GntR17 gene deleted M5deltagntR17 strain as well as construction method and application of gntR17 gene deleted M5deltagntR17 strain

Abstract

The invention provides a gntR17 gene deleted strain M5 delta gntR17 as well as a construction method and application thereof, and belongs to the technical field of biology. The M5 delta gntR17 strain is preserved in the China General Microbiological Culture Collection Center (CGMCC), the preservation date is July 4, 2024, and the preservation number is CGMCC NO.46061. The M5 delta gntR17 strain is preserved in the China General Microbiological Culture Collection Center (CGMCC). It is found that the gntR17 gene is a related gene affecting the virulence of the brucella, the virulence of the brucella can be weakened by deletion of the gntR17 gene, the safety is improved, the survival ability of the brucella in cells and a mouse body can be remarkably reduced after deletion of the gntR17 gene, and the gntR17 gene has potential application value. Compared with the original brucella M5 strain, the M5 delta gntR17 strain constructed after the gntR17 gene is knocked out has the advantages that the virulence is weakened, the safety is high, the immune protection similar to that of an M5-90 delta 26 vaccine is realized, and the strain can be used as a candidate attenuated live vaccine strain for preventing animal brucellosis.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a gntR17 gene deleted strain M5ΔgntR17 strain and a construction method and application thereof. Background Art

[0002] Brucellosis, abbreviated as "brucellosis", is an important bacterial infectious disease that is transmitted between humans and animals. Infected animals mainly cause orchitis or epididymitis in male animals, and miscarriage, premature birth or stillbirth in female animals; infected humans mainly cause undulant fever and various complications.

[0003] Brucellosis is widely prevalent and distributed throughout the world. According to reports, there are about 500,000 new cases of infection worldwide each year, which seriously restricts the international trade of animals and animal-related products, and has a huge impact on public health and social and economic development. Brucellosis is widely distributed in my country, and the overall epidemic trend is "high in the north and low in the south". In the past two decades, due to factors such as the increase in animal breeding, frequent animal trade and circulation, brucellosis has resurfaced, the incidence rate has increased year by year, and the epidemic has reached a historical high level, seriously endangering people's health and the sustainable development of animal husbandry.

[0004] The prevention and control of brucellosis mainly rely on quarantine and vaccination. Since the beginning of the 20th century, the research and development of brucellosis vaccines has begun, and the development of vaccines has undergone a gradual evolution from inactivated vaccines, attenuated live vaccines, mutant strain vaccines and new vaccines. Studies have shown that the protective effect of Brucella attenuated live vaccines is significant and significantly better than inactivated vaccines. Therefore, vaccinating animals with Brucella attenuated live vaccines is one of the important measures to effectively control the prevalence of brucellosis. However, the current clinical veterinary Brucella attenuated live vaccines have certain defects, such as the high toxicity of attenuated vaccine strains and serious atavism, which will cause certain harm to human and animal bodies, and in severe cases, will cause illness. In addition, there is no effective vaccine for human brucellosis, and there is a risk of transmission to humans in the process of vaccinating animals with attenuated live vaccines. Therefore, the development of safe and effective vaccines for animals and humans will be a top priority for effectively curbing the prevalence of brucellosis.

[0005] With the development of molecular biology technology and a deeper understanding of the pathogenic mechanism of Brucella, new genetic engineering vaccines against brucellosis are expected to replace traditional vaccines and overcome the defects of existing vaccines. Therefore, the development of a new genetic engineering vaccine for brucellosis is of great significance to effectively curb the epidemic of brucellosis. Summary of the invention

[0006] The purpose of the present invention is to provide a gntR17 gene deleted strain M5ΔgntR17 strain and its construction method and application. The M5ΔgntR17 strain constructed after knocking out the gntR17 gene is less virulence than the original Brucella M5 strain and has high safety. It can be used as a candidate attenuated live vaccine strain for preventing animal brucellosis.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The present invention provides a gntR17 gene deleted strain M5ΔgntR17 strain, wherein the M5ΔgntR17 strain is obtained by deleting the gntR17 gene from the Brucella melitensis M5 strain, and the M5ΔgntR17 strain is deposited in the China General Microbiological Culture Collection Center, with a deposit date of July 4, 2024 and a deposit number of CGMCC NO.46061.

[0009] The present invention also provides a method for constructing the above-mentioned M5ΔgntR17 strain, comprising the following steps:

[0010] (1) PCR amplified the upstream homology arm fragment and the downstream homology arm fragment of the gntR17 gene, and after the amplification, the two fragments were fused to obtain a fusion fragment;

[0011] (2) connecting the fusion fragment with the linearized suicide plasmid pKB by homologous recombination to obtain a connection product, and screening to obtain the suicide plasmid pKB-ΔgntR17;

[0012] (3) The suicide plasmid was electroporated into Brucella melitensis competent cells, and the M5ΔgntR17 strain was obtained by screening.

[0013] Furthermore, in step (1), the sequence of the primer group used to amplify the upstream homologous arm fragment of the gntR17 gene is: GntR17-UF shown in SEQ ID NO:1 and GntR17-UR shown in SEQ ID NO:2; the sequence of the primer group used to amplify the downstream homologous arm fragment of the gntR17 gene is: GntR17-DF shown in SEQ ID NO:3 and GntR17-DR shown in SEQ ID NO:4; the primer group used for the fusion is GntR17-UF and GntR17-DR.

[0014] Furthermore, in step (2), the screening method is: the ligation product of step (2) is transformed into Escherichia coli DH5a competent cells, kanamycin-resistant strains are screened in turn on LB plates and liquid culture media containing kanamycin, and then PCR identification of the bacterial liquid is performed, and the pKB-ΔgntR17 plasmid is extracted.

[0015] Furthermore, in step (3), the screening method is: inoculating the transformed Brucella melitensis competent cells on a TSA plate containing kanamycin, picking up monoclonal bacteria for culture, and then negatively screening on a TSA plate containing sucrose, picking up monoclonal colonies, and continuing to culture them, and then using inner identification primers and outer identification primers to PCR identify the deletion strain M5ΔgntR17.

[0016] Furthermore, the sequences of the inner identification primers are: InGntR17-F shown in SEQ ID NO.5 and InGntR17-R shown in SEQ ID NO.6; the sequences of the outer identification primers are: OutGntR17-F shown in SEQ ID NO.7 and OutGntR17-R shown in SEQ ID NO.8.

[0017] The present invention also provides an application of a gntR17 gene deleted strain M5ΔgntR17 in the preparation of a Brucella attenuated live vaccine.

[0018] The M5ΔgntR17 strain of the present invention has the following beneficial effects compared with the prior art:

[0019] (1) The present invention found that the gntR17 gene is a related gene that affects the virulence of Brucella. The deletion of the gntR17 gene can weaken the virulence of Brucella and improve its safety. After deletion, it can significantly reduce the survival ability of Brucella in cells and mice, and has potential application value.

[0020] (2) The M5ΔgntR17 strain constructed after knocking out the gntR17 gene is less virulent than the original Brucella M5 strain and has higher safety. It has similar immune protection as the M5-90Δ26 vaccine and can be used as a candidate live attenuated vaccine strain for preventing animal brucellosis.

[0021] (3) The present invention found that the deletion of the gntR17 gene affects the basic phenotype of Brucella, such as slowing down the growth rate in a low-nutrient environment and significantly reducing the ability to resist killing by immune mediators. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0023] Figure 1 The result of PCR amplification of the target gene fragment in Example 1;

[0024] Figure 2The results of using universal primers M13F(-47) / R(-48) to identify the suicide plasmid pKB-ΔgntR17 in Example 1;

[0025] Figure 3 This is a schematic diagram of the identification of the M5ΔgntR17 deletion strain by PCR using inner and outer primers in Example 1;

[0026] Figure 4 The results of PCR identification of the M5ΔgntR17 deletion strain in Example 1; A is the PCR identification of the parent strain M5 and the M5ΔgntR17 deletion strain using the inner identification primers InGntR17-F and InGntR17-R; B is the PCR identification of the parent strain M5 and the M5ΔgntR17 deletion strain using the outer identification primers OutGntR17-F and OutGntR17-R;

[0027] Figure 5 Test Example 1 is a Brucella growth curve determination, wherein A is the growth curve result of the parent strain M5 and the M5ΔgntR17 deletion strain in TSB medium; B is the growth curve result of the parent strain M5 and the M5ΔgntR17 deletion strain in MM basal medium; Statistical analysis: "ns" indicates that there is no significant difference in the data; "***" indicates that the p value is ≤0.001 and the data is significantly different;

[0028] Figure 6 The results of the tolerance test of Experimental Example 1; A is the sensitivity of the parent strain M5 and the M5ΔgntR17 deletion strain to H2O2; B is the tolerance of the parent strain M5 and the M5ΔgntR17 deletion strain to polymyxin B; C is the tolerance of the parent strain M5 and the M5ΔgntR17 deletion strain to inactivated sheep serum and non-inactivated sheep serum; Statistical analysis: "ns" indicates that there is no significant difference in the data; "**" indicates that the p value is ≤0.01, and "***" indicates that the p value is ≤0.001 and the data are significantly different;

[0029] Figure 7 The results of Brucella adhesion and invasion of cells in Experiment 2; A shows the adhesion and invasion of RAW264.7 cells by the parent strain M5 and the M5ΔgntR17 deletion strain; B shows the adhesion and invasion of HeLa cells by the parent strain M5 and the M5ΔgntR17 deletion strain; Statistical analysis: "***" indicates that the p value is ≤ 0.001, and the data are significantly different;

[0030] Figure 8 This is the survival test of the parent strain M5 and the M5ΔgntR17 deletion strain in RAW264.7 cells and HeLa cells of Experiment Example 2; Statistical analysis: "***" indicates that the p value is ≤ 0.001, and the data are significantly different;

[0031] Fig. 9 The pathogenicity of the parent strain M5 and the M5ΔgntR17 deletion strain was evaluated in the mouse infection experiment of Experimental Example 2; Figure A shows the results of spleen bacterial load of mice infected with the parent strain M5 and the M5ΔgntR17 deletion strain for 1 week, 2 weeks and 4 weeks; spleen weight of mice infected with the M5 and M5ΔgntR17 deletion strain for 1 week, 2 weeks and 4 weeks; Statistical analysis: "***" indicates that the p value is ≤ 0.001, and the data are significantly different;

[0032] Fig.10 The results of the immune protection test of M5ΔgntR17 as a vaccine in Experimental Example 2; Figure A shows the results of the spleen bacterial load 30 days after mice were immunized with the deletion strain M5ΔgntR17 and the vaccine strain M5-90Δ26, and 2 weeks after the M5 challenge; Figure B shows the results of the spleen weight 30 days after mice were immunized with the deletion strain M5ΔgntR17 and the vaccine strain M5-90Δ26, and 2 weeks after the M5 challenge; Statistical analysis: "***" indicates that the p value is ≤ 0.001, and the data are significantly different;

[0033] Fig.11 These are the results of histopathological changes in the liver of mice 30 days after immunization with the deletion strain M5ΔgntR17 and the vaccine strain M5-90Δ26 in Experimental Example 2 and 2 weeks after M5 infection; the arrows point to the liver granulomas formed by Brucella infection.

[0034] Collection Instructions

[0035] M5ΔgntR17 strain, the strain is preserved in the General Microbiology Center of China Microbiological Culture Collection Administration, classification name: Brucella melitensis, address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing; the preservation date is: July 4, 2024, and the preservation number is: CGMCCNO.46061. DETAILED DESCRIPTION

[0036] The embodiments of the present invention are described in detail below, and the embodiments are intended to explain the present invention and should not be construed as limiting the present invention. If specific techniques or conditions are not specified in the embodiments, they are carried out according to the techniques or conditions described in the literature in this area or according to the product specifications. If the manufacturers of reagents or instruments are not specified, they are all conventional products that can be obtained commercially.

[0037] The present invention constructs the M5ΔgntR17 strain by knocking out the gntR17 gene. Compared with the original Brucella M5 strain, the M5ΔgntR17 strain has weakened virulence and high safety. After the deletion, the survival ability of Brucella in cells and mice can be significantly reduced. It has similar immune protection as the M5-90Δ26 vaccine and can be used as a candidate attenuated live vaccine strain for preventing animal brucellosis.

[0038] Example 1

[0039] In Example 1 of the present invention, a gntR17 gene deletion strain M5ΔgntR17 was constructed, and the specific method is as follows:

[0040] (1) Primer design:

[0041] The complete genome sequence of Brucella M28 (from NCBI's GenBank, sequence numbers: NC_017244.1, NC_017245.1) was used as a template to design the required primers. The primer sequences are as follows:

[0042] Primer pair for amplifying the upstream homology arm fragment GntR17-U of the gntR17 gene:

[0043] GntR17-UF (SEQ ID NO.1):

[0044] GGTACCCGGGGATCCCAGAGGATAACATGGCCGTC;

[0045] GntR17-UR (SEQ ID NO. 2):

[0046] GAGGCGGCGCATTTCGGTTTTATAGATAATGTTCT;

[0047] Primer pair for amplifying the downstream homology arm fragment of gntR17 gene GntR17-D:

[0048] GntR17-DF (SEQ ID NO. 3):

[0049] ATTATCTATAAAACCGAAATGCGCCGCCTCGCCTT;

[0050] GntR17-DR (SEQ ID NO.4):

[0051] TGCCTGCAGGTCGACGGCTTCACGCCTTGCCGTCG;

[0052] Internal identification primers:

[0053] InGntR17-F (SEQ ID NO.5): GTATCATTGCGGGCGAGATC;

[0054] InGntR17-R (SEQ ID NO.6): GGTGAGAATGAGACGGTGGA;

[0055] Outer identification primers:

[0056] OutGntR17-F (SEQ ID NO.7): TGAATGGAAACAGGCCGGCA;

[0057] OutGntR17-R (SEQ ID NO. 8): TGCAAGGCGCATTGAAGCTG.

[0058] (2) Amplification and fusion of target genes:

[0059] Using the genome of Brucella melitensis M5 as a template, the upstream homology arm fragment GntR17-U and the downstream homology arm fragment GntR17-D of the gntR17 gene were PCR amplified using the primer pairs GntR17-UF / UR and GntR17-DF / DR, respectively. The PCR amplification system was 50 μL, including 1 μL DNA template (100 ng / μL), 2 μL each of the upstream primer (10 pmol / μL) and the downstream primer (10 pmol / μL), 25 μL of 2×PrimeSTAR Max Premix (Takara), and deionized water was added to 50 μL; the PCR reaction conditions were 98°C pre-denaturation for 2 min, 98°C for 10 sec, 55°C for 15 sec, 72°C for 30 sec, 35 cycles, and finally extension at 72°C for 10 min. The PCR product was subjected to 1% agarose gel electrophoresis, and the results were as follows: Figure 1 As shown. Figure 1 It can be seen that the amplified GntR17-U and GntR17-D fragments are approximately 700 bp in size, which is consistent with the expected results.

[0060] Then, the target gene fragment was recovered by Tiangen agarose gel recovery kit, and the gel-recovered GntR17-U and GntR17-D were used as templates and GntR17-UF / DR as primers. Overlap-PCR was used to fuse the upstream and downstream homology arm fragments. In the 50μL PCR amplification reaction system, 1μL of the gel-recovered GntR17-U (10-20ng / μL) and GntR17-D (10-20ng / μL) were added, 2μL of the upstream primer GntR17-UF (10pmol / μL) and the downstream primer GntR17-DR (10pmol / μL) were added, 2×PrimeSTAR MaxPremix (Takara) 25μL, and deionized water was added to 50μL; the PCR reaction conditions were 98℃ pre-denaturation for 2min, 98℃ for 10sec, 55℃ for 15sec, 72℃ for 1min, 35 cycles, and finally extension at 72℃ for 10min. The PCR products were subjected to 1% agarose gel electrophoresis. Figure 1 As shown, the upstream and downstream fusion fragment GntR17-UD is approximately 1400 bp, which is consistent with the expected size.

[0061] (3) Construction of suicide plasmid:

[0062] The fusion fragment GntR17-UD was connected to the linearized pKB plasmid using the Novagen homologous recombination kit, and the connection product was transformed into Escherichia coli DH5a competent cells. After screening on LB plates containing 50 μg / mL kanamycin, single colonies with kanamycin resistance were picked and inoculated in LB liquid culture medium containing kanamycin for culture. Subsequently, the universal primers M13F(-47) / R(-48) were used for bacterial liquid PCR identification. The PCR reaction system was 20 μL, including 1 μL of cultured bacterial liquid, 1 μL of upstream and downstream primers, 10 μL of 2×Taq Master Mix (Novagen), and 7 μL of deionized water. The PCR reaction conditions were 95°C pre-denaturation for 2 min, 95°C for 15 sec, 60°C for 15 sec, 72°C for 1 min, 35 cycles, and finally 72°C extension for 10 min.

[0063] Figure 2 The PCR identification results showed that the target fragment size was about 1400 bp, which was consistent with the expected result. The correctly identified recombinant bacteria were cultured and amplified by LB, and the suicide plasmid was extracted by Tiangen Mini-Extraction Kit and named pKB-ΔgntR17. The correctly sequenced plasmid was saved for later use.

[0064] (4) Construction of gene-deficient strains:

[0065] Brucella melitensis M5 (purchased from China Veterinary Microbial Culture Collection Center, culture collection number: CVCC18) was cultured in TSB until the early logarithmic growth phase (OD 600 After ice bath for 15 min, centrifuge at 8000 rpm for 5 min, collect bacterial precipitates, wash the cells twice with pre-cooled sterile deionized water, add pre-cooled 10% glycerol water to resuspend the bacterial precipitates, and obtain Brucella electrotransformation competent cells. Add 2 μg of pKB-ΔgntR17 plasmid to 90 μL Brucella competent cells, place on ice for 10 minutes, add the mixture to the electroporation cup, electroporate the plasmid into Brucella competent cells at 2.4 kV, 400 Ω, immediately add 900 μL of preheated TSB, shake and culture at 200 rpm for 6-8 hours, spread the entire bacterial solution on a TSA plate containing kanamycin, and culture at 37°C and 5% CO2 for 3-5 days. Pick out single clone bacteria, inoculate in TSB and shake and culture at 37°C for 2-3 days, spread the bacterial solution on a TSA plate containing 5% sucrose for the second round of screening, use InGntR17-F / R and OutGntR17-F / R as the inner and outer identification primers, respectively, and perform PCR to identify the deletion strain. The PCR reaction system and reaction conditions are the same as those described in step (3). The schematic diagram of PCR identification is shown in the figure below. Figure 3 shown.

[0066] Depend on Figure 3 It can be seen that the fragment size of the parental strain identified by PCR using the inner primers InGntR17-F / R is 356bp, and the deletion strain should not have this band; the band size of the parental strain identified by PCR using the outer primers OutGntR17-F / R is 1102bp, and the deletion strain has a missing 693bp, so the band size should be 409bp.

[0067] Figure 4 The PCR identification results showed that the band size of the parent strain M5 was about 350bp using the inner primers, which was consistent with the expected size; the deletion strain M5ΔgntR17 had no obvious band amplification, which was consistent with expectations. The band size of the parent strain M5 was about 1100bp using the outer primers for PCR identification, which was consistent with the expected result; the band size of the deletion strain M5ΔgntR17 was about 400bp, which was consistent with the expected deletion strain. The above results showed that the M5ΔgntR17 strain was successfully constructed.

[0068] Test Example 1

[0069] Test Example 1 of the present invention verifies the basic phenotypes of the Brucella M5ΔgntR17 strain and the Brucella M5 parent strain in Example 1, and the specific method is as follows:

[0070] (1) Growth curve determination:

[0071] Brucella M5 parent strain and M5ΔgntR17 deletion strain were cultured in vitro to the logarithmic growth phase and OD 600 The value was set to 1.0, and the bacterial solution was inoculated into TSB and MM at a ratio of 1:10, respectively, and cultured at 37°C and 220 rpm. 100 μL of the bacterial solution was taken every 6 h to measure the OD 600 The bacterial growth curve was drawn according to the value. The results are shown in Figure 5 .

[0072] like Figure 5 As shown in the figure, in TSB medium, the growth rate of M5ΔgntR17 is consistent with that of the parent strain, indicating that the loss of the gntR17 gene does not affect the growth ability of Brucella in TSB. In MM basal medium, the growth ability of M5ΔgntR17 is significantly weaker than that of the parent strain M5, indicating that the loss of the gntR17 gene affects the growth of Brucella in low-nutrient medium.

[0073] (2) Tolerance test

[0074] Brucella M5 parent strain and M5ΔgntR17 deletion strain were cultured in vitro to the logarithmic growth phase, and the bacterial solution was diluted to 5×10 5 CFU / mL, the obtained bacterial solution was subjected to the following experiments:

[0075] A. Hydrogen peroxide tolerance test: Use sterile PBS to dilute H2O2 to a final concentration of 2mM and 1mM, take 50μL of each in an EP tube, then add 50μL of the diluted bacterial solution to the EP tube. Also set up a negative control group, take 50μL of PBS solution in an EP tube and add 50μL of the diluted bacterial solution to the EP tube, pipette and mix the mixture, and then culture it at 37°C and 220rpm for 1h. After the incubation, add 900μL of sterile PBS and mix well. After diluting 10 times, take 100μL of the suspension and apply it to the TSA plate. Culture at 37°C for 3-5 days, count the bacterial colonies, and calculate the bacterial survival rate. Three repeated tests are set for each group of tests for each strain. The results are as follows: Figure 6 shown.

[0076] B. Brucella resistance to positive bactericidal peptides test: prepare polymyxin B solutions with concentrations of 2 mg / mL and 1 mg / mL respectively, take 50 μL of each in an EP tube, then add 50 μL of the diluted bacterial solution to the EP tube, and set up a negative control group, take 50 μL of PBS solution in an EP tube and add 50 μL of the diluted bacterial solution to the EP tube, blow and mix the mixture, and then culture it at 37°C and 220 rpm for 1 hour. After incubation, add 900 μL of sterile PBS and mix well. After diluting 10 times, take 100 μL of the suspension and apply it to the TSA plate. Culture at 37°C for 3 to 5 days, count the bacterial colonies, and calculate the bacterial survival rate. Three repeated tests are set for each group of tests for each strain. The results are as follows Figure 6 shown.

[0077] C. Anti-bacterial ability test of natural serum of adult sheep: using sheep serum inactivated at 56℃ for 30min as control, the bactericidal ability of M5ΔgntR17 strain against non-inactivated sheep serum was studied. 950μL of each of the two sheep sera were taken in 2mL EP tubes, 50μL of the diluted bacterial solution was added to each EP tube and mixed by blowing, and then a control group was set up, that is, 950μL of PBS was taken in 2mL EP tubes and 50μL of the diluted bacterial solution was added thereto respectively. Three replicates were made for each strain, and then placed in a 37℃ incubator for 1.5h. The bacterial solution after standing was diluted 10 times, and 100μL of the diluted bacterial solution was taken for hanging on the plate. After culturing in a 37℃ incubator for 3-4d, the monoclonal colonies on the plate were counted, and the survival rate of Brucella was calculated with the PBS group as the control. The results are as follows: Figure 6 shown.

[0078] (Bacterial survival rate = bacterial CFU of the treatment group / bacterial CFU of the PBS control group×100%).

[0079] Figure 6The results showed that the tolerance of the M5ΔgntR17 strain in hydrogen peroxide solutions with a final concentration of 0.5mM and 1.0mM was significantly lower than that of the parent strain M5, indicating that the loss of gntR17 weakened the ability of Brucella to resist oxidative stress; secondly, the tolerance of the M5ΔgntR17 strain in polymyxin B solutions with a final concentration of 0.5mg / mL and 1.0mg / mL was also significantly lower than that of the parent strain M5, indicating that the loss of gntR17 weakened the ability of Brucella to resist killing by positive bactericidal peptides. In addition, the survival rate of the M5ΔgntR17 strain in adult sheep serum was significantly lower than that of the parent strain M5, while in non-inactivated adult sheep serum, the survival rate of the M5ΔgntR17 strain was similar to that of the parent strain M5, indicating that the loss of the gntR17 gene weakened the resistance of Brucella to killing by non-immune sheep serum.

[0080] Test Example 2

[0081] Test Example 2 of the present invention detected the virulence and immune protection evaluation of Brucella M5ΔgntR17 strain, and the specific steps were as follows:

[0082] (1) Brucella M5ΔgntR17 strain adhesion, invasion and intracellular survival assay

[0083] A. Brucella M5ΔgntR17 strain adhesion and invasion cell test:

[0084] Brucella M5 and M5ΔgntR17 strains were cultured in TSB until the logarithmic growth phase, and the bacterial concentration was adjusted to OD 600 Value = 1.0.

[0085] One day in advance, mouse macrophages RAW264.7 or HeLa cells were inoculated in a 24-well cell culture plate and cultured for 20-24 hours until the cells grew into a monolayer. Wash the cells twice with DMEM, inoculate RAW264.7 cells at a bacteria / cell ratio of 100:1, and inoculate HeLa cells at a bacteria / cell ratio of 500:1, with three replicates per group. After inoculation, place the cell plate in a centrifuge and centrifuge at 25°C, 400×g for 5 minutes. After centrifugation, place the cell plate in a 37°C, 5% CO2 incubator for infection for 1 hour, which is counted as time 0 of infection. After the cells are infected, wash the cells three times with PBS, add 200 μL of 0.25% Triton-X 100 solution to each well to lyse the cells, take 100 μL of cell lysate and dilute it 10 times, then hang the plate, culture it in a 37°C, 5% CO2 incubator for 3-4 days, count the number of monoclonal colonies and calculate the original CFU of each well, which is the amount of adhered bacteria at this time; after the cells are infected, wash the cells three times with PBS, add DMEM containing 100 μg / mL gentamicin and incubate for 1 hour to kill extracellular bacteria. Subsequently, wash the cells three times with PBS to remove extracellular bacteria, add 200 μL of 0.25% Triton-X 100 solution to each well to lyse the cells, take 100 μL of cell lysate and dilute it 10 times, then hang the plate, culture it in a 37°C, 5% CO2 incubator for 3-4 days, count the number of monoclonal colonies and calculate the original CFU of each well, which is the amount of invading bacteria at this time. The results are as follows: Figure 7 shown.

[0086] Figure 7 The results showed that in the RAW264.7 cell infection group, the ability of M5ΔgntR17 strain to adhere to RAW264.7 cells was similar to that of the parent strain M5, but its ability to invade RAW264.7 cells was significantly improved; in the HeLa cell infection group, the ability of M5ΔgntR17 strain to adhere to and invade HeLa cells was significantly improved. This result may be related to the fact that the deletion of Brucella gntR17 gene affects the bacterial outer membrane structure.

[0087] B. Intracellular survival assay:

[0088] Brucella M5 and M5ΔgntR17 strains were cultured in TSB until the logarithmic growth phase, and the bacterial concentration was adjusted to OD 600Value = 1.0. Mouse macrophages RAW264.7 or HeLa cells were inoculated into 24-well cell culture plates one day in advance and cultured for 20-24 hours until the cells grew into a monolayer. The infection dose and infection method were the same as those in the A cell adhesion and invasion test. After the cells completed the infection process, DMEM containing 100 μg / mL gentamicin was used to kill extracellular bacteria. The cells were washed 3 times with PBS. After removing the extracellular bacteria, the cells were replaced with DMEM solution containing 50 μg / mL gentamicin and 1% FBS to maintain the cells. At 1h, 8h, 24h and 48h after infection, the cells were washed 3 times with PBS. 200 μL of 0.25% Triton-X100 solution was added to each well to lyse the cells. 100 μL of cell lysate was diluted 10 times in a gradient manner and then hung on the plate. The plates were cultured in a 37°C, 5% CO2 incubator for 3-4 days. The CFU were counted and the original CFU of each well was calculated. The intracellular survival curve of Brucella was drawn. The results are shown in the figure. Figure 8 shown.

[0089] Figure 8 The results showed that the M5ΔgntR17 deletion strain showed an increase in the intracellular bacterial load in the early stage of infection compared with the parent strain M5 when infecting RAW264.7 cells and HeLa cells, and the intracellular survival ability was significantly weakened as the infection time extended. The results indicate that the deletion of the gntR17 gene weakens the ability of Brucella to survive intracellularly.

[0090] (2) Pathogenicity test in mice:

[0091] Brucella M5 and M5ΔgntR17 strains were cultured in TSB until the logarithmic growth phase, and the bacterial concentration was adjusted to OD 600 Value = 1.0 (at this time, the bacterial concentration is about 5×10 9 CFU / mL), and the bacterial solution was diluted with PBS to about 1×10 7 CFU / mL.

[0092] Thirty female BALB / c mice aged 6-8 weeks were divided into M5 and M5ΔgntR17 inoculation groups, with 15 mice in each group. Each mouse was intraperitoneally injected with 0.2 mL of bacterial solution (about 1×10 6 CFU / mouse). At the 1st, 2nd and 4th week after infection, 5 mice were taken from each group and killed by rapid cervical dislocation. The spleens were taken out to observe the swelling of the spleens and weigh the spleens. 3 mL of 0.25% Triton-X100 PBS solution was added to the spleens for tissue grinding. After ten-fold dilution, 100 μL was coated on TSA plates. After the appearance of monoclonal colonies, the CFU was calculated, the original bacterial load in each spleen was estimated, and a bar graph was drawn. The bacterial load and spleen enlargement of mice inoculated with M5 and M5ΔgntR17 strains were statistically analyzed to evaluate the residual virulence of the bacteria. The results are shown in Figure 2. Fig. 9 shown.

[0093] Fig. 9 The results showed that 1 week after the mice were inoculated with bacteria, the bacterial load in the spleen infected with M5ΔgntR17 was significantly reduced compared with the M5 parent strain, and the spleen weight infected with M5ΔgntR17 was not significantly different from the M5 parent strain; 2 weeks after the mice were inoculated with bacteria, the bacterial load and spleen weight infected with M5ΔgntR17 were significantly reduced compared with the M5 parent strain; 4 weeks after the mice were inoculated with bacteria, the bacterial load in the spleen infected with M5ΔgntR17 was significantly reduced compared with the M5 parent strain, and the spleen weight infected with M5ΔgntR17 was not significantly different from the M5 parent strain. In summary, the results of the experiments showed that the deletion of the gntR17 gene significantly reduced the pathogenicity of Brucella M5 strain to mice.

[0094] (3) Immunoprotective test: Brucella M5ΔgntR17 and vaccine strain M5-90Δ26 were cultured in vitro by TSB until the logarithmic growth phase, and the bacterial solution concentration was adjusted to OD 600 Value = 1.0 (at this time, the bacterial concentration is about 5×10 9 CFU / mL), and the bacterial solution was diluted with PBS to about 1×10 6 CFU / mL. Thirty female BALB / c mice aged 6-8 weeks were divided into PBS group, M5ΔgntR17 group and M5-90Δ26 group, with 5 mice in each group. Each mouse was intraperitoneally injected with 0.2 mL of bacterial solution (about 1×10 6 CFU / mouse), the mice in the PBS group were intraperitoneally injected with 0.2 mL PBS, and 30 days after vaccination, all mice were inoculated with 5×10 4 The mice were challenged with M5 strain at a dose of 1000 CFU / mouse. Two weeks after the challenge, all mice were quickly killed by cervical dislocation. The spleens of the mice were taken out to observe the swelling of the spleens and weigh the spleens. 3 mL of 0.25% Triton-X100 PBS solution was added to the spleens for tissue grinding. After ten-fold dilution, 100 μL was taken and coated on TSA plates. After monoclonal colonies appeared, the CFUs were counted and calculated, and the bacterial load per gram of spleen was estimated. The results are shown in the figure. Fig.10 shown.

[0095] Fig.10The results showed that 2 weeks after M5 infection, the Brucella load in the spleens of mice immunized with M5ΔgntR17 and M5-90Δ26 was significantly decreased compared with that of the PBS vaccination group, and the difference was significant; there was no significant difference in the Brucella load in the spleens of mice immunized with M5ΔgntR17 and M5-90Δ26; the spleen weight results showed that compared with the spleen weight of mice in the PBS group, the spleen weight of mice immunized with M5ΔgntR17 and M5-90Δ26 was significantly decreased, and the difference was significant; there was no significant difference in the spleen weight of mice immunized with M5ΔgntR17 and M5-90Δ26.

[0096] To further evaluate the immune protection of the M5ΔgntR17 and M5-90Δ26 vaccine strains, the livers of mice challenged with M5 were removed and fixed in 4% paraformaldehyde for 24-48 hours. The livers were then sent to Wuhan Sewell Company for tissue section preparation and HE staining to observe the pathological changes in the liver. The results are as follows: Fig.11 shown.

[0097] Fig.11 The results showed that compared with the PBS vaccination group, mice vaccinated with M5ΔgntR17 and M5-90Δ26 vaccine strains significantly weakened the formation of liver granulomas induced by Brucella infection; there was almost no difference between the M5ΔgntR17 and M5-90Δ26 groups, and scattered small granulomas formed by M5-90Δ26 were seen in some locations. The above experimental results show that M5ΔgntR17 is a good vaccine candidate strain, and its immune protection effect is similar to that of the commercial vaccine M5-90Δ26 strain, with no significant difference.

[0098] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A gntR17 gene deletion strain M5ΔgntR17 strain, characterized in that: The M5ΔgntR17 strain is obtained after the Brucella melitensis M5 strain lacks the gntR17 gene. The M5ΔgntR17 strain is deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration, with the address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing; the preservation date is July 4, 2024, and the preservation number is: CGMCC NO.46061.

2. A method for constructing the M5ΔgntR17 strain according to claim 1, characterized in that: The steps include: (1) PCR amplified the upstream homology arm fragment and the downstream homology arm fragment of the gntR17 gene, and after the amplification, the two fragments were fused to obtain a fusion fragment; (2) connecting the fusion fragment with the linearized suicide plasmid pKB by homologous recombination to obtain a connection product, and screening to obtain the suicide plasmid pKB-ΔgntR17; (3) The suicide plasmid was electroporated into Brucella melitensis competent cells, screened and extracted to obtain the M5ΔgntR17 strain.

3. The method for constructing the M5ΔgntR17 strain according to claim 2, characterized in that: In step (1), the sequence of the primer set used to amplify the upstream homology arm fragment of the gntR17 gene is: GntR17-UF shown in SEQ ID NO: 1 and GntR17-UR shown in SEQ ID NO: 2; the sequence of the primer set used to amplify the downstream homology arm fragment of the gntR17 gene is: GntR17-DF shown in SEQ ID NO: 3 and GntR17-DR shown in SEQ ID NO: 4; the primer set used for the fusion is GntR17-UF and GntR17-DR.

4. The method for constructing the M5ΔgntR17 strain according to claim 2, characterized in that: In step (2), the screening method is: the ligation product of step (2) is transformed into Escherichia coli DH5a competent cells, kanamycin-resistant strains are screened in LB plates and liquid culture media containing kanamycin, and then PCR identification of the bacterial liquid is performed, and the pKB-ΔgntR17 plasmid is extracted.

5. The method for constructing the M5ΔgntR17 strain according to claim 2, characterized in that: In step (3), the screening method is: inoculating the transformed Brucella melitensis competent cells on a TSA plate containing kanamycin, picking up monoclonal bacteria for culture, and then negatively screening on a TSA plate containing sucrose, picking up monoclonal colonies, and continuing to culture them, using inner identification primers and outer identification primers, and PCR identifying the deletion strain M5ΔgntR17.

6. The method for constructing the M5ΔgntR17 strain according to claim 5, characterized in that: The sequences of the inner identification primers are: InGntR17-F shown in SEQ ID NO.5 and InGntR17-R shown in SEQ ID NO.6; the sequences of the outer identification primers are: OutGntR17-F shown in SEQ ID NO.7 and OutGntR17-R shown in SEQ ID NO.

8.

7. Use of the gntR17 gene deleted strain M5ΔgntR17 according to claim 1 in preparing a Brucella attenuated live vaccine.

Images