invitrogen), the filter was washed four times with 20 mM Tris-HCl pH 7.3, 100 mM NaCl, and 0.05% Tween-20. The filter was washed twice with 20 mM Tris-HCl pH 7.3, 100 mM NaCl, and 0.05% Tween-20, and twice with 20 mM Tris-HCl pH 7.3 and 100 mM NaCl. Ten microliters of catalase 30% (107209; MERCK) were added to 10 ml of 20 mM Tris-HCl pH 7.3 and 100 mM NaCl, and to visualize the protein-peroxidase conjugate, 2 ml of the substrate 4-chloro-1-naphthol was added to visualize the protein-peroxidase conjugate after incubation and incubated at room temperature.

[0449] result :SDS gel ( Figure 3A ) shows that the fusion polypeptides BCA, 4Zn+3, 5AsL and SP274C-S corresponding to SEQ ID NOs: 49, 50, 51 and 52, respectively, and the polypeptides HtpsA, HtpsB, HtpsC, SP2C, SP4C and SP7C corresponding to SEQ ID NOs: 1, 2, 3, 74, 75 and 76, respectively, are intact.

[0450] Pre-immune serum was assayed for four fusion proteins and polypeptides HtpsA, HtpsB, and HtpsC (represented as "BCA single" in the figure). Figure 3B As shown. The pre-immune serum had no reactivity to 4Zn+3 and 5AsL. Weak signals were visible for BCA, SP274C and "BCA Single" in the pre-immune serum. This may be due to cross-reactivity, as the zinc binding protein in BCA and the nucleotidase in SP274 have homology with proteins in bacteria other than S. suis. It was concluded that the titers or antibodies against the fusion polypeptide were low to undetectable in the pre-immune serum. Figure 3C As shown, the strong signals observed in the positions corresponding to the predicted sizes of the fusion polypeptides BCA, 4Zn+3, 5AsL and SP274C-S and polypeptides HtpsA, HtpsB, HtpsC, SP2C, SP4C and SP7C indicate the presence of fusion polypeptide-specific antibodies in the immunized rabbits.

[0451] Thus, this example shows that immunization with a mixture of the four S. suis fusion polypeptides BCA, 4Zn+3, 5AsL and SP274C-S results in a strong antibody response against the four different fusion proteins, as well as against the three polypeptides contained in BCA and SP274C-S, respectively, after the third immunization.

[0452] Example 7

[0453] Immunogenicity and efficacy of Streptococcus suis vaccine against experimental Streptococcus suis challenge in piglets

[0454] In this example, 1 ml of the four fusion polypeptides (i.e., BCA, 4Zn+3, 5AsL, and SP274C-S) correspond to SEQ ID NOs: 49, 50, 51, and 52, respectively, and include SEQ ID NOs: 43, 44, 45, and 47 (which in turn include SEQ ID NO: 46). The combination of the four fusion polypeptides is called Piggivac4. Piggivac4 mixed with 100 μg of MatrixV adjuvant or adjuvant-only control was injected into pregnant sows on days 0, 21, and 42. 100 μg of each fusion polypeptide, also referred to as fusion antigen, was used. The IgG antibody response of the sows was measured. Starting from the 7th day after the first vaccination, sows vaccinated with Piggivac4 had higher antibody levels to the components of Piggivac4 compared to control sows.

[0455] Piglets were farrowed and weaned at approximately 4 weeks of age. IgG antibody responses were measured in the colostrum of the sows. IgG antibody responses were measured in piglets of vaccinated and control sows. From birth until the time piglets in Groups 5 and 6 were vaccinated on Day 119, piglets from sows vaccinated with Piggivac4 had significantly higher antibody levels to the components of Piggivac4 than piglets from control sows (P<0.0001 on all days).

[0456] Groups of 9 piglets from vaccinated sows (Group 3) and 10 piglets from control sows (Group 4) received between 1.3 × 10 9 cfu with 1.5×10 9cfu. Piglets from Group 3 and Group 4 were then monitored for signs of infection for 7 days. The piglets were euthanized when health endpoint criteria were reached or at the end of the study on Day 7 after challenge. On Day 1 and Day 2 after challenge, the rectal temperatures of piglets from sows vaccinated with Piggivac4 (Group 3) were significantly lower than those of piglets from control sows (Group 4) (P=0.001 and P=0.006, two-tailed Student's t-test, respectively). The onset of rectal temperatures of ≥40°C for two consecutive days in Group 3 piglets was significantly delayed (P=0.03, log-rank test). There was also a trend toward lower and delayed behavior and central nervous system (CNS) signs in Group 3 piglets.

[0457] Two additional piglets from sows vaccinated with Piggivac4 (Group 5) and three additional piglets from control sows (Group 6) were vaccinated on day 119, when they were approximately 8 weeks old. The IgG antibody responses of piglets from Groups 5 and 6 were measured. Piglets from sows vaccinated with Piggivac4 had higher levels of antibodies to the components of Piggivac4 relative to piglets from control sows. After vaccination of piglets from Groups 5 and 6, antibody levels to the components of Piggivac4 remained stable in piglets from Group 5, while antibody levels increased in piglets from Group 6.

[0458] In conclusion, vaccination of sows generated significant antibody responses that were transferred to piglets via colostrum and reduced the effects of S. suis challenge. Vaccination of 8-week-old piglets maintained antibody responses to vaccine components in piglets from sows vaccinated with Piggivac4 and generated antibody responses in piglets from control sows.

[0459] Materials and methods:

[0460] Test animals:

[0461] Detailed information on the sows and piglets used in this study is given in Table 2 below.

[0462]

[0463] Table 2. Details of the animals used in the study.

[0464] Test and control materials :

[0465] The test material was prepared according to Table 3, and the control group received a control dose of an adjuvant selected to simulate the test material dosing regimen. For the first vaccination of Group 1, lot #1020-01 was used. For the second vaccination of Group 1, lot #1020-02 was used. For the third vaccination of Group 1, lot #1020-03 was used. For the first vaccination of Group 2, lot #1020-05 was used. For the second vaccination of Group 2, lot #1020-06 was used, and for the third vaccination of Group 2, lot #1020-07 was used.

[0466]

[0467] Table 3: Information about test and control materials.

[0468] Study Design and Procedures :

[0469] A summary of the study design is given in Table 4. A total of two pregnant pigs (approximately 40 days of gestation) were obtained from a commercial pig farm with no history of clinical disease with S. suis.

[0470] Once at the site, the animals were housed on straw and provided with drinking water and feed for the gestating sows. Upon arrival, the sows were examined by the veterinarian to confirm that they were in good general health and blood samples were collected from each sow. Blood samples were collected from each sow after 14 days of acclimatization (day 0). One sow was injected with Piggivac4 by the intramuscular route (group 1) and the second sow was injected with a placebo (group 2). Vaccination was repeated on days 21 and 42. Blood samples were collected from sows on days 0, 7, 14, 21, 28, 35, 42 and 49. On day 55, the animals were transferred to farrowing crates. The animals farrowed on days 59 and 61. The final blood sample was collected after farrowing was completed on day 62.

[0471] After farrowing, the piglets were examined to confirm health status and the number of live / dead piglets was recorded. All piglets were encouraged to consume as much colostrum as possible. Blood samples were collected from all piglets (Groups 3 and 4) within 24 hours of farrowing and then weekly until weaning. At 28 days, all piglets were examined by a veterinarian. Nine and 10 piglets from each litter were selected and weaned. They were then fed intravenously with 1×10 9 These piglets (Groups 3 and 4) were challenged with cfu serotype 2 S. suis isolate 23 / P0278 / 02 / 11.

[0472] After challenge, piglets in Groups 3 and 4 were observed twice daily for signs of illness and additional health observations were performed as needed.

[0473] On day 7 after challenge, the remaining animals in Groups 3 and 4 were euthanized and samples were collected after necropsy for further analysis.

[0474] Two additional piglets from sows vaccinated with Piggivac4 (Group 5) and three additional piglets from control sows (Group 6) were vaccinated on day 119, when they were approximately 8 weeks old. Serum samples were collected to measure antibody responses to the components of Piggivac4.

[0475]

[0476] Table 4: Summary of study design.

[0477] Challenge preparation: Streak the S. suis isolate (23 / P0278 / 02 / 11) onto 5% sheep blood agar plates (2 plates total) on day 89. Incubate the plates at +37°C (±2°C) aerobic conditions overnight for 20 to 24 hours.

[0478] After incubation, check the plate and confirm that its growth is consistent with the expectation of the isolate. Bacterial colonies are removed from each plate and added to 2×3ml of preheated plant peptone liquid medium supplemented with 3% (v / v) horse serum (supplemented with VPB) in a bijoux bottle, and grown to a turbidity of 1.5McFarland turbidity units (McF) at +37°C (±2°C) (optical density is measured using a densitometer (BioMerieux)). Each 3ml volume is then added to 97ml of preheated supplemented VPB to obtain 2×100ml excitation cultures, which are incubated 4 (±0.5) hours at +37°C (±2°C) on an orbital shaker set at 150rpm.

[0479] The contents of one culture were used as pure material for the challenge of animals from groups 3 and 4, where the expected concentration was 5 × 10 8 cfu / ml. Take a 2 ml sample of the challenge material for back titration. Keep the challenge material refrigerated (+2 to +8°C) until use.

[0480] Stimulation application: On day 91 (at 4 weeks of age), all animals from groups 3 and 4 were administered 2 ml of a 6.5 × 10 8 cfu / ml to 7.5×10 8 cfu / ml of S. suis challenge material as measured by back titration via the intravenous route (jugular vein, using a separate sterile needle and syringe for each animal).

[0481] Clinical observation:On the day of challenge (day 91), clinical observations were performed by experienced personnel before and 4 (± 1) hours after challenge. Clinical observations were then performed twice daily from day 91 to day 97, with only one scheduled observation before necropsy on day 98. Additional health observations were performed at a frequency determined by the condition of the animals during day 91 to day 98.

[0482] Clinical observations included assessment of demeanor, behavioral / CNS changes, lameness, and rectal temperature (°C) according to a scoring system (Table 5). Other comments related to behavioral or neurological issues were recorded as comments.

[0483]

[0484] Table 5: Clinical scoring system

[0485] The individual scores for each clinical score were summed during data tabulation to give a total clinical score for each animal in each observation.

[0486] For humane reasons, piglets lying / moribund and / or showing severe signs of distress were immediately euthanized by administering a lethal dose of sodium pentobarbital BP. The last observation carried forward method was used in cases where data were lost due to euthanasia before the end of the study.

[0487] Arranged euthanasia : After weaning (day 85), sows were euthanized by approved methods. On day 98, all remaining piglets in Groups 3 and 4 were euthanized by lethal injection (sodium pentobarbital BP (Vet) 20% w / v (Pentoject or equivalent)).

[0488] Autopsy: On day 98 (or upon request after early euthanasia for health reasons), piglets from groups 3 and 4 were euthanized by lethal injection. Gross pathological examination of each carcass was performed, detailed information was recorded, and samples were collected for further analysis.

[0489] Sample collection and processing:

[0490] Blood sampling (sows): Blood samples (up to 10 ml) were collected from all sows on days 14, 0, 7, 14, 21, 28, 35, 42 and 49. Blood was collected into 10 ml evacuated non-heparinized tubes using a sterile needle and syringe of appropriate size.

[0491] Blood sampling (piglets): Blood samples (up to 5 ml) were collected from piglets in Groups 3 and 4 on days 62, 70, 77, 84 and 91. Blood samples (up to 5 ml) were collected from piglets in Groups 5 and 6 on days 62, 70, 84, 91, 119, 127, 131, 133, 140 and 147.

[0492] Blood sample processing : After collection, non-heparinized blood samples are transferred to the laboratory and allowed to stand overnight (16 hours to 24 hours) at +2°C to +8°C or stand for 30 minutes to 45 minutes at +37°C (+2°C) to coagulate. The coagulated blood samples are then centrifuged at 2000x g (about 3000rpm) for 20 minutes, and the serum is transferred to duplicate plastic serum collection tubes. Serum aliquots are stored at -20°C (+10°C) before analysis.

[0493] Colostrum sampling : Colostrum (up to 10 ml) was collected from each sow as soon as possible after farrowing (within 24 hours) into a sterile container. The samples were transferred to the laboratory and a volume of rennet (approximately 20 μl rennet to 1 ml of milk) was added to the colostrum, mixed thoroughly and incubated at 37°C (±2°C) for 1 hour. After incubation, each sample was centrifuged at 18,000 x g for 3 minutes and the whey portion was transferred to a separate sterile container. The whey samples were stored at -20°C (+10°C) before analysis.

[0494] Autopsy samples : At necropsy, one brain sample and two tonsil samples were removed from each animal using sterile forceps and a scalpel and placed in sterile containers for bacteriological analysis. The remaining tonsil samples were placed in sterile containers and stored at -20°C (±10°C).

[0495] At necropsy, samples were collected from the brainstem, pleura, peritoneum, spleen, joints (left front leg), and pericardium using cotton swabs.

[0496] ELISA for detection of IgG in pig serum using antigen coated plates: 8×12 flat bottom microtiter plates (Nunc) were coated with 100 μL of each protein antigen (4 μg / ml, dissolved in PBS pH 7.3) per well at 20°C-25°C overnight. After coating, 100 μL of 2% BSA (bovine serum albumin, Sigma Aldrich, catalog #A4503) in PBS was added to each well and the plates were incubated at 37°C for one hour. The wells were washed five times with 250 μL PBST (PBS with 0.05% Tween 20, Sigma Aldrich, catalog #P1379) using a Tecan HydroSpeed ​​plate washer. 100 μL of 5% animal serum in PBST was added to the first well, followed by 2-fold serial dilutions of serum to the remaining wells in the row. The plates were incubated at 37°C for two hours. The wells were washed 5 times with 250 μL PBST. 100 μL of anti-swine IgG antibody (Sigma-Aldrich, catalog number #A5670) conjugated to HRP (horseradish peroxidase) diluted 10,000 times in PBST was added to the wells, and the plate was incubated at 37°C for one hour. The wells were washed 5 times with 250 μL PBST. 100 μL OPD substrate prepared according to the manufacturer's recommendations (Sigma-Aldrich, catalog number #P9187) was added to each well. After incubation for 14 minutes, 100 μL 0.5 mol / L H2SO4 was added to terminate the reaction. The absorbance at 492 nm was measured using a plate spectrophotometer (Tecan Sunrise). Titers were calculated based on a graph showing the relationship between the logarithm of serum dilution and the absorbance at 492 nm. The regression line of the linear point around absorbance 1.5 was determined in MS Excel and the titer was calculated as the logarithm of the serum dilution corresponding to absorbance 1.5.

[0497] result Piggivac4 induces antibody responses in vaccinated sows. Before the first vaccination, the antibody levels to the components of Piggivac4 were similar in both sows. From day 7 post-vaccination, sow 2580 vaccinated with Piggivac4 had increased antibody levels to the vaccine components, while there was no change in the levels measured in the sera from control sows (Table 6).

[0498] Table 6. Antibody titers against Piggivac4 antigen in sera recovered from pregnant sows.

[0499]

[0500] Significant antibody responses were transferred from Piggivac4-vaccinated sows to piglets.

[0501] Piglets in Group 3 from vaccinated sows had significantly higher antibody levels to components of Piggivac4 from birth and throughout the study period when compared to levels measured in piglets in Group 4 from control sows (P<0.0001 at all time points, Table 7).

[0502]

[0503]

[0504] Table 7. Antibody titers against Piggivac4 antigen in sera recovered from piglets. N / A indicates that the sample was not available for analysis.

[0505] More piglets from Piggivac4-vaccinated sows reached the study endpoint 7 days after challenge.

[0506] Overall, 3 of 9 piglets in Group 3 and 6 of 10 piglets in Group 4 were euthanized before the end of the study (P = 0.4, Fisher's exact two-tailed test). The first piglets in Group 4 (from control sows) were euthanized at the humane endpoint on day 1 post-challenge, while the first piglets from Group 4 were euthanized on day 3 post-challenge, but the earlier euthanasia time did not reach statistical significance (P = 0.3, two-tailed Mann-Whitney U test), and analysis by log-rank test did not reach statistical significance (P = 0.2, Figure 5 ). However, a clear trend was observed.

[0507] Piglets from Piggivac4-vaccinated sows had significantly lower rectal temperatures on days 1 and 2 post-challenge.

[0508] The slower onset of severe signs in piglets from sows vaccinated with Piggivac4 was reflected in significantly lower rectal temperatures in piglets in Group 3 on days 1 and 2 post-challenge (P = 0.001, P = 0.006, respectively, two-tailed Student's t-test, Figure 6 ).

[0509] The onset of rectal temperature increase was also significantly delayed in piglets from sows vaccinated with Piggivac4, as shown by the time required for piglets to develop a rectal temperature of 40°C or higher based on two of three consecutive observations (P = 0.03, log-rank test, Figure 7 ).

[0510] Piglets from Piggivac4-vaccinated sows had lower behavior scores after challenge.

[0511] The behavior scores of piglets in Group 3 were lower than those in the control group, but these behavior scores did not reach statistical significance (P ≥ 0.1 on all days, two-tailed Mann-Whitney U test, Figure 8 ).

[0512] Overall, 3 of 9 piglets in Group 3 and 7 of 10 piglets in Group 4 developed demeanor scores of 2 or higher by the end of the study (P = 0.2, Fisher's exact two-tailed test). The first piglets in both groups developed demeanor scores of 2 or higher by day 2 post-challenge, and there was no statistically significant difference in the initial demeanor scores by the log-rank test (P = 0.2, Fig. 9 ). However, a clear trend was observed.

[0513] Piglets from Piggivac4-vaccinated sows had lower CNS scores after challenge.

[0514] Piglets in Group 3 had lower CNS scores than those in the control group, but these did not reach statistical significance (P ≥ 0.2 on all days, two-tailed Mann-Whitney U test, Fig.10 ).

[0515] Overall, 3 of 9 piglets in Group 3 and 6 of 10 piglets in Group 4 developed a CNS score of 1 on two of three consecutive days before the end of the study (P = 0.4, Fisher's exact two-tailed test). The first piglets in both groups developed a CNS score of 1 or higher on day 2 post-challenge, and there was no statistically significant difference in the initial CNS score by the log-rank test (P = 0.3, Fig.11 ). However, a clear trend was observed.

[0516] Piglets from Piggivac4-vaccinated sows had lower activity scores after challenge.

[0517] Activity scores of piglets in Group 3 were lower than those in the control group, but these did not reach statistical significance (P ≥ 0.1 on all days, two-tailed Mann-Whitney U test, Fig.12 ).

[0518] Overall, 8 of 9 piglets in Group 3 and 9 of 10 piglets in Group 4 developed an activity score of 1 on two of three consecutive days before the end of the study (P = 1.0, Fisher's exact two-tailed test). The first piglets in both groups developed an activity score of 1 or higher for two consecutive observations on day 2 post-challenge, and there was no statistically significant difference in the start of activity scores by the log-rank test (P = 0.9, Fig.13). However, a clear trend was observed.

[0519] Piglets from Piggivac4-vaccinated sows had lower overall clinical scores after challenge.

[0520] The total clinical scores of piglets in Group 3 were lower than those in the control group, but these total clinical scores did not fully reach statistical significance (P ≥ 0.1 on all days, two-tailed Mann-Whitney U test, Fig.14 ).

[0521] Overall, 4 of 9 piglets in Group 3 and 7 of 10 piglets in Group 4 developed a total clinical score of ≥ 5 on two of three consecutive days before the end of the study (P = 0.4, Fisher's exact two-tailed test). The first piglets in Group 3 developed a total clinical score of 5 or higher on Day 2 post-challenge for two of three consecutive observations, while the first piglets in Group 4 achieved this total clinical score on Day 4 for two of three consecutive observations. However, there was no statistical significance of a significant difference in the onset of greater total clinical scores by the log-rank test (P = 0.2, Fig.15 ), but a clear trend was observed.

[0522] Example 8

[0523] Efficacy of Streptococcus suis vaccine against experimental Streptococcus suis challenge in piglets

[0524] In this example, 1 ml of five fusion polypeptides (i.e., BCA, 4Zn+3, 5AsL, SP274C-ny, and 3PCS) correspond to SEQ ID NOs: 49, 50, 51, 53, and 54, respectively, and include SEQ ID NOs: 43, 44, 45, 46, and 48. The combination of the five fusion polypeptides is called Piggivac 5. On days -92, -71, and -43, 1 ml containing 100 μg of the five fusion polypeptides (also referred to as fusion antigens) was injected into two groups (four pregnant sows in each group) (Group 1 and Group 2, respectively) with 100 μg of MatrixV adjuvant or adjuvant-only control.

[0525] Piglets were farrowed and weaned at approximately 4 weeks of age. Two groups of approximately 5 piglets from each vaccinated sow (Group 3) or control sow (Group 4) (20 piglets per group) received between 8.3×10 7 With 1.1×10 8Piglets from Groups 3 and 4 were challenged intravenously with a dose of serotype 2 S. suis isolate 23 / P0278 / 02 / 11 between 1 and 2 days. Piglets from Groups 3 and 4 were then monitored for signs of infection for 14 days. Piglets were euthanized when health endpoint criteria were reached or at the end of the study on day 14 after challenge.

[0526] In the second challenge phase, two groups of approximately 5 piglets from each vaccinated sow (Group 5) or control sow (Group 6) (20 piglets per group) received between 6.5×10 7 With 7.1×10 7 Piglets from Groups 5 and 6 were challenged intravenously with a dose of serotype 2 S. suis isolate 23 / P0278 / 02 / 11 between 1 and 2 days. Piglets from Groups 5 and 6 were then monitored for signs of infection for 14 days. Piglets were euthanized when health endpoint criteria were reached or at the end of the study on day 14 after challenge.

[0527] Piglets from Piggivac5 vaccinated sows (Group 3) had significantly lower rectal temperatures, demeanor scores, CNS scores, activity scores, and total clinical scores than piglets from control sows (Group 4). The onset of rectal temperatures ≥ 40.5°C and all clinical scores were significantly delayed in Group 3 piglets. There was a trend for piglets in Group 3 to reach clinical endpoints later than piglets in Group 4 and be euthanized, with 11 of 20 piglets in Group 3 and 8 of 20 piglets in Group 4 still alive at the end of the study period. Piglets from Piggivac5 vaccinated sows in Group 3 gained significantly more weight after challenge compared to Group 4.

[0528] In the second challenge period, the behavior scores, CNS scores, activity scores and total clinical scores of piglets from Piggivac5-vaccinated sows (Group 5) were significantly lower than those of piglets from control sows (Group 6). The onset of all clinical scores was significantly delayed in piglets from Group 5. There was a trend for piglets in Group 5 to reach clinical endpoints later than piglets in Group 6 and be euthanized, with 8 of 20 piglets in Group 5 and 4 of 20 piglets in Group 6 still alive at the end of the study period. Piglets from Piggivac5-vaccinated sows in Group 5 tended to gain more weight after challenge than piglets in Group 6.

[0529] In conclusion, vaccination of sows with Piggivac 5 significantly protected their piglets against S. suis challenge at 4 and 7 weeks of age.

[0530] Materials and methods:

[0531] Test animals:Detailed information on the sows and piglets used in this study is given in Table 7 below.

[0532]

[0533]

[0534] Table 8. Details of animals used in the study.

[0535] Test and control materials : The test material was prepared according to Table 9, and the control group received a control dose of an adjuvant selected to simulate the test material dosage regimen. The formulation comprising BCA, 4Zn+3, 5AsL, SP274 and 3PCS is also referred to herein as "Piggivac5".

[0536] Study Design and Procedures A summary of the study design is given in Table 10. A total of eight pregnant pigs (approximately 40 days of gestation) were obtained from a commercial piggery with no history of clinical disease with S. suis.

[0537] Once at the site, the animals were housed on straw and provided with drinking water and feed for the gestating sows. Upon arrival, the sows were examined by the veterinarian to confirm that they were in good general health and blood samples were collected from each sow. Blood samples were collected before each vaccination and weekly during the vaccination period. Sows in Group 1 were administered Piggivac5 by the intramuscular route and sows in Group 2 were injected with a placebo vaccine on days -92, -71, and -43. On day -36, the animals were transferred to farrowing crates. The animals farrowed on days -29 and -28. Final blood samples were collected after farrowing was completed.

[0538]

[0539] Table 9: Information about test and control materials.

[0540] After farrowing, piglets are checked to confirm that they are in good health, and the number of live piglets / dead piglets is recorded. All piglets are encouraged to take as much colostrum as possible. Blood samples are collected from all piglets (the 3rd, 4th, 5th and 6th groups) within 24 hours of farrowing and on the 0th day and the 14th day. During 28 days, the veterinarian has checked all piglets. Ten piglets are selected and weaned in every litter. Then, piglets (the 3rd and 5th groups) from the sows inoculated with Piggivac5 and those piglets (the 4th and 6th groups) from the sows inoculated with placebo are stimulated at 4 weeks of age (the 3rd and 4th groups) or at 7 weeks of age (the 5th and 6th groups) by intravenous route with serotype 2 Streptococcus suis isolate 23 / P0278 / 02 / 11.

[0541] After challenge, piglets were observed twice daily for signs of illness and additional health observations were performed as needed.

[0542] On day 14 after challenge, the remaining animals were euthanized and samples were collected after necropsy for further analysis.

[0543]

[0544] Table 10: Summary of study design.

[0545]

[0546]

[0547] Table 11: Research agenda

[0548] Stimulate preparation: Streak the S. suis isolate (23 / P0278 / 02 / 11) onto 5% sheep blood agar plates (2 plates total) on day -1 and day 22. Incubate the plates at +37°C (±2°C) aerobic conditions overnight for 20 to 24 hours.

[0549] After incubation, check the plate and confirm that its growth is consistent with the expectation of the isolate. Bacterial colonies are removed from each plate and added to 2×3ml of preheated plant peptone liquid medium supplemented with 3% (v / v) horse serum (supplemented with VPB) in a bijoux bottle, and grown to a turbidity of 1.5McFarland turbidity units (McF) at +37°C (±2°C) (optical density is measured using a densitometer (BioMerieux)). Each 3ml volume is then added to 97ml of preheated supplemented VPB to obtain 2×100ml excitation cultures, which are incubated 4 (±0.5) hours at +37°C (±2°C) on an orbital shaker set at 150rpm.

[0550] The contents of one culture were diluted 1:10 in 90 ml of VPB and used to challenge animals from Groups 3 and 4, with an expected concentration of 5 × 10 7 cfu / ml. Take a 2 ml sample of the challenge material for back titration. Keep the challenge material refrigerated (+2 to +8°C) until use.

[0551] Stimulation application On day 0 (at 4 weeks of age) and day 23 (at 7 weeks of age), all animals from groups 3 and 4, or groups 5 and 6, were administered 2 ml of a 4.15 × 10 7 cfu / ml to 5.05×10 7 cfu / ml, and 3.25×10 7cfu / ml to 3.55×10 7 cfu / ml of S. suis challenge material as measured by back titration via the intravenous route (jugular vein, using a separate sterile needle and syringe for each animal).

[0552] Clinical observation : On the day of challenge (day 0 and day 23), clinical observations were performed by experienced personnel 4 (± 1) hours before and after challenge. Clinical observations were then performed twice a day from day 1 to day 13 in the first phase and twice a day from day 24 to day 37 in the second phase, with only one planned observation performed on day 14 or day 37 before necropsy. Additional health observations were performed at a frequency determined by the condition of the animals during days 1 to 14 or 24 to 37.

[0553] Clinical observations included assessment of demeanor, behavioral / CNS changes, lameness, and rectal temperature (°C) according to a scoring system (Table 12). Other comments related to behavioral or neurological issues were recorded as comments.

[0554]

[0555] Table 12: Clinical scoring system

[0556] The individual scores for each clinical score were summed during data tabulation to give a total clinical score for each animal in each observation.

[0557] For humane reasons, piglets lying / moribund and / or showing severe signs of distress were immediately euthanized by administering a lethal dose of sodium pentobarbital BP. The last observation carried forward method was used in cases where data were lost due to euthanasia before the end of the study.

[0558] Arranged euthanasia: After weaning of piglets (day -4), sows were euthanized by approved methods. On day 14, all remaining piglets in groups 3 and 4 were euthanized by lethal injection (sodium pentobarbital BP (Vet) 20% w / v (Pentoject or equivalent)). On day 37, all remaining piglets in groups 5 and 6 were euthanized by lethal injection (sodium pentobarbital BP (Vet) 20% w / v (Pentoject or equivalent)).

[0559] Autopsy: On day 14 or 37 (or as required for health reasons), piglets from groups 3 and 4 were euthanized by lethal injection. Each carcass was weighed and gross pathological examination was performed, detailed information was recorded and samples were collected for further analysis.

[0560] Sample collection and processing:

[0561] Blood sampling (sows): Blood samples (up to 10 ml) were collected from all sows on days -99, -92, -85, -78, -71, -64, -57, -50, -43, -36, -29 and -28. Blood was collected into 10 ml evacuated non-heparinized tubes using a sterile needle and syringe of appropriate size.

[0562] Blood sampling (piglets) Blood samples (up to 1 ml) were collected from all piglets within 24 hours of birth (days -27 / -26). Up to 5 ml of blood was then collected on days 0 and 14 (groups 3 and 4) or days 0, 23 and 37 (groups 5 and 6).

[0563] Blood sample processing : After collection, non-heparinized blood samples are transferred to the laboratory and allowed to stand overnight (16 hours to 24 hours) at +2°C to +8°C or stand for 30 minutes to 45 minutes at +37°C (+2°C) to coagulate. The coagulated blood samples are then centrifuged at 2000x g (about 3000rpm) for 20 minutes, and the serum is transferred to duplicate plastic serum collection tubes. Serum aliquots are stored at -20°C (+10°C) before analysis.

[0564] Colostrum sampling : Colostrum (up to 10 ml) was collected from each sow as soon as possible after farrowing (within 24 hours) into a sterile container. The samples were transferred to the laboratory and a volume of rennet (approximately 20 μl rennet to 1 ml of milk) was added to the colostrum, mixed thoroughly and incubated at 37°C (±2°C) for 1 hour. After incubation, each sample was centrifuged at 18,000 x g for 3 minutes and the whey portion was transferred to a separate sterile container. The whey samples were stored at -20°C (+10°C) before analysis.

[0565] Autopsy samples : At necropsy, one brain sample and two tonsil samples were removed from each animal using sterile forceps and scalpels and placed in sterile containers for bacteriological analysis. The remaining tonsil samples were placed in sterile containers and stored at -20°C (±10°C). At necropsy, cotton swabs were used to collect samples from the brain stem, pleura, peritoneum, spleen, joints (left front leg), and pericardium for culture analysis.

[0566] Results Motivation Phase 1 (Groups 3 and 4, 4 weeks of age at challenge):

[0567] More piglets from Piggivac5-vaccinated sows reached the study endpoint 14 days after challenge.

[0568] Overall, 9 of 20 piglets in Group 3 and 12 of 20 piglets in Group 4 were euthanized before the end of the study (P = 0.53, Fisher's exact two-tailed test). Piglets from control sows in Group 4 tended to reach humane endpoints earlier and were euthanized, although the earlier euthanasia time did not reach statistical significance (P = 0.18, two-tailed Mann-Whitney U test) and analysis by log-rank test did not reach statistical significance (P = 0.23, Fig.16 ).

[0569] Piglets from Piggivac5-vaccinated sows had significantly lower rectal temperatures after challenge.

[0570] Twelve piglets from Piggivac5-vaccinated sows and all 20 piglets from control sows reached body temperatures ≥ 40.5°C (P = 0.003, Fisher's exact two-tailed test). The slower onset of severe signs in piglets from Piggivac5-vaccinated sows was reflected in significantly lower rectal temperatures in piglets in Group 3 on days 2, 3, 4, and 6 post-challenge (two-tailed Student's t-test, Fig.17 ).

[0571] The onset of rectal temperature increase was significantly delayed in piglets from Piggivac5-vaccinated sows, as indicated by the time required for piglets to develop a rectal temperature of 40.5°C or higher (P = 0.00003, log-rank test, Fig.18 .

[0572] Piglets from Piggivac5-vaccinated sows had significantly lower behavior scores after challenge.

[0573] Fifteen piglets from Piggivac5-vaccinated sows and all 20 piglets from control sows obtained behavior scores (P=0.05, Fisher's exact two-tailed test). The behavior scores of piglets in Group 3 were significantly lower than those in the control group on days 2, 3, 4, 5, 6, 7, 8, 9, 10, and 12 after challenge (Mann-Whitney U test, Fig.19 The first piglets in both groups developed demeanor scores of 1 or higher by day 2 post-challenge, but overall there was a highly significant statistical difference in the initial demeanor scores by the log-rank test (P = 0.000004, Fig. 20 ).

[0574] Piglets from Piggivac5-vaccinated sows had significantly lower CNS scores after challenge.

[0575] Eleven piglets from Piggivac5-vaccinated sows and all 20 piglets from control sows had CNS scores (P=0.001, Fisher's exact two-tailed test). CNS scores of piglets in Group 3 were significantly lower than those in the control group on days 2, 4, 5, 6, 8, 9, and 10 after challenge (two-tailed Mann-Whitney U test, Fig.21 The first piglets in both groups developed CNS scores of 1 or higher on day 1 post-challenge, but overall there were highly significant differences in the initial CNS scores by log-rank test (P = 0.0005, Fig. 22 ).

[0576] Piglets from Piggivac5-vaccinated sows had significantly lower activity scores after challenge.

[0577] Overall, 8 of 20 piglets in Group 3 and 17 of 20 piglets in Group 4 developed activity scores > 1 by the end of the study (P = 0.008, Fisher's exact two-tailed test). Activity scores of piglets in Group 3 were significantly lower than those in the control group on days 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, and 14 post-challenge (two-tailed Mann-Whitney U test, Fig.23 ).

[0578] The first piglets in both groups developed activity scores >1 by day 2 post-challenge, but there was a highly significant difference in the start of activity scores >1 by the log-rank test (P = 0.003, Fig.24 ).

[0579] Piglets from Piggivac5-vaccinated sows had significantly lower total clinical scores after challenge.

[0580] Overall, 9 of 20 piglets in Group 3 and 19 of 20 piglets in Group 4 developed total clinical scores of ≥ 5 before the end of the study (P = 0.001, Fisher's exact two-tailed test). The total clinical scores of piglets in Group 3 were significantly lower than those in the control group on days 2, 3, 4, 5, 6, 7, 8, 9, and 10 (two-tailed Mann-Whitney U test, Fig.25 ). On day 2 post-challenge, the first piglets in both groups achieved a total clinical score of 5 or higher in two of three consecutive observations. However, by log-rank test, there was a highly significant difference in the onset of total clinical scores of 5 or higher (P = 0.0006, Fig.26 ).

[0581] Piglets from vaccinated sows gained significantly more weight after challenge.

[0582] Piglets were weighed five days before challenge, immediately before challenge, on days 7 and 14 after challenge, or at the time of euthanasia. The body weight of each piglet was calculated as a percentage of the time of challenge (day 0). The body weight of piglets from vaccinated sows was not significantly different from that of piglets from unvaccinated sows on day -5 or day 0 before challenge. However, on day 14 after challenge, piglets from Piggivac5-vaccinated sows had a significantly higher weight gain after challenge than piglets from group 4 (P = 0.02, Fig. 27 ).

[0583] Results Motivation Phase 2 (Groups 5 and 6, 7 weeks of age at challenge):

[0584] More piglets from Piggivac5-vaccinated sows reached the study endpoint 14 days after challenge.

[0585] Overall, 12 of 20 piglets in Group 5 and 16 of 20 piglets in Group 4 were euthanized before the end of the study (P = 0.30, Fisher's exact two-tailed test). Piglets from control sows in Group 6 tended to reach humane endpoints earlier and were euthanized, although the earlier euthanasia time did not reach statistical significance (P = 0.28, two-tailed Mann-Whitney U test) and analysis by log-rank test did not reach statistical significance (P = 0.19, Fig.28 ).

[0586] Piglets from Piggivac5-vaccinated sows tended to have lower rectal temperatures after challenge.

[0587] Eleven piglets from Piggivac5-vaccinated sows and 14 piglets from control sows reached a body temperature of ≥41°C (P=0.51, Fisher's exact two-tailed test). Starting from day 6 post-challenge, piglets from Piggivac5-vaccinated sows (Group 5) tended to have lower rectal temperatures than piglets from control sows in Group 6 ( Fig.29 The onset of rectal temperature increase was delayed in piglets from Piggivac5-vaccinated sows, as indicated by the time required for piglets to develop a rectal temperature of 41°C or higher, but this did not reach statistical significance (P = 0.28, log-rank test, Fig.30 ).

[0588] Piglets from Piggivac5-vaccinated sows had significantly lower behavior scores after challenge.

[0589] Two piglets from Piggivac5-vaccinated sows and nine piglets from control sows all achieved a demeanor score of >2 (P=0.03, Fisher's exact two-tailed test). The demeanor scores of Group 5 piglets were significantly lower than those of the control group on days 5 to 14 post-challenge (Mann-Whitney U test, Fig.31 By log-rank test, there was a significant statistical difference in the onset of behavior scores>2 (P=0.01, Fig.32 ).

[0590] Piglets from Piggivac5-vaccinated sows had significantly lower CNS scores after challenge.

[0591] Nine piglets from Piggivac5-vaccinated sows and 15 piglets from control sows had CNS scores (P = 0.11, Fisher's exact two-tailed test). On day 2 post-challenge, CNS scores of piglets in Group 5 were significantly lower than those in the control group (two-tailed Mann-Whitney U test, Fig.33 By log-rank test, there was a significant difference in the onset of CNS scores (P = 0.005, Fig.34 ).

[0592] Piglets from Piggivac5-vaccinated sows had significantly lower activity scores after challenge.

[0593] Overall, 3 of 20 piglets in Group 5 and 10 of 20 piglets in Group 6 developed activity scores > 2 before the end of the study (P = 0.04, Fisher's exact two-tailed test). Activity scores of piglets in Group 5 were significantly lower than those in the control group on days 4 to 14 post-challenge (two-tailed Mann-Whitney U test, Fig.35 By log-rank test, there was a significant difference in the onset of activity score>2 (P=0.02, Fig.36 ).

[0594] Piglets from Piggivac5-vaccinated sows had significantly lower total clinical scores after challenge.

[0595] Overall, 8 of 20 piglets in Group 5 and 16 of 20 piglets in Group 6 developed total clinical scores of ≥ 7 before the end of the study (P = 0.02, Fisher's exact two-tailed test). Total clinical scores of piglets in Group 5 were significantly lower than those in the control group on days 5 to 14 post-challenge (two-tailed Mann-Whitney U test, Fig.37 By log-rank test, there was a significant difference in the onset of total clinical score of 7 or higher (P = 0.03, Fig.38 ).

[0596] Piglets from vaccinated sows gained more weight after challenge.

[0597] Piglets were weighed immediately before challenge and then 14 days after challenge or at the time of euthanasia. The body weight of each piglet was calculated as a percentage of the time of challenge (day 0). Piglets from vaccinated sows gained more weight after challenge, but this did not reach statistical significance (P = 0.19, Fig.39 Six of the piglets from Piggivac5-vaccinated sows gained more than 50% body weight compared to only one of the piglets from control sows (P=0.09).

[0598] Implementation plan list

[0599] 1. An immunogenic composition comprising at least one first fusion polypeptide and one second fusion polypeptide, wherein the first fusion polypeptide comprises fragments of at least three native full-length polypeptides from Streptococcus suis.

[0600] 2. The immunogenic composition of item 1, wherein the second fusion polypeptide comprises fragments of at least three native full-length polypeptides from Streptococcus suis.

[0601] 3. The immunogenic composition as described in item 1 or 2, optionally further comprising a third fusion polypeptide.

[0602] 4. The immunogenic composition according to any one of items 1 to 3, optionally further comprising a fourth fusion polypeptide.

[0603] 5. The immunogenic composition of any one of items 1-4, optionally further comprising a fifth fusion polypeptide.

[0604] 6. The immunogenic composition of any one of items 3-5, wherein the third fusion polypeptide, the fourth fusion polypeptide and / or the fifth fusion polypeptide comprise fragments from at least three natural full-length polypeptides from Streptococcus suis.

[0605] 7. An immunogenic composition as described in any of items 1-6, wherein the at least three natural full-length polypeptides from Streptococcus suis are independently selected or selected from the group consisting of: a zinc-binding protein from Streptococcus suis; a protease from Streptococcus suis; a nucleotidase from Streptococcus suis; a protein from Streptococcus suis containing a LPXTG motif; Amid1Sa (SEQ ID NO: 14) and any polypeptide having at least 80% identity with SEQ ID NO: 14; 15BSa (SEQ ID NO: 15) and a polypeptide having at least 80% identity with SEQ ID NO: 15; and Hom17Sa (SEQ ID NO: 16) and any polypeptide having at least 80% identity with SEQ ID NO: 16.

[0606] 8. The immunogenic composition of any one of items 1-7, wherein the at least three native full-length polypeptides from Streptococcus suis are independently selected or selected from the group consisting of: a zinc-binding protein from Streptococcus suis, a protease from Streptococcus suis, a nucleotidase from Streptococcus suis, and a protein comprising a LPXTG motif from Streptococcus suis.

[0607] 9. An immunogenic composition as described in any of items 1-8, wherein the first fusion polypeptide comprises at least three fragments selected from the following: a fragment of a zinc-binding protein from Streptococcus suis; or a fragment of a protease from Streptococcus suis; or a fragment of a nucleotidase from Streptococcus suis or a protein fragment containing a LPXTG motif from Streptococcus suis.

[0608] 10. An immunogenic composition as described in any of items 1-9, wherein the second fusion polypeptide comprises at least three fragments selected from the following: a fragment of a zinc-binding protein from Streptococcus suis; or a fragment of a protease from Streptococcus suis; or a fragment of a nucleotidase from Streptococcus suis or a protein fragment containing a LPXTG motif from Streptococcus suis.

[0609] 11. An immunogenic composition as described in any of items 3-10, wherein the third fusion polypeptide comprises at least three fragments selected from the following: a fragment of a zinc-binding protein from Streptococcus suis; or a fragment of a protease from Streptococcus suis; or a fragment of a nucleotidase from Streptococcus suis or a protein fragment containing a LPXTG motif from Streptococcus suis.

[0610] 12. An immunogenic composition as described in any of items 4-11, wherein the fourth fusion polypeptide comprises at least three fragments selected from the following: a fragment of a zinc-binding protein from Streptococcus suis; or a fragment of a protease from Streptococcus suis; or a fragment of a nucleotidase from Streptococcus suis or a protein fragment containing a LPXTG motif from Streptococcus suis.

[0611] 13. An immunogenic composition as described in any of items 5-12, wherein the fifth fusion polypeptide comprises at least three fragments selected from the following: a fragment of a zinc-binding protein from Streptococcus suis; or a fragment of a protease from Streptococcus suis; or a fragment of a nucleotidase from Streptococcus suis or a protein fragment containing a LPXTG motif from Streptococcus suis.

[0612] 14. An immunogenic composition as described in any of items 9-13, wherein each of the first, second, third, fourth and fifth fusion polypeptides comprises fragments independently selected or selected from the following, such as at least three fragments: a fragment of a zinc-binding protein from Streptococcus suis; or a fragment of a protease from Streptococcus suis; or a fragment of a nucleotidase from Streptococcus suis or a protein fragment containing a LPXTG motif from Streptococcus suis.

[0613] 15. The immunogenic composition of any one of items 8-14, wherein at least two of the first, second, third, fourth and fifth fusion polypeptides comprise fragments of a zinc-binding protein from Streptococcus suis.

[0614] 16. An immunogenic composition as described in any of items 1-15, wherein the at least three natural full-length polypeptides from Streptococcus suis are independently selected or selected from the group consisting of: a polypeptide having an amino acid sequence according to any one of SEQ ID NOs: 1-19, and any polypeptide having at least 80% identity with any one of SEQ ID NOs: 1-19; for example, selected from the group consisting of: a polypeptide having an amino acid sequence according to any one of SEQ ID NOs: 1-19.

[0615] 17. An immunogenic composition as described in any of items 1-16, wherein the at least three natural full-length polypeptides from Streptococcus suis are independently selected or selected from the group consisting of: a polypeptide having an amino acid sequence according to any one of SEQ ID NOs: 1-13 and 17-19 and a polypeptide having at least 80% identity with any one of SEQ ID NOs: 1-13 and 17-19; for example, selected from the group consisting of: a polypeptide having an amino acid sequence according to any one of SEQ ID NOs: 1-13 and 17-19.

[0616] 18. An immunogenic composition as described in any of items 1-17, wherein the first fusion polypeptide comprises at least three fragments selected from the following: a zinc-binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 1-5; or a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 6-10; or a nucleotidase having an amino acid sequence according to any one of SEQ ID NOs: 11-13 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 11-13; or a protein comprising a LPXTG motif having an amino acid sequence according to any one of SEQ ID NOs: 17-19 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 17-19.

[0617] 19. An immunogenic composition as described in any of items 1-18, wherein the first fusion polypeptide comprises at least three fragments selected from the following: a fragment of a zinc-binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5; or a fragment of a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10; or a fragment of a nucleotidase having an amino acid sequence according to any one of SEQ ID NOs: 11-13, or a fragment of a protein comprising a LPXTG motif having an amino acid sequence according to any one of SEQ ID NOs: 17-19.

[0618] 20. An immunogenic composition as described in any of items 1-19, wherein the second fusion polypeptide comprises at least three fragments selected from the following: a zinc-binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 1-5; or a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 6-10; or a nucleotidase having an amino acid sequence according to any one of SEQ ID NOs: 11-13 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 11-13; or a protein comprising a LPXTG motif having an amino acid sequence according to any one of SEQ ID NOs: 17-19 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 17-19.

[0619] 21. An immunogenic composition as described in any of items 1-20, wherein the second fusion polypeptide comprises at least three fragments selected from the following: a fragment of a zinc-binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5; or a fragment of a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10; or a fragment of a nucleotidase having an amino acid sequence according to any one of SEQ ID NOs: 11-13, or a fragment of a protein comprising a LPXTG motif having an amino acid sequence according to any one of SEQ ID NOs: 17-19.

[0620] 22. An immunogenic composition as described in any of items 3-21, wherein the third fusion polypeptide comprises at least three fragments selected from the following: a zinc-binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 1-5; or a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 6-10; or a nucleotidase having an amino acid sequence according to any one of SEQ ID NOs: 11-13 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 11-13; or a protein comprising a LPXTG motif having an amino acid sequence according to any one of SEQ ID NOs: 17-19 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 17-19.

[0621] 23. An immunogenic composition as described in any of items 3-22, wherein the third fusion polypeptide comprises at least three fragments selected from the following: a fragment of a zinc-binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5; or a fragment of a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10; or a fragment of a nucleotidase having an amino acid sequence according to any one of SEQID NOs: 11-13, or a fragment of a protein comprising a LPXTG motif having an amino acid sequence according to any one of SEQ ID NOs: 17-19.

[0622] 24. An immunogenic composition as described in any of items 4-23, wherein the fourth fusion polypeptide comprises at least three fragments selected from the following: a zinc-binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 1-5; or a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 6-10; or a nucleotidase having an amino acid sequence according to any one of SEQ ID NOs: 11-13 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 11-13; or a protein comprising a LPXTG motif having an amino acid sequence according to any one of SEQ ID NOs: 17-19 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 17-19.

[0623] 25. An immunogenic composition as described in any of items 4-24, wherein the fourth fusion polypeptide comprises at least three fragments selected from the following: a fragment of a zinc-binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5; or a fragment of a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10; or a fragment of a nucleotidase having an amino acid sequence according to any one of SEQ ID NOs: 11-13, or a fragment of a protein comprising a LPXTG motif having an amino acid sequence according to any one of SEQ ID NOs: 17-19.

[0624] 26. An immunogenic composition as described in any of items 5-25, wherein the fifth fusion polypeptide comprises at least three fragments selected from the following: a zinc-binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 1-5; or a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 6-10; or a nucleotidase having an amino acid sequence according to any one of SEQ ID NOs: 11-13 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 11-13; or a protein comprising a LPXTG motif having an amino acid sequence according to any one of SEQ ID NOs: 17-19 and a fragment of a polypeptide having at least 80% identity with any one of SEQ ID NOs: 17-19.

[0625] 27. An immunogenic composition as described in any of items 5-26, wherein the fifth fusion polypeptide comprises at least three fragments selected from the following: a fragment of a zinc-binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5; or a fragment of a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10; or a fragment of a nucleotidase having an amino acid sequence according to any one of SEQID NOs: 11-13, or a fragment of a protein comprising a LPXTG motif having an amino acid sequence according to any one of SEQ ID NOs: 17-19.

[0626] 28. An immunogenic composition as described in any of the preceding items, wherein each of the first, second, third, fourth and fifth fusion polypeptides comprises a fragment independently selected or selected from the following:

[0627] A zinc-binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5, and fragments of polypeptides having at least 80% identity with any one of SEQ ID NOs: 1-5; or a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10, and fragments of polypeptides having at least 80% identity with any one of SEQ ID NOs: 6-10; or a nucleotidase having an amino acid sequence according to any one of SEQ ID NOs: 11-13, and fragments of polypeptides having at least 80% identity with any one of SEQ ID NOs: 11-13; or a protein comprising a LPXTG motif having an amino acid sequence according to any one of SEQ ID NOs: 17-19, and fragments of polypeptides having at least 80% identity with any one of SEQ ID NOs: 17-19.

[0628] 29. An immunogenic composition as described in any of the preceding items, wherein each of the first, second, third, fourth and fifth fusion polypeptides comprises a fragment independently selected or selected from the following: a fragment of a zinc-binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5; or a fragment of a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10; or a fragment of a nucleotidase having an amino acid sequence according to any one of SEQ ID NOs: 11-13, or a fragment of a protein comprising a LPXTG motif having an amino acid sequence according to any one of SEQ ID NOs: 17-19.

[0629] 30. The immunogenic composition of any of the preceding items, wherein at least two of the first, second, third, fourth and fifth fusion polypeptides comprise a zinc-binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5 and a fragment of a polypeptide having at least 80% identity to any one of SEQ ID NOs: 1-5, for example wherein at least two of the first, second, third, fourth and fifth fusion polypeptides comprise a fragment of a zinc-binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5.

[0630] 31. The immunogenic composition of any of the preceding items, wherein at least one of the first, second, third, fourth and fifth fusion polypeptides comprises at least three or four fragments from a zinc-binding protein from Streptococcus suis, such as at least three, such as at least four, such as at least five fragments from different zinc-binding proteins from Streptococcus suis.

[0631] 32. The immunogenic composition of any of the preceding items, wherein at least one of the first, second, third, fourth and fifth fusion polypeptides comprises a zinc-binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5 and at least three or four fragments of a polypeptide having at least 80% identity to any one of SEQ ID NOs: 1-5, such as at least three or four fragments of a zinc-binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5; or

[0632] The immunogenic composition of any of the preceding claims, wherein at least one of the first, second, third, fourth and fifth fusion polypeptides comprises a zinc-binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5 and at least three, such as at least four, such as at least five fragments of a polypeptide having at least 80% identity to any one of SEQ ID NOs: 1-5, such as at least three, such as at least four, such as at least five fragments of a zinc-binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5.

[0633] 33. The immunogenic composition of any of the preceding items, wherein at least one of the first, second, third, fourth and fifth fusion polypeptides comprises at least three fragments from a protease from Streptococcus suis, such as at least three fragments from different proteases from Streptococcus suis.

[0634] 34. An immunogenic composition as described in any of the preceding items, wherein at least one of the first, second, third, fourth and fifth fusion polypeptides comprises a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10 and at least three fragments of a polypeptide having at least 80% identity with any of said amino acid sequences, for example at least three, for example at least four, for example at least five, for example at least six fragments of a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10.

[0635] 35. The immunogenic composition of any of the preceding items, wherein at least one of the first, second, third, fourth and fifth fusion polypeptides comprises at least three fragments from a nucleotidase from Streptococcus suis, such as at least three fragments from different nucleotidases from Streptococcus suis.

[0636] 36. An immunogenic composition as described in any of the preceding items, wherein at least one of the first, second, third, fourth and fifth fusion polypeptides comprises a nucleotidase having an amino acid sequence according to any one of SEQ ID NOs: 11-13 and at least three fragments of a polypeptide having at least 80% identity with any of said amino acid sequences, e.g., at least three fragments of a nucleotidase having an amino acid sequence according to any one of SEQ ID NOs: 11-13.

[0637] 37. The immunogenic composition of any of the preceding items, wherein at least one of the first, second, third, fourth and fifth fusion polypeptides comprises at least three fragments of a protein from Streptococcus suis comprising a LPXTG motif, such as at least three fragments from different nucleotidases from Streptococcus suis.

[0638] 38. The immunogenic composition of any of the preceding items, wherein at least one of the first, second, third, fourth and fifth fusion polypeptides comprises a protein comprising a LPXTG motif from Streptococcus suis having an amino acid sequence according to any one of SEQ ID NOs: 17-19 and at least three fragments of a polypeptide having at least 80% identity to any of said amino acid sequences, e.g., at least three fragments of a protein comprising a LPXTG motif from Streptococcus suis having an amino acid sequence according to any one of SEQ ID NOs: 17-19.

[0639] 39. The immunogenic composition of any of the preceding items, wherein at least one of the first, second, third, fourth and fifth fusion polypeptides further comprises at least one fragment, e.g., at least two fragments, e.g., at least three fragments, of at least one native full-length polypeptide having an amino acid sequence according to any one of SEQ ID NOs: 1-19 or any amino acid sequence having at least 80% identity with any one of SEQ ID NOs: 1-19.

[0640] 40. The immunogenic composition of any one of the preceding items, wherein at least one of the first, second, third, fourth and fifth fusion polypeptides further comprises

[0641] a fragment of at least one native full-length polypeptide having an amino acid sequence according to any one of SEQ ID NOs: 14-16, or any amino acid sequence having at least 80% identity to any one of SEQ ID NOs: 14-16;

[0642] For example, a fragment of each of at least two native full-length polypeptides having an amino acid sequence according to any one of SEQ ID NOs: 14-16, or any amino acid sequence with at least 80% identity to any one of SEQ ID NOs: 14-16; for example, a fragment of each of all three native full-length polypeptides having an amino acid sequence according to any one of SEQ ID NOs: 14-16, or any amino acid sequence with at least 80% identity to any one of SEQ ID NOs: 14-16.

[0643] 41. The immunogenic composition of any one of the preceding items, wherein at least one of the first, second, third, fourth and fifth fusion polypeptides further comprises

[0644] A fragment of at least one native full-length polypeptide having an amino acid sequence according to any one of SEQ ID NOs: 14-16, for example a fragment of each of at least two native full-length polypeptides having an amino acid sequence according to any one of SEQ ID NOs: 14-16; for example a fragment of each of all three native full-length polypeptides having an amino acid sequence according to any one of SEQ ID NOs: 14-16.

[0645] 42. The immunogenic composition of any of the preceding items, wherein at least one of the first, second, third, fourth and fifth fusion polypeptides comprises at least two fragments from the same native full-length polypeptide from Streptococcus suis, and wherein the fragments are different fragments from the same native full-length polypeptide from Streptococcus suis.

[0646] 43. The immunogenic composition of item 42, wherein the native full-length polypeptide from Streptococcus suis is a protease from Streptococcus suis or a zinc-binding protein from Streptococcus suis.

[0647] 44. The immunogenic composition of any one of items 42 and 43, wherein the native full-length polypeptide is SEQ ID NO: 9 or any amino acid sequence that is at least 80% identical to SEQ ID NO: 9, for example wherein the native full-length polypeptide is SEQ ID NO: 9.

[0648] 45. The immunogenic composition of any of the preceding items, wherein said at least two of said first, second, third, fourth and fifth fusion polypeptides comprise at least one fragment, each of which is derived from the same native full-length polypeptide from Streptococcus suis, such as from the same two native full-length polypeptides from Streptococcus suis, such as from the same three native full-length polypeptides from Streptococcus suis; and wherein the fragments are different fragments of the same native full-length polypeptide from Streptococcus suis.

[0649] 46. ​​The immunogenic composition of item 45, wherein the native full-length polypeptide from Streptococcus suis is a zinc-binding protein from Streptococcus suis.

[0650] 47. The immunogenic composition of any of the preceding items, wherein the composition comprises three, four or five fusion polypeptides, such as wherein the composition comprises four or five fusion polypeptides, such as wherein the composition comprises five fusion polypeptides.

[0651] 48. The immunogenic composition of any of the preceding items, wherein the composition comprises a first fusion polypeptide, a second fusion polypeptide, a third fusion polypeptide and a fourth fusion polypeptide;

[0652] or wherein the composition comprises a first fusion polypeptide, a second fusion polypeptide and a fourth fusion polypeptide and a fifth fusion polypeptide;

[0653] or wherein the composition comprises a first fusion polypeptide, a second fusion polypeptide, a third fusion polypeptide, and a fifth fusion polypeptide;

[0654] Or wherein the composition comprises a first fusion polypeptide, a second fusion polypeptide, a third fusion polypeptide, a fourth fusion polypeptide and a fifth fusion polypeptide.

[0655] 49. The immunogenic composition of any of the preceding items, wherein the fragment of the zinc-binding polypeptide is selected from the group consisting of fragments of the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, and fragments of any amino acid sequence having at least 80% identity thereto, such as the group consisting of fragments of the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and fragments of any amino acid sequence having at least 80% identity thereto.

[0656] 50. An immunogenic composition as described in claim 49, wherein the fragment of the zinc-binding protein is selected from the group consisting of: a polypeptide fragment comprising an amino acid sequence selected from SEQ ID NOs: 20-27, and any amino acid sequence having at least 80% identity with any one of SEQ ID NOs: 20-27, for example, a group consisting of: a polypeptide fragment comprising an amino acid sequence selected from SEQ ID NOs: 20-27.

[0657] 51. The immunogenic composition of any of the preceding items, wherein the fragment of the protease is selected from the group consisting of fragments of the amino acid sequences SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, and fragments of any amino acid sequence that is at least 80% identical to the fragment.

[0658] 52. An immunogenic composition as described in claim 51, wherein the fragment of the protease is selected from the group consisting of: a polypeptide fragment comprising an amino acid sequence selected from SEQ ID NO: 28-33, and any amino acid sequence having at least 80% identity with any one of SEQ ID NO: 28-33, for example, a group consisting of: a polypeptide fragment comprising an amino acid sequence selected from SEQ ID NO: 28-33.

[0659] 53. The immunogenic composition of any of the preceding items, wherein the fragment of the nucleotidase is selected from the group consisting of fragments of the amino acid sequences SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, and fragments of any amino acid sequence having at least 80% identity with the fragments.

[0660] 54. An immunogenic composition as described in item 53, wherein the fragment of the nucleotidase is selected from the group consisting of: a polypeptide fragment comprising an amino acid sequence selected from SEQ ID NO: 34-36, and any amino acid sequence having at least 80% identity with any one of SEQ ID NO: 34-36, for example, a group consisting of: a polypeptide fragment comprising an amino acid sequence selected from SEQ ID NO: 34-36.

[0661] 55. The immunogenic composition of any of the preceding items, wherein the fragment of the protein comprising the LPXTG motif is selected from the group consisting of fragments of the amino acid sequences SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, and fragments of any amino acid sequence having at least 80% identity with the fragments.

[0662] 56. An immunogenic composition as described in claim 55, wherein the fragment of the protein comprising the LPXTG motif is selected from the group consisting of: a polypeptide fragment comprising an amino acid sequence selected from SEQ ID NOs: 40-42, and any amino acid sequence having at least 80% identity with any one of SEQ ID NOs: 40-42, for example, a group consisting of: a polypeptide fragment comprising an amino acid sequence selected from SEQ ID NOs: 40-42.

[0663] 57. The immunogenic composition of any of the preceding items, wherein the fragment is selected from the group consisting of fragments of the amino acid sequences SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, and fragments of any amino acid sequence having at least 80% identity thereto.

[0664] 58. An immunogenic composition as described in claim 57, wherein the fragment is selected from the group consisting of: SEQ ID NO: 37-39, and any amino acid sequence having at least 80% identity with any one of SEQ ID NO: 37-39, for example, the group consisting of: a polypeptide fragment comprising an amino acid sequence selected from SEQ ID NO: 37-39.

[0665] 59. The immunogenic composition of any of the preceding items, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises at least one, such as at least two, such as at least three fragments selected from the group consisting of: SEQ ID NOs: 20-22, and any amino acid sequence having at least 80% identity with any one of SEQ ID NOs: 20-22.

[0666] 60. The immunogenic composition of claim 59, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises SEQ ID NO: 20, 21 and 22.

[0667] 61. An immunogenic composition as described in claim 59 or 60, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises SEQ ID NO:43, or an amino acid sequence that is at least 80% identical to SEQ ID NO:43, or wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises SEQ ID NO:106, or an amino acid sequence that is at least 80% identical to SEQ ID NO:106.

[0668] 62. An immunogenic composition as described in claim 59 or 60, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises SEQ ID NO:43, wherein, independently of each other, the amino acid residue at position 303 may be absent, present, or not G, and the amino acid residue at position 304 may be absent, present, or not S.

[0669] 63. An immunogenic composition as described in item 61 or 62, wherein the SEQ ID NO: 43 or 106 further comprises an N-terminal M or MT and optionally comprises a C-terminal His tag.

[0670] 64. The immunogenic composition of any of the preceding items, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises at least one, such as at least two, such as at least three, such as at least four, such as at least five, such as at least six, such as at least seven, such as eight fragments selected from the group consisting of: SEQ ID NOs: 23-27 and SEQ ID NOs: 37-39, and any amino acid sequence having at least 80% identity with any one of SEQ ID NOs: 23-27 and SEQ ID NOs: 37-39.

[0671] 65. The immunogenic composition of claim 64, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises SEQ ID NOs: 23-27 and SEQ ID NOs: 37-39.

[0672] 66. An immunogenic composition as described in item 64 or 65, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises SEQ ID NO:44, or an amino acid sequence that is at least 80% identical to SEQ ID NO:44.

[0673] 67. The immunogenic composition of claim 66, wherein the SEQ ID NO: 44 further comprises an N-terminal M, such as an N-terminal amino acid residue MT, or MTG, or MTGS.

[0674] 68. The immunogenic composition of any of the preceding items, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises at least one, such as at least two, such as at least three, such as at least four, such as at least five, such as at least six fragments selected from the group consisting of: SEQ ID NO: 28-33, and any amino acid sequence having at least 80% identity with any one of SEQ ID NO: 28-33.

[0675] 69. An immunogenic composition as described in claim 68, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises SEQ ID NO: 28-33.

[0676] 70. The immunogenic composition of item 58 or 59, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises SEQ ID NO: 45, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 45.

[0677] 71. The immunogenic composition of claim 70, wherein the SEQ ID NO: 45 further comprises an N-terminal M, such as an N-terminal amino acid residue MT, or MTG, or MTGS.

[0678] 72. The immunogenic composition of any of the preceding items, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises at least one, such as at least two, such as at least three, of the following: SEQ ID NOs: 34-36, or any amino acid sequence that is at least 80% identical to any one of SEQ ID NOs: 34-36.

[0679] 73. An immunogenic composition as described in claim 72, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises SEQ ID NO:34-36.

[0680] 74. The immunogenic composition of item 72 or 73, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises SEQ ID NO: 46, or an amino acid sequence having at least 80% identity to SEQ ID NO: 46

[0681] or

[0682] wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises SEQ ID NO:47, or an amino acid sequence having at least 80% identity to SEQ ID NO:47

[0683] or

[0684] wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises SEQ ID NO: 107, or an amino acid sequence having at least 80% identity to SEQ ID NO: 107

[0685] or

[0686] One of the first, second, third, fourth and fifth fusion polypeptides comprises SEQ ID NO:108, or an amino acid sequence that is at least 80% identical to SEQ ID NO:108.

[0687] 75. An immunogenic composition as described in claim 73 or 74, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises SEQ ID NO:46 or 47, wherein, independently of each other, the amino acid residue at position 317 may be absent, present, or not E; the amino acid residue at position 318 may be absent, present, or not F; the amino acid residue at position 608 may be absent, present, or not G; the amino acid residue at position 609 may be absent, present, or not T; the amino acid residue at position 944 may be absent, present, or not L; and the amino acid residue at position 945 may be absent, present, or not E.

[0688] 76. An immunogenic composition as described in item 74 or 75, wherein the SEQ ID NO:46, 47, 107 or 108 further comprises an N-terminal M, such as an N-terminal amino acid residue MT, or MTG, or MTGS, and optionally comprises a C-terminal SL2-tag.

[0689] 77. An immunogenic composition as described in any of the preceding items, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises at least one, such as at least two, such as at least three, of the following: SEQ ID NO: 40-42, or any amino acid sequence that is at least 80% identical to any one of SEQ ID NO: 40-42.

[0690] 78. The immunogenic composition of claim 77, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises SEQ ID NO: 40-42.

[0691] 79. An immunogenic composition as described in claim 77 or 78, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises SEQ ID NO:48, or an amino acid sequence that is at least 80% identical to SEQ ID NO:48.

[0692] 80. The immunogenic composition of claim 79, wherein the SEQ ID NO: 48 further comprises an N-terminal M, such as an N-terminal amino acid residue MT, or MTG, or MTGS, or comprises an N-terminal GPLGS.

[0693] 81. The immunogenic composition of any one of the preceding items, wherein at least two, at least three, at least four or all five of the first, second, third, fourth and fifth fusion polypeptides are selected from the group consisting of:

[0694] a fusion polypeptide comprising SEQ ID NOs: 20, 21 and 22, or an amino acid sequence at least 80% identical to any one of SEQ ID NOs: 20, 21 and 22;

[0695] A fusion polypeptide comprising SEQ ID NOs:23-27 and SEQ ID NOs:37-39 or an amino acid sequence that is at least 80% identical to any one of SEQ ID NOs:23-27 and SEQ ID NOs:37-39;

[0696] a fusion polypeptide comprising SEQ ID NO: 28-33 or an amino acid sequence at least 80% identical to any one of SEQ ID NO: 28-33;

[0697] A fusion polypeptide comprising SEQ ID NO:34-36 or an amino acid sequence at least 80% identical to any one of SEQ ID NO:34-36; and

[0698] A fusion polypeptide comprising SEQ ID NO:40-42 or an amino acid sequence at least 80% identical to any one of SEQ ID NO:40-42.

[0699] 82. The immunogenic composition of item 64, wherein at least two, at least three, at least four or all five of the first, second, third, fourth and fifth fusion polypeptides are selected from the group consisting of:

[0700] A fusion polypeptide comprising SEQ ID NOs: 20-22;

[0701] A fusion polypeptide comprising SEQ ID NOs: 23-27 and SEQ ID NOs: 37-39;

[0702] A fusion polypeptide comprising SEQ ID NOs: 28-33;

[0703] A fusion polypeptide comprising SEQ ID NOs: 34-36; and

[0704] Fusion polypeptide comprising SEQ ID NO:40-42

[0705] 83. The immunogenic composition of any one of the preceding items, wherein at least two, at least three, at least four or all five of the first, second, third, fourth and fifth fusion polypeptides are selected from the group consisting of:

[0706] a fusion polypeptide comprising SEQ ID NO: 106 or an amino acid sequence at least 80% identical to SEQ ID NO: 106;

[0707] A fusion polypeptide comprising SEQ ID NO:44 or an amino acid sequence at least 80% identical to SEQ ID NO:44;

[0708] A fusion polypeptide comprising SEQ ID NO:45 or an amino acid sequence at least 80% identical to SEQ ID NO:45;

[0709] A fusion polypeptide comprising SEQ ID NO: 107 or an amino acid sequence at least 80% identical to SEQ ID NO: 107, and

[0710] A fusion polypeptide comprising SEQ ID NO:48 or an amino acid sequence at least 80% identical to SEQ ID NO:48;

[0711] or selected from the group consisting of:

[0712] a fusion polypeptide comprising SEQ ID NO: 106 or an amino acid sequence at least 80% identical to SEQ ID NO: 106;

[0713] A fusion polypeptide comprising SEQ ID NO:44 or an amino acid sequence at least 80% identical to SEQ ID NO:44;

[0714] A fusion polypeptide comprising SEQ ID NO:45 or an amino acid sequence at least 80% identical to SEQ ID NO:45;

[0715] A fusion polypeptide comprising SEQ ID NO: 108 or an amino acid sequence having at least 80% identity to SEQ ID NO: 108, and

[0716] A fusion polypeptide comprising SEQ ID NO:48 or an amino acid sequence having at least 80% identity to SEQ ID NO:48,

[0717] For example, wherein at least two, at least three, at least four or all five of the first, second, third, fourth and fifth fusion polypeptides are selected from the group consisting of:

[0718] A fusion polypeptide comprising SEQ ID NO:43 or an amino acid sequence at least 80% identical to SEQ ID NO:43;

[0719] A fusion polypeptide comprising SEQ ID NO:44 or an amino acid sequence at least 80% identical to SEQ ID NO:44;

[0720] A fusion polypeptide comprising SEQ ID NO:45 or an amino acid sequence at least 80% identical to SEQ ID NO:45;

[0721] A fusion polypeptide comprising SEQ ID NO:46 or an amino acid sequence having at least 80% identity to SEQ ID NO:46, and

[0722] A fusion polypeptide comprising SEQ ID NO:48 or an amino acid sequence at least 80% identical to SEQ ID NO:48;

[0723] or selected from the group consisting of:

[0724] A fusion polypeptide comprising SEQ ID NO:43 or an amino acid sequence at least 80% identical to SEQ ID NO:43;

[0725] A fusion polypeptide comprising SEQ ID NO:44 or an amino acid sequence at least 80% identical to SEQ ID NO:44;

[0726] A fusion polypeptide comprising SEQ ID NO:45 or an amino acid sequence at least 80% identical to SEQ ID NO:45;

[0727] A fusion polypeptide comprising SEQ ID NO: 47 or an amino acid sequence having at least 80% identity to SEQ ID NO: 47, and

[0728] A fusion polypeptide comprising SEQ ID NO:48 or an amino acid sequence at least 80% identical to SEQ ID NO:48.

[0729] 84. The immunogenic composition of item 83, wherein at least two, at least three, at least four or all five of the first, second, third, fourth and fifth fusion polypeptides are selected from the group consisting of: a fusion polypeptide comprising SEQ ID NO: 106;

[0730] A fusion polypeptide comprising SEQ ID NO:44;

[0731] A fusion polypeptide comprising SEQ ID NO:45;

[0732] A fusion polypeptide comprising SEQ ID NO 107; and

[0733] A fusion polypeptide comprising SEQ ID NO:48;

[0734] or selected from the group consisting of:

[0735] A fusion polypeptide comprising SEQ ID NO: 106;

[0736] A fusion polypeptide comprising SEQ ID NO:44;

[0737] A fusion polypeptide comprising SEQ ID NO: 108;

[0738] A fusion polypeptide comprising SEQ ID NO: 47; and

[0739] A fusion polypeptide comprising SEQ ID NO:48.

[0740] For example, wherein at least two, at least three, at least four or all five of the first, second, third, fourth and fifth fusion polypeptides are selected from the group consisting of:

[0741] A fusion polypeptide comprising SEQ ID NO:43;

[0742] A fusion polypeptide comprising SEQ ID NO:44;

[0743] A fusion polypeptide comprising SEQ ID NO:45;

[0744] A fusion polypeptide comprising SEQ ID NO: 46; and

[0745] A fusion polypeptide comprising SEQ ID NO:48;

[0746] or selected from the group consisting of:

[0747] A fusion polypeptide comprising SEQ ID NO:43;

[0748] A fusion polypeptide comprising SEQ ID NO:44;

[0749] A fusion polypeptide comprising SEQ ID NO:45;

[0750] A fusion polypeptide comprising SEQ ID NO: 47; and

[0751] A fusion polypeptide comprising SEQ ID NO:48.

[0752] 85. The immunogenic composition of item 83 or 84, wherein the fusion polypeptide comprising SEQ ID NO:48 is SEQ ID NO:54 or SEQ ID NO:55.

[0753] 86. The immunogenic composition of any of the preceding items, wherein at least one, such as at least two, or at least three of the fusion polypeptides are not denatured and / or not precipitated by heating to about 100°C.

[0754] 87. A fusion polypeptide comprising fragments from at least 3, such as at least 4, such as at least 5, such as at least 6, such as at least 7 native full-length polypeptides from Streptococcus suis, wherein the native full-length polypeptides are independently selected or selected from the group consisting of: amino acid sequences according to SEQ ID NOs: 1-10 and SEQ ID NOs: 14-19, and amino acid sequences having at least 80% identity with any one of SEQ ID NOs: 1-10 and SEQ ID NOs: 14-19, such as the group consisting of: amino acid sequences according to SEQ ID NOs: 1-10 and SEQ ID NOs: 14-19.

[0755] 88. A fusion polypeptide as described in item 87, wherein the native full-length polypeptide is independently selected or selected from the group consisting of: an amino acid sequence according to SEQ ID NO: 1-3, and an amino acid sequence having at least 80% identity with any one of SEQ ID NO: 1-3, for example, wherein the native full-length polypeptide is SEQ ID NO: 1-3.

[0756] 89. A fusion polypeptide as described in item 87, wherein the native full-length polypeptide is independently selected or selected from the group consisting of: an amino acid sequence according to SEQ ID NO: 1-5 and 14-16, and an amino acid sequence having at least 80% identity with any one of SEQ ID NO: 1-5 and 14-16, for example, a group consisting of: an amino acid sequence according to SEQ ID NO: 1-5 and 14-16, for example, wherein the native full-length polypeptide is SEQ ID NO: 1-5 and 14-16.

[0757] 90. A fusion polypeptide as described in item 87, wherein the native full-length polypeptide is independently selected or selected from the group consisting of: an amino acid sequence according to SEQ ID NO:6-10, and an amino acid sequence having at least 80% identity with any one of SEQ ID NO:6-10, for example, a group consisting of: an amino acid sequence according to SEQ ID NO:6-10, for example, wherein the native full-length polypeptide is SEQ ID NO:6-10.

[0758] 91. A fusion polypeptide as described in item 87, wherein the native full-length polypeptide is independently selected or selected from the group consisting of: an amino acid sequence according to SEQ ID NO: 17-19, and an amino acid sequence having at least 80% identity with any one of SEQ ID NO: 17-19, for example, a group consisting of: an amino acid sequence according to SEQ ID NO: 17-19, for example, wherein the native full-length polypeptide is SEQ ID NO: 17-19.

[0759] 92. A fusion polypeptide as described in item 87, wherein the fragments are independently selected or selected from the group consisting of: fragments having amino acid sequences according to SEQ ID NOs: 20-33 and 37-42, and fragments having an amino acid sequence with at least 80% identity with any one of SEQ ID NOs: 20-33 and 37-42, for example, a group consisting of: amino acid sequences according to SEQ ID NOs: 20-33 and 37-42.

[0760] 93. A fusion polypeptide as described in item 87, 88 or 93, wherein the fragment is selected from the group consisting of: SEQ ID NO: 20-22, and an amino acid sequence having at least 80% identity with any one of SEQ ID NO: 20-22.

[0761] 94. The fusion polypeptide according to item 93, wherein the fragment has an amino acid sequence according to SEQ ID NO: 20-22.

[0762] 95. A fusion polypeptide as described in any of items 87-88 and 92-94, which comprises or consists of the amino acid sequence of SEQ ID NO:106, or an amino acid sequence that is 80% identical to SEQ ID NO:106, for example, comprises or consists of the amino acid sequence of SEQ ID NO:43, or an amino acid sequence that is 80% identical to SEQ ID NO:43.

[0763] 96. A fusion polypeptide as described in any of items 87-88 and 92-95, which comprises or consists of the following: the amino acid sequence SEQ ID NO:43, wherein, independently of each other, the amino acid residue at position 303 may be absent, present, or not G, and the amino acid residue at position 304 may be absent, present, or not S.

[0764] 97. The fusion polypeptide as described in any one of items 87-88 and 92-96, comprising or consisting of the amino acid sequence SEQ ID NO:43.

[0765] 98. A fusion polypeptide as described in items 87 and 89, wherein the fragment is selected from the following group: a fragment having an amino acid sequence according to SEQ ID NO: 23-27 and 37-39, and an amino acid...

Claims

1. An immunogenic composition comprising at least one first fusion polypeptide and one second fusion polypeptide, wherein the first fusion polypeptide comprises fragments from at least three native full-length polypeptides from Streptococcus suis, and the second fusion polypeptide comprises fragments from at least three native full-length polypeptides from Streptococcus suis, and wherein the at least three native full-length polypeptides from Streptococcus suis are independently selected from the group consisting of: a zinc binding protein from Streptococcus suis; a protease from Streptococcus suis; a nucleotidase from Streptococcus suis; a protein from Streptococcus suis comprising an LPXTG motif; Amid1Sa (SEQ ID NO: 14) and any polypeptide having at least 80% identity with SEQ ID NO: 14; 15BSa (SEQ ID NO: 15) and any polypeptide having at least 80% identity with SEQ ID NO: 15; and Hom17Sa (SEQ ID NO: 16) and any polypeptide having at least 80% identity with SEQ ID NO:

16.

2. The immunogenic composition of claim 1, wherein the immunogenic composition further comprises one or more of a third fusion polypeptide, a fourth fusion polypeptide, and a fifth fusion polypeptide.

3. The immunogenic composition of claim 1 or 2, wherein the third fusion polypeptide, the fourth fusion polypeptide and / or the fifth fusion polypeptide comprise fragments from at least three native full-length polypeptides from Streptococcus suis, wherein the at least three native full-length polypeptides from Streptococcus suis are independently selected from the group consisting of: a zinc-binding protein from Streptococcus suis; a protease from Streptococcus suis; a nucleotidase from Streptococcus suis; a protein from Streptococcus suis comprising an LPXTG motif; Amid1Sa (SEQ ID NO: 14) and any polypeptide having at least 80% identity with SEQ ID NO: 14; 15BSa (SEQ ID NO: 15) and a polypeptide having at least 80% identity with SEQ ID NO: 15; and Hom17Sa (SEQ ID NO: 16) and any polypeptide having at least 80% identity with SEQ ID NO:

16.

4. The immunogenic composition of any one of claims 1-3, wherein said at least two of said first, second, third, fourth and fifth fusion polypeptides comprise fragments of a zinc binding protein from Streptococcus suis.

5. The immunogenic composition of any one of claims 1 to 4, wherein the at least three native full-length polypeptides from Streptococcus suis are independently selected from the group consisting of: a polypeptide having an amino acid sequence according to any one of SEQ ID NOs: 1 to 19, and any polypeptide having at least 80% identity with any one of SEQ ID NOs: 1 to 19; for example, selected from the group consisting of: a polypeptide having an amino acid sequence according to any one of SEQ ID NOs: 1 to 19.

6. The immunogenic composition of any of the preceding claims, wherein each of the first, second, third, fourth and fifth fusion polypeptides comprises a fragment independently selected from the group consisting of: a zinc binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5, and a fragment of a polypeptide having at least 80% identity to any one of SEQ ID NOs: 1-5; a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10, and a fragment of a polypeptide having at least 80% identity to any one of SEQ ID NOs: 6-10; a nucleotidase having an amino acid sequence according to any one of SEQ ID NOs: 11-13, and a fragment of a polypeptide having at least 80% identity to any one of SEQ ID NOs: 11-13; and a protein comprising a LPXTG motif having an amino acid sequence according to any one of SEQ ID NOs: 17-19, and a fragment of a polypeptide having at least 80% identity to any one of SEQ ID NOs: 17-19.

7. The immunogenic composition of any of the preceding claims, wherein each of the first, second, third, fourth and fifth fusion polypeptides comprises a fragment independently selected from the group consisting of: a fragment of a zinc binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5; a fragment of a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10; a fragment of a nucleotidase having an amino acid sequence according to any one of SEQ ID NOs: 11-13, and a fragment of a protein comprising a LPXTG motif having an amino acid sequence according to any one of SEQ ID NOs: 17-19.

8. The immunogenic composition of any of the preceding claims, wherein at least one of the first, second, third, fourth and fifth fusion polypeptides comprises at least three, such as at least four, such as at least five, of the following: a zinc-binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5, and a polypeptide having at least 80% identity with any one of SEQ ID NOs: 1-5; for example at least three, such as at least four, such as at least five fragments of a zinc-binding protein having an amino acid sequence according to any one of SEQ ID NOs: 1-5.

9. An immunogenic composition as described in any of the preceding claims, wherein at least one of the first, second, third, fourth and fifth fusion polypeptides comprises at least three fragments, such as at least four, such as at least five, such as at least six fragments of: a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10, and a polypeptide having at least 80% identity with any of said amino acid sequences; for example, at least three, such as at least four, such as at least five, such as at least six fragments of a protease having an amino acid sequence according to any one of SEQ ID NOs: 6-10.

10. An immunogenic composition as described in any of the preceding claims, wherein at least one of the first, second, third, fourth and fifth fusion polypeptides comprises a nucleotidase having an amino acid sequence according to any one of SEQ ID NOs: 11-13 and at least three fragments of a polypeptide having at least 80% identity with any of said amino acid sequences, e.g., at least three fragments of a nucleotidase having an amino acid sequence according to any one of SEQ ID NOs: 11-13.

11. The immunogenic composition of any of the preceding claims, wherein at least one of the first, second, third, fourth and fifth fusion polypeptides comprises a protein comprising a LPXTG motif from Streptococcus suis having an amino acid sequence according to any one of SEQ ID NOs: 17-19 and at least three fragments of a polypeptide having at least 80% identity to any of said amino acid sequences, e.g., at least three fragments of a protein comprising a LPXTG motif from Streptococcus suis having an amino acid sequence according to any one of SEQ ID NOs: 17-19.

12. The immunogenic composition of any of the preceding claims, wherein at least one of the first, second, third, fourth and fifth fusion polypeptides further comprises a fragment of at least one native full-length polypeptide from Streptococcus suis having an amino acid sequence according to any one of SEQ ID NOs: 14-16 or any amino acid sequence having at least 80% identity to any one of SEQ ID NOs: 14-16.

13. An immunogenic composition as described in any one of the preceding claims, wherein at least one of the first, second, third, fourth and fifth fusion polypeptides comprises at least two fragments derived from the same native full-length polypeptide from Streptococcus suis, and wherein these fragments are different fragments derived from the same native full-length polypeptide from Streptococcus suis.

14. The immunogenic composition of any one of the preceding claims, wherein the composition comprises three, four or five fusion polypeptides, e.g., wherein the composition comprises four or five fusion polypeptides, e.g., wherein the composition comprises five fusion polypeptides.

15. The immunogenic composition of any of the preceding claims, wherein the fragments of the zinc-binding protein are selected from the group consisting of polypeptide fragments comprising an amino acid sequence selected from SEQ ID NOs: 20-27 and any amino acid sequence having at least 80% identity to any one of SEQ ID NOs: 20-27, such as the group consisting of polypeptide fragments comprising an amino acid sequence selected from SEQ ID NOs: 20-27.

16. An immunogenic composition as described in any of the preceding claims, wherein the fragment of the protease is selected from the group consisting of: a polypeptide fragment comprising an amino acid sequence selected from SEQ ID NOs: 28-33 and any amino acid sequence having at least 80% identity with any one of SEQ ID NOs: 28-33, such as a group consisting of: a polypeptide fragment comprising an amino acid sequence selected from SEQ ID NOs: 28-33.

17. An immunogenic composition as described in any of the preceding claims, wherein the fragment of the nucleotidase is selected from the group consisting of: a polypeptide fragment comprising an amino acid sequence selected from SEQ ID NOs: 34-36 and any amino acid sequence having at least 80% identity with any one of SEQ ID NOs: 34-36, for example, a polypeptide fragment comprising an amino acid sequence selected from SEQ ID NOs: 34-36.

18. The immunogenic composition of any of the preceding claims, wherein the fragment of the protein comprising the LPXTG motif is selected from the group consisting of polypeptide fragments comprising an amino acid sequence selected from SEQ ID NOs: 40-42 and any amino acid sequence having at least 80% identity with any one of SEQ ID NOs: 40-42, such as the group consisting of polypeptide fragments comprising an amino acid sequence selected from SEQ ID NOs: 40-42.

19. An immunogenic composition as described in any of the preceding claims, wherein the fragment selected from the group consisting of fragments of the amino acid sequences SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, and any amino acid sequence having at least 80% identity thereto is a fragment selected from the group consisting of SEQ ID NO: 37-39, and any amino acid sequence having at least 80% identity thereto any one of SEQ ID NO: 37-39, e.g., a fragment selected from the group consisting of a polypeptide fragment comprising an amino acid sequence selected from SEQ ID NO: 37-39.

20. An immunogenic composition as described in any of the preceding claims, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises at least one, e.g., at least two, e.g., at least three fragments selected from the group consisting of: SEQ ID NOs: 20-22, and any amino acid sequence having at least 80% identity with any one of SEQ ID NOs: 20-22.

21. The immunogenic composition of claim 20, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises SEQ ID NOs: 20, 21 and 22.

22. The immunogenic composition of claim 21, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises SEQ ID NO: 106, or an amino acid sequence at least 80% identical to SEQ ID NO:

106.

23. The immunogenic composition of claim 21 or 22, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises SEQ ID NO:43, or an amino acid sequence at least 80% identical to SEQ ID NO:

43.

24. The immunogenic composition of any one of claims 20-23, further comprising an N-terminal M or MT and optionally a C-terminal His tag.

25. An immunogenic composition as described in any of the preceding claims, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises at least one, such as at least two, such as at least three, such as at least four, such as at least five, such as at least six, such as at least seven, such as eight fragments selected from the group consisting of: SEQ ID NOs: 23-27 and SEQ ID NOs: 37-39, and any amino acid sequence that is at least 80% identical to any one of SEQ ID NOs: 23-27 and SEQ ID NOs: 37-39.

26. The immunogenic composition of claim 25, wherein one of the first, second, third, fourth, and fifth fusion polypeptides comprises SEQ ID NOs: 23-27 and SEQ ID NOs: 37-39.

27. The immunogenic composition of claim 25 or 26, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises SEQ ID NO:44, or an amino acid sequence at least 80% identical to SEQ ID NO:

44.

28. The immunogenic composition of any one of claims 25-27, wherein the SEQ ID NO: 44 further comprises an N-terminal M, such as an N-terminal amino acid residue MT, or MTG, or MTGS.

29. An immunogenic composition as described in any of the preceding claims, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises at least one, such as at least two, such as at least three, such as at least four, such as at least five, such as at least six fragments selected from the group consisting of: SEQ ID NOs: 28-33, and any amino acid sequence that is at least 80% identical to any one of SEQ ID NOs: 28-33.

30. The immunogenic composition of claim 29, wherein one of the first, second, third, fourth, and fifth fusion polypeptides comprises SEQ ID NOs: 28-33.

31. The immunogenic composition of claim 29 or 30, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises SEQ ID NO:45, or an amino acid sequence at least 80% identical to SEQ ID NO:

45.

32. The immunogenic composition of any one of claims 28-31, wherein the SEQ ID NO: 45 further comprises an N-terminal M, such as an N-terminal amino acid residue MT, or MTG, or MTGS.

33. An immunogenic composition as described in any of the preceding claims, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises at least one, e.g., at least two, e.g., at least three fragments selected from the group consisting of: SEQ ID NOs: 34-36, or an amino acid sequence having at least 80% identity with any one of SEQ ID NOs: 34-36.

34. The immunogenic composition of claim 33, wherein one of the first, second, third, fourth, and fifth fusion polypeptides comprises SEQ ID NOs: 34-36.

35. The immunogenic composition of claim 33 or 34, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises SEQ ID NO: 46, or an amino acid sequence having at least 80% identity to SEQ ID NO:

46. or One of the first, second, third, fourth and fifth fusion polypeptides comprises SEQ ID NO:47, or an amino acid sequence that is at least 80% identical to SEQ ID NO:

47.

36. The immunogenic composition of claim 34 or 35, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises SEQ ID NO: 107, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 107, or One of the first, second, third, fourth and fifth fusion polypeptides comprises SEQ ID NO:108, or an amino acid sequence that is at least 80% identical to SEQ ID NO:

108.

37. The immunogenic composition of any one of claims 33-36, further comprising an N-terminal M, such as an N-terminal amino acid residue MT, or MTG, or MTGS, and optionally a C-terminal SL2 tag.

38. An immunogenic composition as described in any of the preceding claims, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises at least one, e.g., at least two, e.g., at least three fragments selected from the group consisting of: SEQ ID NOs: 40-42, and an amino acid sequence having at least 80% identity with any one of SEQ ID NOs: 40-42.

39. The immunogenic composition of claim 38, wherein one of the first, second, third, fourth, and fifth fusion polypeptides comprises SEQ ID NOs: 40-42.

40. The immunogenic composition of claim 38 or 39, wherein one of the first, second, third, fourth and fifth fusion polypeptides comprises SEQ ID NO:48, or an amino acid sequence at least 80% identical to SEQ ID NO:

48.

41. The immunogenic composition of any one of claims 38-40, wherein the SEQ ID NO:48 further comprises an N-terminal M, such as an N-terminal amino acid residue MT, or MTG, or MTGS, or comprises an N-terminal GPLGS.

42. The immunogenic composition of any one of the preceding claims, wherein at least two, at least three, at least four, or all five of the first, second, third, fourth, and fifth fusion polypeptides are selected from the group consisting of: a fusion polypeptide comprising SEQ ID NOs: 20, 21 and 22, or an amino acid sequence at least 80% identical to any one of SEQ ID NOs: 20, 21 and 22; A fusion polypeptide comprising SEQ ID NOs:23-27 and SEQ ID NOs:37-39 or an amino acid sequence that is at least 80% identical to any one of SEQ ID NOs:23-27 and SEQ ID NOs:37-39; a fusion polypeptide comprising SEQ ID NO: 28-33 or an amino acid sequence at least 80% identical to any one of SEQ ID NO: 28-33; A fusion polypeptide comprising SEQ ID NO:34-36 or an amino acid sequence at least 80% identical to any one of SEQ ID NO:34-36; and A fusion polypeptide comprising SEQ ID NO:40-42 or an amino acid sequence at least 80% identical to any one of SEQ ID NO:40-42.

43. The immunogenic composition of claim 42, wherein at least two, at least three, at least four, or all five of the first, second, third, fourth, and fifth fusion polypeptides are selected from the group consisting of: A fusion polypeptide comprising SEQ ID NOs: 20-22; A fusion polypeptide comprising SEQ ID NOs: 23-27 and SEQ ID NOs: 37-39; A fusion polypeptide comprising SEQ ID NOs: 28-33; A fusion polypeptide comprising SEQ ID NOs: 34-36; and A fusion polypeptide comprising SEQ ID NOs: 40-42.

44. The immunogenic composition of claim 42 or 43, wherein at least two, at least three, at least four, or all five of the first, second, third, fourth, and fifth fusion polypeptides are selected from the group consisting of: a fusion polypeptide comprising SEQ ID NO: 106 or an amino acid sequence at least 80% identical to SEQ ID NO: 106; A fusion polypeptide comprising SEQ ID NO:44 or an amino acid sequence at least 80% identical to SEQ ID NO:44; a fusion polypeptide comprising SEQ ID NO:45 or an amino acid sequence at least 80% identical to SEQ ID NO:45; A fusion polypeptide comprising SEQ ID NO: 107 or an amino acid sequence at least 80% identical to SEQ ID NO: 107, and A fusion polypeptide comprising SEQ ID NO:48 or an amino acid sequence at least 80% identical to SEQ ID NO:

48.

45. The immunogenic composition of any one of claims 42-44, wherein at least two, at least three, at least four, or all five of the first, second, third, fourth, and fifth fusion polypeptides are selected from the group consisting of: A fusion polypeptide comprising SEQ ID NO:43 or an amino acid sequence at least 80% identical to SEQ ID NO:43; A fusion polypeptide comprising SEQ ID NO:44 or an amino acid sequence at least 80% identical to SEQ ID NO:44; a fusion polypeptide comprising SEQ ID NO:45 or an amino acid sequence at least 80% identical to SEQ ID NO:45; A fusion polypeptide comprising SEQ ID NO: 46 or 47 or an amino acid sequence having at least 80% identity to SEQ ID NO: 46 or 47, and A fusion polypeptide comprising SEQ ID NO:48 or an amino acid sequence at least 80% identical to SEQ ID NO:

48.

46. ​​The immunogenic composition of claim 43, wherein four or five of the first, second, third, fourth, and fifth fusion polypeptides are selected from the group consisting of: A fusion polypeptide comprising SEQ ID NOs: 20-22; A fusion polypeptide comprising SEQ ID NOs: 23-27 and SEQ ID NOs: 37-39; A fusion polypeptide comprising SEQ ID NOs: 28-33; A fusion polypeptide comprising SEQ ID NOs: 34-36; and A fusion polypeptide comprising SEQ ID NOs: 40-42.

47. The immunogenic composition of claim 46 or 44, wherein four or five of the first, second, third, fourth and fifth fusion polypeptides are selected from the group consisting of: a fusion polypeptide comprising SEQ ID NO: 106 or an amino acid sequence at least 80% identical to SEQ ID NO: 106; A fusion polypeptide comprising SEQ ID NO:44 or an amino acid sequence at least 80% identical to SEQ ID NO:44; A fusion polypeptide comprising SEQ ID NO:45 or an amino acid sequence at least 80% identical to SEQ ID NO:45; A fusion polypeptide comprising SEQ ID NO: 107 or an amino acid sequence at least 80% identical to SEQ ID NO: 107, and A fusion polypeptide comprising SEQ ID NO:48 or an amino acid sequence at least 80% identical to SEQ ID NO:

48.

48. The immunogenic composition of any one of claims 46, 47 and 44, wherein four or five of the first, second, third, fourth and fifth fusion polypeptides are selected from the group consisting of: A fusion polypeptide comprising SEQ ID NO:43 or an amino acid sequence at least 80% identical to SEQ ID NO:43; A fusion polypeptide comprising SEQ ID NO:44 or an amino acid sequence at least 80% identical to SEQ ID NO:44; A fusion polypeptide comprising SEQ ID NO:45 or an amino acid sequence at least 80% identical to SEQ ID NO:45; A fusion polypeptide comprising SEQ ID NO: 46 or 47 or an amino acid sequence having at least 80% identity to SEQ ID NO: 46 or 47, and A fusion polypeptide comprising SEQ ID NO:48 or an amino acid sequence at least 80% identical to SEQ ID NO:

48.

49. A fusion polypeptide comprising fragments of at least 3, for example at least 4, for example at least 5, for example at least 6, for example at least 7 natural full-length polypeptides from Streptococcus suis, wherein the natural full-length polypeptides are independently selected from the group consisting of: amino acid sequences according to SEQ ID NOs: 1-10 and SEQ ID NOs: 14-19, and amino acid sequences having at least 80% identity with any one of SEQ ID NOs: 1-10 and SEQ ID NOs: 14-19; for example, selected from the group consisting of: amino acid sequences according to SEQ ID NOs: 1-10 and SEQ ID NOs: 14-19.

50. The fusion polypeptide of claim 49, wherein the native full-length polypeptide is independently selected from the group consisting of an amino acid sequence according to SEQ ID NOs: 1-3, and an amino acid sequence having at least 80% identity to any one of SEQ ID NOs: 1-3.

51. The fusion polypeptide of claim 49 or 50, wherein the native full-length polypeptide is SEQ ID NO: 1-3.

52. The fusion polypeptide of claim 49, wherein the native full-length polypeptide is independently selected from the group consisting of an amino acid sequence according to SEQ ID NOs: 1-5 and 14-16, and an amino acid sequence having at least 80% identity to any one of SEQ ID NOs: 1-5 and 14-16.

53. The fusion polypeptide of claim 49 or 52, wherein the native full-length polypeptide is SEQ ID NO: 1-5 and 14-16.

54. The fusion polypeptide of claim 49, wherein the native full-length polypeptide is independently selected from the group consisting of an amino acid sequence according to SEQ ID NOs: 6-10, and an amino acid sequence having at least 80% identity to any one of SEQ ID NOs: 6-10.

55. The fusion polypeptide of claim 49 or 54, wherein the native full-length polypeptide is SEQ ID NO: 6-10.

56. A fusion polypeptide as described in claim 49, wherein the native full-length polypeptide is independently selected from the group consisting of: an amino acid sequence according to SEQ ID NO: 17-19, and an amino acid sequence having at least 80% identity with any one of SEQ ID NO: 17-19, wherein the native full-length polypeptide is SEQ ID NO: 17-19.

57. The fusion polypeptide of claim 49 or 56, wherein the native full-length polypeptide is SEQ ID NO: 17-19.

58. A fusion polypeptide as described in claim 49, wherein the fragments are independently selected from the group consisting of: fragments having amino acid sequences according to SEQ ID NOs: 20-33 and 37-42 and amino acid sequences having at least 80% identity with any one of SEQ ID NOs: 20-33 and 37-42, such as the group consisting of: amino acid sequences according to SEQ ID NOs: 20-33 and 37-42.

59. The fusion polypeptide of claim 49-51 or 58, wherein the fragment is selected from the group consisting of SEQ ID NOs: 20-22, and an amino acid sequence at least 80% identical to any one of SEQ ID NOs: 20-22.

60. The fusion polypeptide of any one of claims 49-51, 58 and 59, comprising a fragment having an amino acid sequence according to SEQ ID NOs: 20-22.

61. A fusion polypeptide as described in any one of claims 49-51 and 58-60, comprising or consisting of: The amino acid sequence of SEQ ID NO: 106 or 109, or an amino acid sequence having 80% identity with SEQ ID NO: 106 or 109, for example comprises or consists of the amino acid sequence of SEQ ID NO: 106 or 109.

62. A fusion polypeptide as described in any one of claims 49-51 and 58-61, comprising or consisting of: The amino acid sequence of SEQ ID NO: 43 or 49, or an amino acid sequence having 80% identity with SEQ ID NO: 43 or 49, for example comprises or consists of the amino acid sequence of SEQ ID NO: 43 or 49.

63. A fusion polypeptide as described in any one of claims 49, 52-53 and 58, wherein the fragment is selected from the following group: a fragment having an amino acid sequence according to SEQ ID NO: 23-27 and 37-39 and an amino acid sequence having at least 80% identity with any one of SEQ ID NO: 23-27 and 37-39.

64. The fusion polypeptide of any one of claims 49, 52-53, 58 and 63, comprising a fragment having an amino acid sequence according to SEQ ID NOs: 23-27 and 37-39.

65. A fusion polypeptide as described in any one of claims 49, 52-53, 58 and 63-64, comprising or consisting of: The amino acid sequence is SEQ ID NO:44 or an amino acid sequence having 80% identity to SEQ ID NO:

44.

66. A fusion polypeptide as described in any one of claims 49, 52-53, 58 and 63-65, comprising or consisting of: Amino acid sequence SEQ ID NO:

44.

67. The fusion polypeptide of any one of claims 49, 54-55 and 58, wherein the fragment is selected from the group consisting of fragments having an amino acid sequence according to SEQ ID NOs: 28-33 and an amino acid sequence having at least 80% identity to any one of SEQ ID NOs: 28-33.

68. The fusion polypeptide of any one of claims 49, 54-55, 58 and 67, comprising a fragment having an amino acid sequence according to SEQ ID NO: 28-33.

69. The fusion polypeptide of any one of claims 49, 54-55, 58 and 67-68, comprising or consisting of: The amino acid sequence is SEQ ID NO:45 or an amino acid sequence having 80% identity to SEQ ID NO:

45.

70. The fusion polypeptide of any one of claims 49, 54-55, 58 and 67-69, comprising or consisting of: Amino acid sequence SEQ ID NO:

45.

71. The fusion polypeptide of any one of claims 49, 56-57 and 58, wherein the fragment is selected from the group consisting of fragments having an amino acid sequence according to SEQ ID NOs: 40-42 and an amino acid sequence having at least 80% identity to any one of SEQ ID NOs: 40-42.

72. The fusion polypeptide of any one of claims 49, 56-57, 58 and 71, comprising a fragment having an amino acid sequence according to SEQ ID NOs: 40-42.

73. A fusion polypeptide as described in any one of claims 49, 56-57, 58, 71 and 72, comprising or consisting of: The amino acid sequence is SEQ ID NO:48 or an amino acid sequence having 80% identity to SEQ ID NO:

48.

74. A fusion polypeptide as described in any one of claims 49, 56-57, 58 and 71-73, comprising or consisting of: Amino acid sequence SEQ ID NO:

48.

75. The fusion polypeptide of any one of claims 49-74, comprising one or more additional N-terminal and / or C-terminal residues, such as an N-terminal M, MT, MTG, MTGS or GPLGS.

76. A polynucleotide encoding the fusion polypeptide of any one of claims 49-75.

77. An expression vector comprising the polynucleotide of claim 76.

78. A host cell comprising the expression vector of claim 77.

79. A method for producing a fusion polypeptide as described in any one of claims 49-75, the method comprising - culturing the host cell according to claim 78 under conditions that allow expression of the polypeptide from the expression vector, and - isolating said polypeptide.

80. An immunogenic composition comprising at least one fusion polypeptide as described in any one of claims 49-75.

81. The immunogenic composition of any one of claims 1-48 and 80, further comprising an agent having an adjuvant effect.

82. A vaccine composition comprising the immunogenic composition of any one of claims 1-48 and 80-81, and a pharmaceutically acceptable carrier or excipient.

83. The vaccine composition of claim 82, further comprising an agent having an adjuvant effect.

84. The vaccine composition of any one of claims 82-83, which is formulated for intramuscular, intradermal, subcutaneous or intranasal administration, such as for intramuscular administration.

85. The vaccine composition of any one of claims 82-84, which is capable of eliciting a serum antibody response and / or a mucosal antibody response in a mammalian subject, such as a pig, or a human subject, such as a pig subject.

86. The vaccine composition of claim 85, wherein the antibody response is in the form of IgG, IgA and / or IgM antibodies in serum and / or mucosa and / or colostrum.

87. The vaccine composition of claim 85 or 86, wherein the antibody response is in the form of IgG, IgA and / or IgM in colostrum.

88. A method for producing antiserum or colostrum, the method comprising the steps of: The immunogenic composition of any one of claims 1-48 and 80-81 or the vaccine composition of any one of claims 82-87 is administered to a mammalian host to produce antibodies in the host, and antiserum or colostrum containing the antibodies produced in the host is recovered.

89. An antiserum or colostrum obtainable by the method of claim 88.

90. The immunogenic composition of any one of claims 1-48 and 80-81, the fusion polypeptide of any one of claims 49-75, the vaccine composition of any one of claims 82-87, the antiserum or colostrum of claim 89, for use as a medicament.

91. The immunogenic composition of any one of claims 1-48 and 80-81, the fusion polypeptide of any one of claims 49-75, the vaccine composition of any one of claims 82-87; or the antiserum or colostrum of claim 89, for use in treating, e.g., prophylactically treating, a Streptococcus suis infection in a mammalian subject susceptible to Streptococcus suis infection.

92. The immunogenic composition, fusion polypeptide, vaccine composition, antiserum or colostrum for use as claimed in claim 91, wherein the use comprises administration on a single occasion or on multiple separate occasions, such as at least two or at least three occasions.

93. The immunogenic composition, fusion polypeptide, vaccine composition, antiserum or colostrum for use as described in claim 91 or 92, wherein the use comprises administration to a piglet, a gilt or a sow.

94. The immunogenic composition, fusion polypeptide, vaccine composition, antiserum or colostrum for use as described in any one of claims 91-93, wherein the use comprises administration to a pregnant sow or a gilt.

95. The immunogenic composition, fusion polypeptide, vaccine composition or antiserum for use as described in any one of claims 91-94, wherein the administration is intramuscular, intradermal, subcutaneous or intranasal, such as intramuscular administration.

96. An immunogenic composition, fusion polypeptide, or vaccine composition for use as described in any one of claims 91-95 for use in the prophylactic treatment of Streptococcus suis infection in piglets susceptible to Streptococcus suis infection, wherein the use comprises administering the immunogenic composition, fusion polypeptide, or vaccine composition to pregnant gilts or sows.

97. The immunogenic composition, fusion polypeptide, vaccine composition for use as described in claim 96, wherein the administration is at least two or at least three separate occasions, such as separate occasions separated by at least about two weeks, such as about three weeks.

98. The immunogenic composition, fusion polypeptide or vaccine composition for use as claimed in any one of claims 91 to 97, wherein the piglets obtain antibodies after birth through the colostrum, such as antibodies that provide protection against S. suis infection.

Images