Gene LNC003296 related to growth and development of sheep muscle and application of gene LNC003296

Abstract

The invention provides a gene LNC003296 related to growth and development of sheep muscles and application of the gene LNC003296, and belongs to the technical field of functional genes. The invention discloses a gene LNC003296 for regulating and controlling growth and proliferation of sheep myoblasts. The nucleotide sequence of the gene LNC003296 is shown as SEQ ID NO: 1. The gene LNC003296 is differentially expressed in transcriptomes of small-tailed han sheep without ovaries and small-tailed han sheep without ovaries in the same growth period, and the gene LNC003296 is positively regulated to influence expression of growth factors in sheep myoblasts and activity and cell proliferation performance of the sheep myoblasts. Therefore, overexpression of the gene LNC003296 provided by the invention can promote growth and proliferation of the sheep myoblasts, and the gene LNC003296 can be used as a regulation element for regulating the sheep myoblasts, so that a new way is provided for molecular breeding of sheep.

Description

Technical Field

[0001] The invention belongs to the technical field of functional genes, and in particular relates to a gene LNC_003296 related to sheep muscle growth and development and an application thereof. Background Art

[0002] Long noncoding RNA (lncRNA), an RNA molecule with a length between 200 and 100,000 nt, does not encode proteins, but is involved in the regulation of multiple processes within cells. Most lncRNAs have obvious spatiotemporal expression specificity during tissue differentiation and development. For example, some people have studied 1,300 lncRNAs in mice and found that lncRNAs have different expression patterns in different parts of brain tissue. At present, lncRNAs have the function of regulating the ovarian development of sheep, participating in the regulation of male reproductive development, and regulating the hypoxia adaptability of Tibetan sheep. However, there are few reports on lncRNAs related to sheep muscle growth and development. Summary of the invention

[0003] In view of this, the purpose of the present invention is to provide a gene LNC_003296 related to sheep muscle growth and development, so as to achieve the purpose of promoting sheep muscle growth by regulating the growth and proliferation activity of sheep myoblasts.

[0004] The present invention provides a gene LNC_003296 related to sheep muscle growth and development. The nucleotide sequence of the gene LNC_003296 is shown in SEQ ID NO:1.

[0005] The present invention provides a derivative product comprising the gene LNC_003296.

[0006] Preferably, it comprises an overexpression recombinant vector containing gene LNC_003296.

[0007] The present invention provides the application of the gene LNC_003296 or the derivative product in breeding meat-type sheep breeds.

[0008] The present invention provides the use of the gene LNC_003296 or the derivative product in increasing the meat yield of sheep and / or improving the quality of sheep meat.

[0009] The present invention provides an application of a reagent for regulating the expression of the gene LNC_003296 in the preparation of a product that affects sheep meat production and / or affects the proliferation of sheep myoblasts.

[0010] Preferably, the reagent includes the derivative product or a recombinant vector interfering with the expression of gene LNC_003296;

[0011] The siRNA targeting gene LNC_003296 contained in the recombinant vector interfering with the expression of gene LNC_003296;

[0012] The siRNA is obtained by hybridization of DNA fragments with nucleotide sequences as shown in SEQ ID NO: 10 and SEQ ID NO: 11.

[0013] Preferably, the sheep include ewes.

[0014] The invention provides a method for promoting sheep muscle development, and the gene LNC_003296 or the derivative product is expressed in sheep myoblasts.

[0015] The invention provides a method for promoting the growth and / or proliferation of sheep myoblasts, and the gene LNC_003296 or the derivative product thereof is introduced into the sheep myoblasts.

[0016] The present invention provides a gene LNC_003296 related to sheep muscle growth and development, and the nucleotide sequence of the gene LNC_003296 is shown in SEQ ID NO: 1. The present invention analyzes differentially expressed genes by transcriptome sequencing of small-tailed Han sheep with or without ovaries removed at the same growth period, obtains gene LNC_003296, and verifies transcriptome data by RT-qPCR. The results show that the verification result is consistent with the transcriptome data result. The present invention analyzes the effect of overexpression gene LNC_003296 and inhibition gene LNC_003296 on the expression of growth factors (CDK4 and CCND1) in sheep myoblasts by overexpression gene LNC_003296 and inhibition gene LNC_003296. The results show that overexpression gene LNC_003296 promotes the expression of growth factors in sheep myoblasts, while inhibition gene LNC_003296 inhibits the expression of growth factors in sheep myoblasts, indicating that gene LNC_003296 affects the expression of growth factors in myoblasts through positive regulation. At the same time, the present invention also carried out the effects of overexpression gene LNC_003296 and inhibition gene LNC_003296 expression on the growth and proliferation of myoblasts cultured with estradiol. The results showed that overexpression of LNC_003296 can increase the activity of sheep myoblasts and promote cell proliferation, whereas inhibition of LNC_003296 expression can reduce the activity of sheep myoblasts and inhibit cell proliferation. It can be seen that the gene LNC_003296 provided by the present invention can promote the growth and proliferation of sheep myoblasts through positive regulation, can be used as a regulatory element for regulating sheep myoblasts, and provides a new means for sheep molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1To validate transcriptome sequencing results for RT-qPCR;

[0018] Figure 2 This is the result of RT-qPCR detection of the effects of overexpression and interference expression of LNC_003296 on the expression levels of growth factors in sheep myoblasts;

[0019] Figure 3 The figure shows the effect of overexpression and interference expression of LNC_003296 on the expression level of growth factors in sheep myoblasts detected by Western blotting;

[0020] Figure 4 This is the result of CCK-8 detection of the effect of overexpression of LNC_003296 on the activity of sheep myoblasts;

[0021] Figure 5 This is the result of CCK-8 detection of the effect of interference expression of LNC_003296 on the activity of sheep myoblasts;

[0022] Figure 6 This is the result of EdU detection of the effect of overexpression of LNC_003296 on the proliferation of sheep myoblasts. DETAILED DESCRIPTION

[0023]

[0024] In the present invention, the gene LNC_003296 is differentially expressed in the small-tailed Han sheep with and without ovarian removal. The results of the present invention show that the gene LNC_003296 is down-regulated in the small-tailed Han sheep with ovarian removal, and up-regulated in the small-tailed Han sheep without ovarian removal, which is consistent with the trend of keto body weight change. The present invention uses RT-qPCR verification, and the results show that the gene LNC_003296 is highly expressed in the small-tailed Han sheep without ovarian removal, which is completely consistent with the transcriptome sequencing results.

[0025] In the present invention, in order to clarify the relationship between the gene LNC_003296 and sheep growth and muscle development, the present invention explores the effect on myoblast growth by overexpressing the gene LNC_003296 and inhibiting the gene LNC_003296 in sheep myoblasts. The growth factor is shown to be positively correlated with the expression level of the gene LNC_003296 at both the gene and protein levels. At the same time, the results of the activity and proliferation experiments of myoblasts also show that the activity and proliferation ability of myoblasts are positively correlated with the expression level of the gene LNC_003296. Therefore, when the gene LNC_003296 is overexpressed, it is beneficial to promote the growth of myoblasts. Therefore, the gene LNC_003296 can be used as a screening marker or target for screening and detecting meat-type sheep, and can also be used to cultivate new strains of high-meat-type sheep.

[0026] The present invention provides a derivative product comprising the gene LNC_003296.

[0027] In the present invention, the derivative product preferably includes an overexpression recombinant vector of gene LNC_003296, including an agent that promotes the expression of gene LNC_003296. The present invention has no special restrictions on the type of backbone vector of the overexpression recombinant vector of gene LNC_003296, and can use an overexpression vector commonly used in mammalian cells known in the art, such as pcDNA3.1(+) vector. The agent that promotes the expression of gene LNC_003296 preferably includes gene elements such as promoters and enhancers.

[0028] The present invention provides the application of the gene LNC_003296 or the derivative product in breeding meat-type sheep breeds.

[0029] In the present invention, the method for breeding meat-type sheep breeds preferably involves heritably overexpressing the gene LNC_003296 in sheep cells to construct a transgenic sheep breed.

[0030] The present invention provides the use of the gene LNC_003296 or the derivative product in increasing the meat yield of sheep and / or improving the quality of sheep meat.

[0031] In the present invention, the sheep preferably includes small-tailed Han sheep. The sheep preferably includes ewe sheep. The present invention provides a use of an agent for regulating the expression of the gene LNC_003296 in the preparation of a product that affects sheep meat production and / or affects sheep myoblast proliferation.

[0032] In the present invention, the reagent preferably includes the derivative product or the recombinant vector interfering with the expression of gene LNC_003296. The recombinant vector interfering with the expression of gene LNC_003296 contains siRNA targeting gene LNC_003296. In an embodiment of the present invention, the siRNA is obtained by hybridization of DNA fragments with nucleotide sequences such as SEQ ID NO: 10 and SEQ ID NO: 11.

[0033] The derivative product can promote the up-regulation of growth factor in myoblasts through positive regulation, promote the proliferation of myoblasts, and thus increase the meat production of sheep. The recombinant vector that interferes with the expression of gene LNC_003296 inhibits the expression of gene LNC_003296 through siRNA, reduces the expression of myoblast growth factor, inhibits the proliferation of myoblasts, and thus reduces the meat production of sheep.

[0034] In the present invention, the sheep preferably includes ewes. The method for breeding sheep varieties preferably includes detecting the expression level of gene LNC_003296 in the sheep variety to be tested. When the expression level of gene LNC_003296 is upregulated, it indicates that the sheep variety to be tested has the characteristics of muscle development potential and can be used as a parent for breeding sheep varieties. The sheep includes small-tailed Han sheep. The product includes a kit.

[0035] The invention provides a method for promoting sheep muscle development, and the gene LNC_003296 or the derivative product is expressed in sheep myoblasts.

[0036] In the present invention, the method for expressing in sheep myoblasts is preferably to increase the expression of gene LNC_003296 in sheep by heritable and non-heritable means. The heritable means is preferably to integrate gene LNC_003296 into sheep fertilized eggs under the mediation of lentivirus. The non-heritable means preferably includes integrating gene LNC_003296 into sheep cells under the mediation of mammalian vectors or viral vectors for overexpression. The sheep cells preferably include sheep myoblasts.

[0037] The invention provides a method for promoting the growth and / or proliferation of sheep myoblasts, and the gene LNC_003296 or the derivative product thereof is introduced into the sheep myoblasts.

[0038] In the present invention, the introduction into sheep myoblasts can be accomplished by conventional methods in the art, such as lipid transfection.

[0039] The following is a detailed description of a gene LNC_003296 related to sheep muscle growth and development and its application provided by the present invention in conjunction with the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0040] Example 1

[0041] -ΔΔCt The relative expression of experimental data was calculated by t-test and P value was calculated.

[0042] Results Figure 1 RT-qPCR verified the transcriptome sequencing results, and the results showed that the expression level of LNC_003296 in the longissimus dorsi muscle of the Small-tailed Han sheep without ovarian tissue removal was significantly higher than that in the longissimus dorsi muscle of the Small-tailed Han sheep with ovarian tissue removal, which was consistent with the transcriptome sequencing results and the meat production results of the Small-tailed Han sheep.

[0043] Example 2

[0044] Construction method of LNC_003296 overexpression recombinant vector and interference vector

[0045] According to the sequence of LNC_003296, siRNA (si-LNC_003296) was designed to interfere with the expression of LNC_003296 gene, and the sequence is shown in GUCCUCAGCACAAUAGAAUTT (SEQ ID NO: 10), AUUCUAUUGUGCUGAGGACTT (SEQ ID NO: 11). The si-LNC_003296 was used to construct an interference vector, which was recorded as si-LNC_003296 interference vector, and was specifically commissioned to Shanghai Jima Pharmaceutical Technology Co., Ltd. for synthesis.

[0046] BamHI and NotI restriction sites were added to both ends of the DNA fragment of LNC_003296, and cloned into the pcDNA3.1(+) vector by restriction digestion and ligation to obtain the pcDNA3.1-LNC_003296 overexpression vector, which was specifically commissioned to Shanghai Jima Pharmaceutical Technology Co., Ltd. for synthesis.

[0047] Example 3

[0048] LNC_003296 Cell transfection experiment of overexpression recombinant vector and interference vector

[0049] DMEM complete medium was prepared by adding 10% fetal bovine serum, 2% penicillin and streptomycin (100 μg / mL) to the DMEM medium. Sheep myoblasts were cultured at 1×10 6 Cells were inoculated into 6-well plates at a density of 100 cells / well (3 replicates per group), and 2 mL of DMEM complete medium was added to each well. The cells were cultured overnight at 37°C, 5% CO2, and saturated humidity. Before transfection, the original cell culture medium was replaced with 1.5 mL of Opti-MEM. 242 μL of Opti-MEM and 8 μL of pcDNA3.1-LNC_003296 recombinant vector or si-LNC_003296 interference vector at a concentration of 500 ng / μL were mixed to make solution A. 242 μL of Opti-MEM and 8 μL of 2000 was used to make liquid B, and liquid A and liquid B were mixed to form a transfection complex. After incubation at room temperature for 20 minutes, it was added to the cell culture plate to transfect sheep myoblasts. Cultured at 37°C and 5% CO2 saturated humidity, replaced with complete medium after 6 hours, and cells were collected after 48 hours. At the same time, a control group was set up, in which the pcDNA3.1 empty vector (denoted as pcDNA3.1-LNC_003296-NC) replaced the pcDNA3.1-LNC_003296 recombinant vector or the empty interference vector (denoted as si-LNC_003296-NC) replaced the si-LNC_003296 interference vector, and the other steps were the same.

[0050] Example 4

[0051] RT-qPCR and Western blot techniques were used to detect changes in the expression of growth factors (CDK4, CCND1). The total RNA of the four sheep myoblasts constructed in Example 3 was used as a template, and the RT-qPCR reaction system was prepared with CDK4-F (CAACGGAGGAGGTGCTGGAG, SEQ ID NO: 4) / CDK4-R (GAGCCTGACAACATTGGGATGC, SEQ ID NO: 5) and CCND1-F (TTGCTGCTTCCGCCTTGTATC, SEQ ID NO: 6) / CCND1-R (AACCATCCACTTGACACACTTCTC, SEQ ID NO: 7) primers, which were specifically described in Example 1. At the same time, the internal reference gene was GAPDH, and the internal reference primers were GAPDH-F (GCAAGTTCCACGGCACAG, SEQ ID NO: 8) and GAPDH-R (TCAGCACCAGCATCACCC, SEQ ID NO: 9). The RT-qPCR reaction was performed using LightCycler 480II. The reaction procedure was 95°C pre-denaturation for 5 min; 95°C denaturation for 5 s, 60°C annealing for 30 s, for a total of 40 cycles. -ΔΔCt The relative expression of experimental data was calculated by t-test and P value was calculated.

[0052] 2. Protein Extraction and Western Blot Detection

[0053] Use a whole protein extraction kit to extract the total protein of the four types of sheep myoblasts constructed in Example 3. Collect the cultured muscle cells in a 1.5mL centrifuge tube, use a high-speed centrifuge at 4°C, 12000r / min for 30min, collect the supernatant, and discard the precipitate. Determine the BCA standard curve and calculate the protein concentration according to the instructions of the protein concentration determination kit (BCA). According to the protein volume: 5×SDS Loading Buffer=4:1, mix the protein with 5×SDS Loading Buffer and boil it in a metal bath at 100°C for 5min. Add 20μg of protein to each well in BeyoGel Plus PAGE precast gel (Tris-Gly, 10%, 10 wells), 90V, 15min, 120V 50min, and stop when bromophenol blue electrophoresis reaches the bottom of the PAGE precast gel. After the electrophoresis is completed, use 180mA 90min electrophoresis conditions for transfer, and then use QuickBlock TM Western blocking solution was used to block the sample on a shaker at room temperature for 2 hours. Then, different concentrations of primary antibodies (CCND1: proteintech, 26939-1-AP; CDK4: proteintech, 83994-3-RR) were added and blocked overnight at 4°C. The sample was washed with TBST 3 times, 8 minutes each time. After incubation with the secondary antibody at room temperature for 2 hours, the sample was washed again with TBST 3 times, 5 minutes each time. Finally, the sample was developed with an ultra-sensitive ECL chemiluminescent reagent, exposed with the Odyssey CLX imaging system (Li-COR), and photographed and saved. The grayscale value of the bands was analyzed using Image J software, and the ratio of the grayscale value of the target protein to that of GAPDH was the relative expression level of the target protein.

[0054] Results Figure 2 and Figure 3 The expression of LNC_003296 in cells was overexpressed / inhibited, and the expression of growth factors was detected by RT-qPCR and Western blot. The results showed that the expression levels of CDK4 and CCND1 after overexpression of LNC_003296 were significantly higher than those after interfering with the expression of LNC_003296 gene.

[0055] Example 5

[0056] Detection of myoblast cell viability and proliferation

[0057] 1.CCK-8 assay

[0058] First, a cell culture medium was prepared, specifically, 10% fetal bovine serum, 2% penicillin and streptomycin (100 μg / mL) were added to DMEM culture medium to prepare DMEM complete culture medium.

[0059] 2×10 per well 4The sheep myoblasts were inoculated into a 96-well plate filled with DMEM complete medium at a density of 10 μL / 100 μL, with 3 replicates per group, and cultured overnight at 37°C, 5% CO2, and saturated humidity. According to the instructions of the cell counting kit (CCK-8), after transfection with the recombinant vector (or control vector) constructed in Example 2, 10 μL of CCK8 solution was added to each well after the cells grew for 0 h, 6 h, 12 h, 24 h, 48 h, and 72 h, respectively, and the absorbance at 450 nm was measured using an ELISA instrument after incubation in an incubator for 2 h, and then the proliferation rate of the sheep myoblasts was calculated.

[0060] 2. EdU Detection

[0061] The proliferation of sheep myoblasts was detected using the EdU cell proliferation detection kit. 5 Sheep myoblasts were inoculated into 12-well plates at a density of 100 / well, with 3 replicates per group, and cultured for 24 hours at 37°C, 5% CO2, and saturated humidity. According to the instructions of the EdU cell proliferation detection kit, the vector was transfected and cultured for 24 hours. After the cells were in normal state, an equal volume of EdU working solution (10μmol / L) preheated at 37°C was added and incubated for 3 hours. After EdU labeling of cells, the culture medium was removed, and 1mL of immunostaining fixative was added and fixed at room temperature for 15 minutes. Wash with washing solution 3 times, 5 minutes each time. Remove the washing solution, permeabilize each well with 1mL of immunostaining strong permeabilization solution, and incubate at room temperature for 15 minutes. Remove the permeabilization solution, add 1mL of washing solution and wash twice, 3 minutes each time. Incubate with blocking solution at room temperature for 20 minutes, and wash with washing solution 3 times, 2 minutes each time. Add 0.5mL of Click reaction solution to each well, incubate at room temperature in the dark for 30 minutes, and wash with washing solution 3 times, 5 minutes each time. Add 200 μL of Streptavidin-HRP working solution to each well and incubate at room temperature for 30 min. Wash with washing solution 3 times, 2 min each time. Observe under a fluorescence microscope and take photos for record.

[0062] Results Figures 4 to 6 The results of CCK-8 and EdU showed that the cell activity of myoblasts after overexpression of LNC_003296 was significantly higher than that after inhibition of LNC_003296.

[0063] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A gene LNC_003296 related to sheep muscle growth and development, characterized in that: The nucleotide sequence of the gene LNC_003296 is shown in SEQ ID NO:

1.

2. A derivative product comprising the gene LNC_003296 according to claim 1.

3. The derivative product according to claim 2, characterized in that: The invention comprises an overexpression recombinant vector containing gene LNC_003296.

4. Use of the gene LNC_003296 according to claim 1 or the derivative product according to claim 2 or 3 in breeding meat-type sheep breeds.

5. Use of the gene LNC_003296 according to claim 1 or the derivative product according to claim 2 or 3 in increasing the meat production of sheep and / or improving the quality of sheep meat.

6. Use of an agent for regulating the expression of the gene LNC_003296 according to claim 1 in the preparation of a product that affects sheep meat production and / or affects the proliferation of sheep myoblasts.

7. The use according to claim 6, characterized in that: The reagent includes the derivative product of claim 2 or a recombinant vector interfering with the expression of gene LNC_003296; The siRNA targeting gene LNC_003296 contained in the recombinant vector interfering with the expression of gene LNC_003296; The siRNA is obtained by hybridization of DNA fragments with nucleotide sequences as shown in SEQ ID NO: 10 and SEQ ID NO:

11.

8. The use according to any one of claims 4 to 7, characterized in that: The sheep include ewes.

9. A method for promoting muscle development in sheep, characterized in that: The gene LNC_003296 of claim 1 or the derivative product of claim 2 or 3 is expressed in sheep myoblasts.

10. A method for promoting the growth and / or proliferation of sheep myoblasts, characterized in that: The gene LNC_003296 of claim 1 or the derivative product of claim 2 or 3 is introduced into sheep myoblasts.

Images