Application of cranial nerve crest cell BMPR1A mutation in screening surface split teratogenic substances

Abstract

The invention discloses application of cranial nerve crest cell BMPR1A mutation in screening of surface split teratogenic substances, and belongs to the technical field of biology. Experiments find that an environmental teratogenic substance 2, 3, 7, 8-tetrachlorodibenzdioxin (TCDD) stimulates early development of an embryo, so that a cranial nerve crest cell specific BMPR1AQ233D mutant mouse generates a surface mid-split phenotype, and the surface middle form of a normal control mouse is not influenced; according to the invention, the high sensitivity of BMPR1A mutation to environmental teratogenic substances is disclosed for the first time, a new thought and a research direction are provided for screening the environmental teratogenic substances which cause surface median fissure, and a new target is provided for exploring a mechanism and prevention and control measures of gene and environmental factor collaborative teratogenic.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to the application of BMPR1A mutation of cranial neural crest cells in screening for face-cleavage teratogens. Background Art

[0002] Exposure to teratogenic pollutants in the environment is a major threat to embryonic development. Birth defects caused by environmental toxins account for 10%-15% of human birth defects. The most common environmental factors include heavy metals such as lead, mercury, arsenic, and cadmium; drugs; alcoholism; tobacco smoke; air pollution PM2.5; organic pollutants such as polychlorinated biphenyls, bisphenol A, and formate pesticides. At present, the mechanism of synergistic teratogenicity between genes and the environment is unclear and many teratogens are still undiscovered.

[0003] Midface developmental malformation is one of the most common congenital craniofacial malformations, and midface cleft is a relatively common disease among them, and it is also the most serious developmental malformation. The clinical manifestation is that the midface cleft runs through the entire upper lip, jaw and nose, accompanied by an increase in the distance between the nostrils, which seriously affects the patient's appearance and causes physiological dysfunctions such as sucking, chewing, and language. Due to the complexity of its deformity, it requires comprehensive sequential treatment, which is somewhat difficult. At present, the environmental factors and mechanisms that lead to midface cleft are still unclear. Therefore, screening midface cleft teratogens is of great significance for studying the mechanism, prevention, and treatment of midface cleft.

[0004] Most of the tissues in the human maxillofacial region are derived from cranial neural crest cells (CNCCs) on the dorsal side of the neural tube. The frontonasal process and the first branchial arch grow and differentiate into two maxillary processes, mandibular process, one frontonasal process, two lateral nasal processes, a globular process and a median nasal process, a total of 10 facial processes, which are combined and fused to form the maxillofacial structure. After birth, they continue to develop into adulthood, forming a bilaterally symmetrical appearance with a harmonious proportion of the upper, middle and lower parts. The BMP (bone morphogenetic protein) receptor-mediated BMP signaling pathway plays a key role in embryonic development and tissue development. The binding of BMP to its receptor induces the phosphorylation of the downstream protein Smad, thereby activating the intracellular signal cascade reaction, among which type I BMP receptor plays a key role in transmitting BMP signals. Studies have found that the BMP signaling pathway plays an important role in the formation and homeostasis of bone and cartilage. Specific knockout of BMP receptors in neural crest cells can lead to abnormal craniofacial development. So far, there has been no report of BMP signaling and environmental teratogens causing midface clefts. Summary of the invention

[0005] The present invention found that mice with BMPR1A mutations in cranial neural crest cells do not have a mid-face cleft phenotype, but when their early embryonic development is stimulated by the environmental teratogen 2,3,7,8-tetrachlorodibenzodioxin (TCDD), they will develop a mid-face cleft phenotype without affecting the mid-face morphology of normal control mice. TCDD is a class of highly toxic aromatic compounds that can cause damage to multiple systems and organs in humans and animals, and has reproductive toxicity, developmental teratogenicity and carcinogenicity, and is considered "one of the most dangerous chemicals in the world." The present invention reveals the high sensitivity of BMPR1A to environmental teratogens after mutations, and mice with BMPR1A mutations in cranial neural crest cells can be used to screen out potential environmental teratogens and explore the mechanism and prevention and control measures of the synergistic teratogenicity of genes and environmental factors.

[0006] Based on the findings of the present invention, the object of the present invention is to provide an application of BMPR1A mutation in cranial neural crest cells in screening for face-cleavage teratogens.

[0007] The purpose of the present invention is achieved through the following technical solutions:

[0008] In a first aspect, the present invention provides an application of a BMPR1A mutation in a cranial neural crest cell for screening for teratogens in the face. Further, the BMPR1A mutation is a BMPR1A Q233D mutation. The BMPR1A mutation in a cranial neural crest cell is a Q233D mutation in BMPR1A in a mouse cranial neural crest cell, and BMPR1A Q233D is expressed in the mouse cranial neural crest cell.

[0009] In a second aspect, the present invention provides a use of a cranial neural crest cell BMPR1A mutant mouse in screening for face-cleft teratogens. Further, the BMPR1A mutation is a BMPR1A Q233D mutation, and the cranial neural crest cell BMPR1A mutant mouse is a mouse expressing BMPR1A Q233D in neural crest cells.

[0010] Furthermore, the cranial neural crest cell BMPR1A mutant mouse is ca-Bmpr1a flox / + ; P0-Cre mice, which specifically activate the expression of BMPR1A Q233D in neural crest cells. The construction of the mice is shown in the literature Augmentation of Smad-Dependent BMP Signaling in Neural Crest Cells Causes Craniosynostosis in Mice (J Bone Miner Res. 2013 Jun; 28 (6): 1422-33. PMID: 23281127), and specifically may include the following steps: making ca-Bmpr1a floxThe P0-Cre mice and P0-Cre mice were self-crossed to obtain F1 mice; the ca-Bmpr1a flox The individuals with positive expression were crossed with those with positive expression of P0-Cre, and the genotype of ca-Bmpr1a was screened. flox and P0-Cre double positive mice, that is, cranial neural crest cell BMPR1A mutant mice were obtained. flox The mouse is ca-Bmpr1a, which has a conditionally activated BMPR1A Q233D mutant inserted into the BMPR1A gene flox / + Heterozygous mice; the P0-Cre mice are P0-Cre(+) / (-) heterozygous mice carrying Cre elements in the promoter region of the P0 gene, and are Cre tool mice for cranial neural crest cells; ca-Bmpr1a flox Positive mice can conditionally activate the expression of BMPR1AQ233D in cranial neural crest cells under the action of P0-Cre positive mice. flox The genotype of individuals with positive expression is ca-Bmpr1a flox / + or ca-Bmpr1a flox / flox ; The genotype of individuals with P0-Cre positive expression in the F1 generation of mice is P0-Cre(+) / (-) or P0-Cre(+) / (+).

[0011] In a third aspect, the present invention provides a method for screening mid-face cleft teratogens, which comprises the following steps: taking pregnant mother mice whose offspring contain the above-mentioned cranial neural crest cell BMPR1A mutant mice, injecting the teratogen into the pregnant mice's abdominal cavity on embryonic development day 8.5-11.5 (E8.5-E11.5), collecting mouse embryo samples on embryonic development day 15.5-18.5 (E15.5-E18.5), observing the shape of the mid-face, and if a mid-face cleft phenotype appears, it indicates that the teratogen is a mid-face cleft teratogen.

[0012] In a fourth aspect, the present invention provides other applications of the above-mentioned cranial neural crest cell BMPR1A mutant mice, such as applications in studying the mechanism of synergistic teratogenicity between the BMPR1A gene and environmental factors, applications in studying measures for preventing and treating facial clefts, and applications in screening drugs for preventing and treating facial clefts.

[0013] The present invention has the following advantages and beneficial effects: The present invention reveals for the first time the high sensitivity of BMPR1A mutation to the environmental teratogen TCDD, providing new ideas and research directions for screening environmental teratogens that cause midface clefts. At the same time, it provides new targets for studying the mechanism of midface clefts caused by the combination of BMPR1A gene and environmental teratogens, and exploring the mechanism of teratogenicity caused by genes and environmental factors and prevention and treatment measures. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 A schematic diagram of the strategy for the method of breeding mice with BMPR1A mutation in cranial neural crest cells provided in an embodiment of the present invention.

[0015] Figure 2 The phenotype of mid-face developmental abnormality of pregnant mice injected with TCDD during the peritoneal period provided in the embodiments of the present invention. (A) is a schematic diagram of TCDD intraperitoneal injection of pregnant mice, and (B) is the mid-face phenotype of mice with BMPR1A mutation in cranial neural crest cells. Ctrl refers to control mice, ca-B Het refers to P0-Cre(+) / (-); ca-Bmpr1a flox / + Mice, Veh refers to the group without TCDD injection, TCDD refers to the group with TCDD injection.

[0016] Figure 3 This is a statistical chart of the results of mid-face developmental deformities in pregnant rats injected intraperitoneally with TCDD provided in an embodiment of the present invention. DETAILED DESCRIPTION

[0017] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described in combination with the embodiments below. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0018] It should be noted that, if no specific techniques or conditions are specified in the following examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0019] Example 1 Construction of cranial neural crest cell BMPR1A mutant mice

[0020] According to the literature Augmentation of Smad-Dependent BMP Signaling in Neural Crest Cells Causes Craniosynostosis in Mice, a fragment containing the BMPR1AcDNA Q233D mutation was inserted into the BMPR1A gene to cause a conditional activation mutation and obtain ca-Bmpr1a flox / + mouse; ca-Bmpr1a flox / + ca-Bmpr1a was obtained by selfing mice flox -F1 generation mice (genotype ca-Bmpr1a flox / +or ca-Bmpr1a flox / flox ). Differentiate ca-Bmpr1a flox / + or ca-Bmpr1a flox / flox The detection primers used for genotyping are shown in Table 1 as SEQ ID NO.1 to SEQ ID NO.4.

[0021] Table 1 Detection primers

[0022]

[0023]

[0024] The construction of P0-Cre(+) / (-) heterozygous mice carrying Cre elements in the promoter region of the P0 gene is shown in the literature A novel transgenic technique that allows specific marking of the neural crest celllineage in mice, which is a Cre tool mouse for cranial neural crest cells. P0-Cre(+) / (-) heterozygous mice were self-crossed to obtain P0-Cre-F1 mice (genotype P0-Cre(+) / (-) or P0-Cre(+) / (+)), and the detection primers for distinguishing the P0-Cre(+) / (-) and P0-Cre(+) / (+) genotypes are shown in SEQ ID NO.5 to SEQ ID NO.8 in Table 2.

[0025] Table 2 Detection primers

[0026] Primer number name Primers sequence SEQ ID NO.5 Control F(5'to3') ATGCTAGACCTGGGCAGCCATA SEQ ID NO.6 Control R(5'to3') CATGCTAGCAGCTCGGAGAAAC SEQ ID NO.7 Cre F(5'to3') GAGTGATGAGGTTCGCAAGA SEQ ID NO.8 Cre R(5'to3') CTACACCAGAGACGGAAATC

[0027] See also Figure 1 , ca-Bmpr1a flox -F1 mice were crossed with P0-Cre-F1 mice to obtain F2 mice, including the following four genotypes: ca-Bmpr1a flox / + and P0-Cre(+) / (-), ca-Bmpr1a flox / + and P0-Cre(-) / (-), ca-Bmpr1a + / + and P0-Cre(+) / (-), ca-Bmpr1a + / + and P0-Cre(-) / (-). Among them, ca-Bmpr1a flox and P0-Cre double positive (genotype ca-Bmpr1a flox / + The mice bearing P0-Cre(+) / (-)) are cranial neural crest cell BMPR1A mutant mice, which specifically activate the expression of BMPR1A Q233D in neural crest cells.

[0028] In this example, the construct ca-Bmpr1a flox / + The technology of mice and P0-Cre(+) / (-) mice is currently mature, and their construction has been recorded in the existing literature and will not be described in detail here.

[0029] Example 2 Mouse genotype identification and detection

[0030] To obtain ca-Bmpr1a flox and P0-Cre double positive model mice, for ca-Bmpr1a flox - The F2 mice (including fetuses) produced by hybridization of F1 mice and P0-Cre-F1 mice were tail-clipped, and genomic DNA was extracted and PCR was performed for verification. The target band should include ca-Bmpr1a flox Or Cre double bands, that is, two bands verified by PCR using primers such as SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.7, SEQ ID NO.8, that is, ca-Bmpr1a flox and P0-Cre double positive mice. ca-Bmpr1a flox / + : The PCR product size is 580bp; WT: The PCR product size is 334bp. In addition, P0-cre: The PCR product size is 696bp; Control: The PCR product size is 371bp.

[0031] Example 3 Analysis of mid-face morphology of BMPR1A mutant mice exposed to teratogens

[0032] Preparation of TCDD: TCDD was first dissolved in toluene to prepare a stock solution, which was diluted to 40 mg / mL with corn oil before injection. At the same time, a solvent (Vehicle, Veh) without TCDD was prepared.

[0033] The control mice (Ctrl) and the offspring containing the above-mentioned cranial neural crest cell BMPR1A mutant mice (P0-Cre(+) / (-); ca-Bmpr1a flox / + , ca-B) were divided into a TCDD-injected group and a Veh-injected group, with 5 mice in each group (n=5).

[0034] During the critical period of midface morphogenesis at embryonic stage E8.5-E11.5, pregnant mice were intraperitoneally injected with TCDD at 4 mg / kg / day. Figure 2 A), vehicle control (Veh) pregnant mice were intraperitoneally injected with the same dose and concentration of toluene dissolved in corn oil. The skulls of E18.5 mouse embryos were collected to detect mid-face deformities of the fetuses.

[0035] The results showed that after TCDD exposure, all BMPR1A mutant mice in the cranial neural crest cells developed obvious facial cleft phenotypes, while Ctrl mice were not affected. Compared with the mutant mice in the Veh group, the distance between the nostrils of the mutant mice in the TCDD-treated group was significantly larger ( Figure 2 B) The incidence of midface cleft is 100% ( Figure 3 ). These results indicate that mice with BMPR1A Q233D mutation in cranial neural crest cells are more sensitive to environmental teratogens and can be used to screen environmental teratogens and explore the mechanism of gene-environment synergy leading to midface cleft and its prevention and treatment measures.

[0036] The above description is intended only to help explain the present invention so that those skilled in the art can understand or implement the present invention. Various modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features claimed herein.

Claims

1. Application of BMPR1A mutations in cranial neural crest cells in screening for face-cleft teratogens.

2. The use according to claim 1, characterized in that: The BMPR1A mutation is a BMPR1A Q233D mutation.

3. The use according to claim 1, characterized in that: The cranial neural crest cell BMPR1A mutation is a Q233D mutation of BMPR1A in mouse cranial neural crest cells.

4. Application of BMPR1A mutant mice in cranial neural crest cells for screening facial cleft teratogens.

5. The use according to claim 4, characterized in that: The BMPR1A mutation is a BMPR1A Q233D mutation.

6. The use according to claim 4, characterized in that: The construction of cranial neural crest cell BMPR1A mutant mice comprises the following steps: making ca-Bmpr1a flox The P0-Cre mice were self-crossed with the P0-Cre mice to obtain F1 mice; the ca-Bmpr1a flox The individuals with positive expression were crossed with those with positive expression of P0-Cre, and the genotype of ca-Bmpr1a was screened. flox and P0-Cre double-positive mice to obtain BMPR1A mutant mice in cranial neural crest cells.

7. The use according to claim 5, characterized in that: The ca-Bmpr1a flox The mouse is ca-Bmpr1a, which has a conditionally activated BMPR1A Q233D mutant inserted into the BMPR1A gene flox / + Heterozygous mice; the P0-Cre mice are P0-Cre(+) / (-) heterozygous mice.

8. The use according to claim 5, characterized in that: ca-Bmpr1a in F1 mice flox The genotype of individuals with positive expression is ca-Bmpr1a flox / + or ca-Bmpr1a flox / flox ; The genotype of individuals with P0-Cre positive expression in the F1 generation of mice is P0-Cre(+) / (-) or P0-Cre(+) / (+).

9. A method for screening for teratogens in facial fissures, characterized in that: The following steps are involved: A pregnant mother mouse whose offspring contains a BMPR1A mutant mouse in cranial neural crest cells according to any one of claims 4 to 8 is intraperitoneally injected with a teratogen on embryonic day 8.5 to 11.5, and a mouse embryo sample is collected on embryonic day 15.5 to 18.5 to observe the shape of the mid-face. If a mid-face cleft phenotype appears, it indicates that the teratogen is a mid-face cleft teratogen.

10. The use of cranial neural crest cell BMPR1A mutant mice according to any one of claims 4 to 8, characterized in that: The application includes at least one of the following: application in studying the mechanism of synergistic teratogenicity between BMPR1A gene and environmental factors; application in studying measures for preventing and treating facial clefts; application in screening drugs for preventing and treating facial clefts.

Images