Nucleic acid molecule, transcription element, expression vector, host and application thereof

Abstract

The invention relates to the field of microorganisms, in particular to a nucleic acid molecule, a transcription element, an expression vector, a host and application thereof. The invention provides a nucleic acid molecule which has a nucleotide sequence as shown in SEQ ID NO: 1. According to the present invention, the genome of Bacillus megaterium YJB3 and the related bioinformatics analysis discover that the protein encoded by the transcription elongation factor Tu is the ribosome binding protein, and can promote the aminoacyl-tRNA dependent GTP and ribosome A site binding in the protein biosynthesis process; by combining molecular biology, genetics and biochemical analysis, further identification finds that the EF-Tu promoter has efficient starting capability and has no negative influence on the growth of bacillus megatherium.

Description

Technical Field

[0001] The present invention relates to the field of microorganisms, and in particular to nucleic acid molecules, transcription elements, expression vectors, hosts and applications thereof. Background Art

[0002] During agricultural production, agricultural products such as pesticides, fertilizers, and agricultural films applied to farmland, combined with industrial "three wastes" emissions, have led to the release of a large number of PAEs-type organic pollutants, which in turn has led to the increasing pollution of farmland soil. These pollutants are not only absorbed and accumulated by crops, but also seriously threaten the quality and safety of agricultural products. PAEs are a type of environmental hormone pollutants with potential carcinogenic, teratogenic and mutagenic effects. Long-term consumption of agricultural products rich in PAEs will lead to long-term low-dose exposure to the human body, which seriously threatens human health. Bioremediation is one of the most direct solutions for PAEs pollution in farmland soil. Compared with traditional physical and chemical remediation methods (such as soil removal, chemical leaching, gas stripping and heat treatment), bioremediation technology has the advantages of low cost, environmental friendliness, safety and efficiency. Bioremediation technology mainly includes microbial remediation, phytoremediation and their combined remediation. Functional microorganisms that can efficiently degrade PAEs can be screened from the external environment of plants or isolated from plants.

[0003] Bacillus megaterium YJB3, which was screened from wild rice roots, has good application prospects as a potential bioremediation agent and can play an important role in the remediation of PAEs-contaminated soil. This strain not only has a fast growth rate and environmental adaptability, making it an ideal microbial resource, but can also effectively degrade PAEs organic pollutants in the soil through its biodegradation ability, thereby reducing environmental hazards and promoting the treatment and remediation of contaminated soil. In addition, as an important growth-promoting bacterium, Bacillus megaterium has the ability to synthesize and secrete secondary metabolites, and can play a significant role in soil element activation, saline-alkali land improvement, and plant disease resistance enhancement. It is harmless to humans and animals and has good value for the development of engineering bacteria.

[0004] In summary, Bacillus megaterium has a simple culture method and grows rapidly. It can be used as an excellent biofertilizer and microbial agent, and can also be used as an ideal host for related enzymes and important compounds. In order to fully tap its potential in environmental remediation and agricultural applications, genetic engineering technology is crucial. However, the lack of highly active endogenous promoters to drive transgenic expression is one of the main bottlenecks in achieving efficient transformation of Bacillus megaterium in traditional methods. The present invention aims to improve the efficiency of genetic transformation of Bacillus megaterium while ensuring that there is no damage to Bacillus megaterium itself.

[0005] Gene expression levels in bacteria are significantly affected by the dynamic range of promoters, which are core genomic elements of transcriptional regulation and determine the intensity and timing of gene expression. The insertion or deletion of promoters can regulate gene expression, thus providing a basis for studying gene function and metabolic regulation in bacteria. Bacterial promoters have conserved features, such as the -35 and -10 regions, as well as binding sites for related transcription factors, which are essential for the recruitment of RNA polymerase and transcription initiation.

[0006] Therefore, finding an efficient promoter is crucial for studying the gene function of Bacillus megaterium and exploring its potential for agricultural applications. Summary of the invention

[0007] In view of this, the present invention provides nucleic acid molecules, transcription elements, expression vectors, hosts and applications thereof. The present invention analyzes the genome and related bioinformatics of Bacillus megaterium YJB3 and finds that the protein encoded by transcription elongation factor Tu (EF-Tu) is a ribosome binding protein, which plays a role in promoting the binding of aminoacyl-tRNA-dependent GTP to the ribosome A site during protein biosynthesis. The EF-Tu promoter contains multiple common acting elements, among which TATA-box is a classic promoter element, which is usually associated with the transcription initiation process; CAAT-box, as a common cis-acting element, plays a role in enhancing the efficiency of gene expression in the promoter and enhancer regions. By combining molecular biology, genetics and biochemical analysis, it was further identified that the EF-Tu promoter has efficient initiation ability and has no negative impact on the growth of Bacillus megaterium. Therefore, the present invention uses the EF-Tu promoter to construct an expression vector of Bacillus megaterium YJB3, and names it as the "pYJB3-EFTu" vector.

[0008] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0009] The present invention provides a nucleic acid molecule having:

[0010] (1) the nucleotide sequence shown in SEQ ID NO: 1; or

[0011] (2) A nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence shown in (1), and having the same or similar functions as the nucleotide sequence shown in (1); or

[0012] (3) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (1) or (2).

[0013] In some embodiments of the present invention, the sequence of SEQ ID NO: 1 above is: ttgattttcactctttattgaagtataactacttatgtacgctgtgaaagtggagctcattccctttcacggcctcataaaa.

[0014] The present invention also provides the use of the nucleic acid molecule as a promoter.

[0015] The present invention also provides a transcription element, comprising the above nucleic acid molecule and a target gene.

[0016] In some embodiments of the present invention, the above-mentioned transcription element further includes a cis-acting element.

[0017] The present invention also provides an expression vector, comprising the above nucleic acid molecule or the above transcription element.

[0018] The present invention also provides a host for transforming or transfecting the above expression vector.

[0019] In some embodiments of the present invention, in the above-mentioned host, the transformed or transfected chassis strain includes: Bacillus megaterium.

[0020] In some embodiments of the present invention, in the above-mentioned host, the Bacillus megaterium includes: Bacillus megaterium YJB3.

[0021] The present invention also provides the use of the nucleic acid molecule, the transcription element, the expression vector or the host in improving the transformation efficiency of Bacillus megaterium.

[0022] The present invention provides a nucleic acid molecule having:

[0023] (1) the nucleotide sequence shown in SEQ ID NO: 1; or

[0024] (2) A nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence shown in (1), and having the same or similar functions as the nucleotide sequence shown in (1); or

[0025] (3) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (1) or (2).

[0026] Beneficial effects of the present invention:

[0027] (1) Bacillus megaterium is relatively simple to cultivate and grows fast. It is not only a good biofertilizer and microbial agent, but also an ideal host for related enzymes and important compounds. In order to fully tap the potential of Bacillus megaterium in environmental treatment and industrial applications, genetic engineering technology plays a vital role. However, the lack of highly active endogenous promoters to drive the expression of transgenes is one of the main obstacles to the efficient transformation of traditional Bacillus megaterium.

[0028] (2) Secondly, efficient transformation of Bacillus megaterium was achieved through genetic engineering.

[0029] (3) The most important point is that the time cycle is short. The transformation efficiency is high when using the EF-Tu promoter. It takes only 4 days from electroporation to transformation, and positive transformation strains can be screened. Figure 4 B in. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art are briefly introduced below.

[0031] Figure 1 Shows analysis of pYJB3-EFTu promoter element;

[0032] Figure 2 shows the transformation plate of EF-Tu promoter before optimization;

[0033] Figure 3 Shows the Blast alignment results of EF-Tu promoter sequence;

[0034] Figure 4 Figure 2 shows a plate image of eYFP transformed bacteria; A shows wild-type bacteria; B shows eYFP transformed bacteria; C shows yeast; D shows Escherichia coli;

[0035] Figure 5 Shows molecular identification of EYFP wild-type bacteria;

[0036] Figure 6 Shows the molecular identification of EYFP-transformed bacteria. DETAILED DESCRIPTION

[0037] The invention discloses nucleic acid molecules, transcription elements, expression vectors, hosts and applications thereof.

[0038] It should be understood that the expression "one or more of..." includes each of the items recited after the expression individually and in various different combinations of two or more of the recited items, unless otherwise understood from the context and usage. The expression "and / or" in combination with three or more recited items should be understood to have the same meaning, unless otherwise understood from the context.

[0039] The use of the terms "comprising", "having" or "containing", including their grammatical synonyms, should generally be understood as open and non-restrictive, for example not excluding other unrecited elements or steps, unless otherwise specifically stated or otherwise understood from the context.

[0040] It should be understood that the order of steps or the order in which certain actions are performed is not important as long as the present invention remains operable. In addition, two or more steps or actions may be performed simultaneously.

[0041] The use of any and all examples or exemplary language, such as "for example" or "including", herein is intended only to better illustrate the invention and does not limit the scope of the invention unless otherwise claimed. No language in this specification should be construed as indicating that any non-claimed element is essential to the practice of the invention.

[0042] In addition, the numerical ranges and parameters used to define the present invention are approximate values, and the relevant values ​​in the specific embodiments have been presented as accurately as possible. However, any numerical value inherently inevitably contains standard deviations due to individual test methods. Therefore, unless otherwise expressly stated, it should be understood that all ranges, quantities, values ​​and percentages used in this disclosure are modified by "about". Here, "about" generally means that the actual value is within plus or minus 10%, 5%, 1% or 0.5% of a specific value or range.

[0043] The present invention analyzes the genome and related bioinformatics of Bacillus megaterium YJB3 and finds that the protein encoded by transcription elongation factor Tu (EF-Tu) is a ribosome binding protein, which plays a role in promoting the binding of aminoacyl-tRNA-dependent GTP to the ribosome A site during protein biosynthesis. The EF-Tu promoter contains multiple common acting elements, among which TATA-box is a classic promoter element, which is usually related to the transcription initiation process; CAAT-box, as a common cis-acting element, plays a role in enhancing the efficiency of gene expression in the promoter and enhancer regions. By combining molecular biology, genetics and biochemical analysis, it was further identified that the EF-Tu promoter has efficient initiation ability and has no negative impact on the growth of Bacillus megaterium. Therefore, this study used the EF-Tu promoter to construct an expression vector of Bacillus megaterium YJB3 and named it "pYJB3-EFTu" vector.

[0044] The Bacillus megaterium YJB3 involved in the present invention is an endophyte screened by the research team from Canna indica L. planted in artificial wetlands in the early stage. Its preservation information is as follows: preservation unit: China Center for Type Culture Collection (CCTCC), preservation date: June 28, 2017, preservation address: Wuhan University, Wuhan, China, preservation number: CCTCCNO: M 2017389.

[0045] In Examples 1 to 3 of the present invention, all the raw materials and reagents used can be purchased from the market.

[0046] The present invention will be further described below in conjunction with embodiments:

[0047] Example 1

[0048] Based on the self-developed promoter prediction software (wePromoter), combined with genomic data, the elongation factor Tu (EF-Tu) promoter was found, and an efficient genetic transformation system for Bacillus megaterium was constructed. First, the EF-Tu overexpression vector of Bacillus megaterium was constructed, such as Figure 1 As shown, the elongation factor Tu (EF-Tu) promoter includes TATA-box, which is a classic promoter element and is usually associated with transcription initiation. CAAT-box, as a widely existing cis-acting element, plays an important role in the promoter and enhancer regions, enhancing the expression efficiency of genes.

[0049] In addition, the rational selection and optimization of the promoter can improve the transcription efficiency of the gene, thereby achieving high expression of the target gene. No colonies were observed in the transformation plate of the unoptimized EF-Tu promoter ( Figure 2 ), therefore, we codon-optimized the EF-Tu promoter sequence. Figure 3 This is the Blast alignment result of EF-Tu promoter sequence.

[0050] Example 2

[0051] The pYJB3-EFTu vector was electroporated and transformed into a large number of strains (such as Figure 4 As shown in B). However, no colonies were observed in wild-type Bacillus megaterium (WT), yeast, and Escherichia coli. This indicates that we have obtained positive clones.

[0052] Example 3

[0053] To verify the transcription level, we extracted RNA from the wild type and transformed strains and reverse transcribed to obtain cDNA. Subsequently, PCR amplification was performed using eYFP-F and eYFP-R primers. The results showed that a 750 bp eYFP band appeared in the transformed strain, while this band was not detected in the wild type. This indicates that the pYJB3-EFTu promoter has successfully driven the expression of the target gene eYFP. (As shown in Figure 5 and Figure 6 as shown).

[0054] The above results confirmed that the pYJB3-EFTu vector constructed using the EF-Tu promoter achieved efficient expression in Bacillus megaterium YJB3, verifying the application value of this promoter.

[0055] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A nucleic acid molecule, characterized in that It has: (1) the nucleotide sequence shown in SEQ ID NO: 1; or (2) A nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence shown in (1), and having the same or similar functions as the nucleotide sequence shown in (1); or (3) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (1) or (2).

2. Use of the nucleic acid molecule as claimed in claim 1 as a promoter.

3. A transcription element, characterized in that Comprising the nucleic acid molecule and target gene as described in claim 1 or .

4. The transcription element according to claim 3, characterized in that Cis-acting elements are also included.

5. An expression vector, characterized in that It comprises the nucleic acid molecule according to claim 1 or the transcription element according to claim 3 or 4.

6. A host, characterized in that Transform or transfect the expression vector according to claim 5.

7. The host according to claim 6, characterized in that The transformed or transfected chassis strains include: Bacillus megaterium.

8. Use of the nucleic acid molecule according to claim 1, the transcription element according to claim 3 or 4, the expression vector according to claim 5 or the host according to claim 6 in improving the transformation efficiency of Bacillus megaterium.

Images