TuHel31B target gene for preventing and treating tetranychus urticae and application of TuHel31B target gene

Abstract

The invention discloses a TuHel31B target gene for preventing and treating tetranychus urticae and application of the TuHel31B target gene, dsRNA synthesized by the TuHel31B target gene and application of the dsRNA. The nucleotide sequence of the TuHel31B target gene is as shown in SEQ ID NO. 1, and the nucleotide sequence of the dsRNA is as shown in SEQ ID NO. 2; after the TuHel31B is interfered, the egg laying amount of the tetranychus urticae is obviously reduced, and the survival rate is obviously influenced due to abnormal growth and development, so that the prevention and treatment purpose is achieved; the method is convenient to operate, good in effectiveness and sensitivity and high in insecticidal efficiency, has the advantages of being environmentally friendly and the like, and has a good application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of agricultural biotechnology and relates to the prevention and control of agricultural pest mites based on RNAi technology, and specifically to a target gene for preventing and controlling two-spotted spider mites. TuHel31B and its applications. Background Art

[0002] The two-spotted spider mite belongs to the genus Tetranychus of the family Tetranychidae. It is a worldwide pest mite that mainly harms fruit trees, greenhouse vegetables and other crops and cash crops. It is small in size, has strong reproductive capacity and spreads quickly. Long-term use of chemical pesticides for prevention and control has led to its strong resistance.

[0003] RNA interference (RNAi), also known as RNA silencing, is a biological phenomenon in eukaryotic organisms that is induced by double-stranded RNA (dsRNA) or siRNA (small interfering RNA) or miRNA (microRNA), which efficiently and specifically degrades or inhibits the expression of homologous mRNA, thereby preventing the translation of target gene protein. RNAi can be used to interfere with the normal growth of target pests, reduce damage to host plants, and ultimately achieve the purpose of controlling pests and protecting plants.

[0004] RNAi technology has great potential in agricultural pest control. At present, companies such as Bayer and Syngenta have developed a number of RNAi-based pest control products. MON87411 also obtained the GMO biosafety certificate (import and food / feed use) issued by the Ministry of Agriculture and Rural Affairs of China in 2021. In particular, in October 2022, the world's first RNA insecticide obtained the English common name Ledprona temporarily approved by the International Organization for Standardization Technical Committee on Pesticide Common Names, which is a milestone for spray-type RNAi biological insecticides to move towards production and application. RNAi technology has great potential for the control of spider mites, but there are currently few reports on the research on the gene function of the two-spotted spider mite and its target genes for insecticidal activity at home and abroad.

[0005] Preliminary tests have shown that the toxicity to two-spotted spider mites can be achieved by soaking eggs with a suitable exogenous dsRNA solution. Therefore, it is easy to use and low-cost to develop exogenous dsRNA products suitable for the prevention and control of two-spotted spider mites from a genetic level. Moreover, due to the specificity of the gene, it can achieve precise and excellent control effects, is environmentally friendly, and has great application prospects in the prevention and control of two-spotted spider mites. However, the screening of relevant target genes and the design of dsRNA with good control effects, specificity, and stability are the biggest challenges and key issues. Summary of the invention

[0006] The present invention overcomes the defects and shortcomings of the existing two-spotted spider mite control technology and provides a method for controlling two-spotted spider mites. TuHel31B Target gene and its application, dsRNA synthesized therefrom and application of dsRNA.

[0007] In order to achieve the above object, the present invention is implemented through the following technical solutions.

[0008] A method for preventing and controlling two-spotted spider mites TuHel31B The target gene is interfered with, resulting in abnormal growth and development and death of the mite, and a significant decrease in the amount of eggs laid by adult mites. TuHel31B The nucleotide sequence of the target gene is shown in SEQ ID NO.1.

[0009] A method for preventing and controlling two-spotted spider mites TuHel31B The target gene is interfered with, resulting in abnormal growth and development and death of the mite, and a significant decrease in the amount of eggs laid by adult mites. TuHel31B The target gene is used as a template to synthesize dsRNA, and the nucleotide sequence of the dsRNA is shown in SEQ ID NO. 2.

[0010] The preparation of the dsRNA comprises the following steps: S1, using the cDNA sequence of two-spotted spider mite as a template, synthesized TuHel31B Gene fragments; S2, TuHel31B The gene fragment was used as a template to design a primer sequence pair containing the T7 promoter sequence; S3, obtaining a dsRNA synthesis template by PCR amplification; S4. Synthesize dsRNA in vitro.

[0011] The S1 is specifically: TuHel31B The primer pair was designed based on the DNA sequence of the gene, and the cDNA sequence of the two-spotted spider mite was used as a template for PCR amplification to obtain TUHEL31B Gene fragment.

[0012] The present invention also discloses TuHel31B The application of the target gene or the dsRNA includes any of the following: 1) TuHel31B Use of the target gene or the dsRNA in controlling two-spotted spider mites; 2) TuHel31B Use of the target gene or the dsRNA in preventing pests of two-spotted spider mites and / or preparing products for preventing and controlling two-spotted spider mites; 3) The application of the TuHel31B target gene or the dsRNA in promoting the death of two-spotted spider mites and / or preparing products that promote the death of two-spotted spider mites. The application refers to reducing the egg-laying amount of adult two-spotted spider mites, thereby reducing their reproductive capacity. The experimental results show that after soaking in dsTuHel31B solution, a strong RNAi effect can be caused in the two-spotted spider mite, resulting in a significant decrease in the expression of the TuHel31B gene in the body, which in turn leads to the death of the two-spotted spider mite and can inhibit reproductive capacity, thereby achieving the purpose of preventing and controlling the two-spotted spider mite.

[0013] The present invention mainly solves the problems of environmental pollution, enhanced pest resistance and impact on non-target organisms in the process of traditional chemical pesticides in the control of two-spotted spider mites. By using gene silencing technology, especially targeting the TuHel31B The design and synthesis of dsRNA based on the gene provides a more environmentally friendly, efficient and specific pest control method. The focus is on the effect of dsRNA (double-stranded RNA) on the control of two-spotted spider mites. The phenotypic response and survival and reproductive ability of the pests after silencing the gene by dsRNA targeting are changed. The main difficulty lies in the effect of dsRNA fragments on the two-spotted spider mites. TuHel31B Highly efficient and specific targeted gene silencing.

[0014] The invention discloses a method for preventing and controlling two-spotted spider mites TuHel31B The beneficial effects of the target gene and its application compared with the prior art are: The present invention utilizes TuHel31B Genetic control of two-spotted spider mites, through TuHel31B Gene synthesis of dsRNA for the control of two-spotted spider mites, which can target and silence the above TuHel31B The eggs are soaked in dsRNA solution to allow dsTuHel31B to enter the two-spotted spider mite. This dsRNA can silence / inhibit the two-spotted spider mite. TuHel31B Gene expression promotes the death of two-spotted spider mites, thereby achieving the purpose of preventing and controlling two-spotted spider mites.

[0015] The present invention screened and obtained a lethal gene of two-spotted spider mite ( TuHel31B ), and developed its highly efficient silencing dsRNA, which can achieve efficient control of two-spotted spider mites, using the lethal effect of dsRNA on two-spotted spider mites to achieve the purpose of control. This method is easy to operate, has good effectiveness and sensitivity, high insecticidal efficiency, and is environmentally friendly, and has many advantages, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The effect of immersing eggs in dsTuHel31B solution on the phenotype of Tetranychus urticae in Example 2, H 2O is the blank control, dsGUS is the negative control, and dsTuHel31B is the two-spotted spider mite treatment group; Figure 2 The effect of soaking eggs in dsTuHel31B solution on the mortality of spider mites in Example 2. Lowercase letters represent significant differences. Figure 3 After the eggs were soaked in dsTuHel31B and dsGUS solution in Example 2, the two-spotted spider mite TuHel31B The changes in gene expression levels, lowercase letters represent significant differences. DETAILED DESCRIPTION

[0017] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present invention clearer, the present invention is further described in detail in conjunction with the embodiments and the accompanying drawings. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. The technical solutions of the present invention are described in detail below in conjunction with the embodiments and the accompanying drawings, but the scope of protection is not limited thereto.

[0018] Unless otherwise specified, the reagents, methods and equipment used in the following examples are conventional reagents, methods and equipment in the art. Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0019] The spider mites used in the following examples were raised by the College of Plant Protection of Shanxi Agricultural University. The spider mites were inoculated on peach seedlings and placed in an artificial climate box (temperature 25±1°C, humidity 50%-60%, photoperiod L:D=16:8) for reproduction (can be provided free of charge for external scientific experiments).

[0020] RNA was extracted using the TRIzol extraction method (Invitrogen, USA). The reverse transcription reagent (PrimeScriptTM RTreagent Kit with gDNA Eraser) was purchased from TAKARA Biotechnology Co., Ltd., the dsRNA synthesis kit (T7RiboMAX™ Express RNAi System) was purchased from Promega, USA, the kit used for the PCR reaction system (GoTaq® Green Master Mix) was purchased from Promega, USA, and the DNA purification and recovery kit (Universal DNA Purification Kit) was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0021] The data processing method of the following embodiment is as follows: the results of the bioassay of spider mites were analyzed by the egg immersion method, the mortality of spider mites was counted on the 12th day (the second day of adult mites) starting from the 0th day of the egg, and the data were subjected to T test using SPSS19.0 software. The expression of the target gene was analyzed on the 8th day (molting from the anterior nymph to the posterior nymph), the qPCR data were calculated using the 2-△△Ct method (Ct represents the number of cycles), and the data were subjected to T test using SPSS 19.0 software. Example

[0022] Two-spotted spider mite growth and development related genes TuHel31B acquisition and utilization TuHel31B Gene synthesis of dsRNA (dsTuHel31B) According to the transcriptome library of Tetranychus urticae, we screened TuHel31B Gene fragment, such as SEQ ID NO. 1.

[0023] SEQ ID NO. 1 1. Extraction of total RNA from Tetranychus urticae and synthesis of the first-strand cDNA.

[0024] 100 adult spider mites were placed in a 1 mL centrifuge tube, and the total RNA of the spider mites was extracted using the TRIzol method. The concentration and quality of RNA were determined using NanoDrop OneC, and reverse transcription was performed using a reverse transcription kit (PrimeScript™ RTreagent Kit with gDNA Eraser, TAKARA) according to the instructions to synthesize the first chain of cDNA.

[0025] 2. Primer design The transcriptome data of spider mites obtained by our research group were used to screen the two-spotted spider mites. TuHel31B The NCBI primer design software Primer-BLAST (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ) was used to design the primers for the gene sequences. TuHel31B Gene dsRNA primer P (Table 1), β-glucuronidase gene ( GUS ) from laboratory-stored GUS The dsRNA primer P2 of GUS gene (Table 1) was used to amplify the target gene. TuHel31B , internal reference gene TuCycA qPCR primers P and P4 (Table 1).

[0026]

[0027] 3. Kit synthesis TuHel31B dsRNAs of β-actin and GUS PCR amplification was performed using primers P1 and P2 in Table 1. The reaction system for PCR amplification was RNase Free water 9.5 μL, Go Taq® Green Master Mix 12.5 μL, 10 μM forward primer 1 μL, 10 μM reverse primer 1 μL, and cDNA / GUS plasmid 1 μL. The reaction program for PCR amplification was 94°C pre-denaturation for 3 min; 94°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 1 min, for a total of 30 cycles; 72°C extension for 5 min. The amplified product was stored at 4°C. After the program reaction was completed, the amplification results were detected by agarose gel electrophoresis.

[0028] The two PCR products obtained above were purified using a DNA purification recovery kit (Universal DNA Purification Kit, TIANGEN) and used as templates for in vitro transcription of dsRNA. The in vitro transcription system of dsRNA was Template DNA 1000 ng, Enzyme Mix, T7 Express 2 μL, RiboMAX™ Express T7 2× Buffer 10 μL, and Nuclease free water was added to make up to 20 μL. After flicking and spinning, the following reaction was carried out in a water bath: incubation at 37 °C for 4 hours, 70 °C for 10 min, and 25 °C for 20 min. After the reaction, 1 μL DNAase and 1 μL RNAase were added, and after incubation at 37°C for 30 min, 2.2 μL sodium acetate solution and 24.2 μL isopropanol were added, and the dsRNA was fully precipitated at -20 °C overnight. The next day, the supernatant was removed after centrifugation at 14000 g for 10 min. The precipitate was washed twice with 75% ethanol and centrifuged to obtain dsRNA. The alcohol in the tube was removed by blowing in the clean bench and dissolved in Nuclease free water. The integrity was detected by 1.5% agarose gel electrophoresis, and the quantification was performed using NanoDrop 2000. The final concentration was diluted to 250 ng / μL, and dsTuHel31B and dsGUS were obtained respectively. The dsRNA bands were verified by 1.5% agarose gel electrophoresis, and the dsRNA was stored in a -80°C refrigerator.

[0029] SEQ ID NO: 2 TTTGGACGAAGCTGACAAGCTACTTTCGCAAGACTTTAACGCTATGCTGGACTCGTTAATTTCCTATTGTCCCAAAGACAGGCAAATCTTGATGTTTTCAGCTACATTTCCTCTCACAGTGGAAAATTTCATGAAAAAACATCTTCACGATCCATATGAGCTAAATCTTATGGAAGAGTTGACCCTTAAAGGAGTAACTCAATATTACGCATTTGTCCAGGAACGTCAAAAAGTGCATTGTCTAAACACTTTATTTTCAAAGTTACAGATCAACCAATCCATCATATTCTGTAATTCAACCCAAAGAGTTGAACTTTTGGCAAAAAAGATTGCTGAACTTGGGTATTCATGTTACTACATTCATGCGAAAATGTCTCAACCTCATCGTAATAGAGTATTTCATGACTTTAGAAGCGGTCTCTGCCGTAATCTGGTCTGC Example

[0030] Lethal effect of dsRNA (dsTuHel31B) on Tetranychus urticae 1. Test method Peach leaves were cut into leaf discs with a diameter of 17 mm using a hole puncher and washed 5 times with nuclease-free water. 30-50 female adult mites were moved to the leaf discs. After the female adult mites laid 30-50 eggs, they were removed and 20 μL dsRNA (250 ng / μL) Tween solution (dsRNA was evenly mixed in the Tween solution to make the final concentration of the Tween solution 0.005%) was evenly applied to all spider mite eggs using a pipette to completely immerse the spider mite eggs in the dsRNA Tween solution. After the spider mite eggs hatched, they continued to be raised on the peach leaf disc, and GUS was used as a negative control. The leaf discs were placed on 0.25% agar gel to keep them moist and prevent the two-spotted spider mites from escaping. The spider mites on the 4th day after hatching (at this time, they were in the molting stage from the front nymph to the back nymph) were collected for detecting the expression of the target gene. Spider mites on the 8th day after hatching (at this time, they were on the 2nd day of adulthood) were used to count the biological changes of spider mites. Three replicates were set up for each group. After dsRNA treatment, they were placed in an artificial climate box (temperature 25±1℃, humidity 50%-60%, photoperiod L:D=16:8). The number of deaths of spider mites in each replicate of each group was counted, and the mortality rate of spider mites under dsRNA and control group treatments was calculated. On the 2nd day of female adulthood, 10 female adult mites were randomly selected from each replicate of each treatment group and raised individually on a 17mm leaf tray to lay eggs. The final number of eggs was recorded, and the average egg laying amount of each female adult mite was counted.

[0031] 2. Test results According to the statistical results, the two-spotted spider mites treated with dsTuHel31B showed a melanization phenotype compared with the control group ( Figure 1 ), the mortality rate of spider mites increased significantly to 60.90% ( Figure 2 The reproductive capacity was significantly reduced. The average number of eggs laid by each female two-spotted spider mite in the dsTuHel31B treatment group was 25.3, while that in the dsGUS control group was 39.30, indicating that dsTuHel31B can induce a strong RNAi effect in the body of the two-spotted spider mite, leading to the death of the two-spotted spider mite and the decrease of reproductive capacity. Example

[0032] dsRNA (dsTuHel31B) inhibits the two-spotted spider mite TuHel31B Gene expression 1. Experimental methods 200 spider mites on the 4th day after hatching (at this time, they were in the molting stage from prenymph to postnymph) were collected to detect the expression of target genes, and 3 biological replicates were collected for each treatment. RNA of two-spotted spider mites was extracted and collected, and then 1 μg of total RNA was reverse transcribed into cDNA and diluted 10 times as a template for qPCR. Relative quantitative qPCR analysis was performed using P3 and P4 as primers. The qPCR system included RNase Free water 7.76 μL, 2×SYBR Green 10 μL (SYBR® Green RealtimePCR Master Mix), 10 μM forward primer 0.32 μL, 10 μM reverse primer 0.32 μL, and cDNA template 1.6 μL. The qPCR reaction instrument was Bio-Rad C1000Real-Time PCR system (BIO-RAD, USA). The reaction conditions were 95°C for 30 s; 40 cycles of 95°C for 5 s, 60°C for 30 s, and three technical replicates were analyzed for each biological replicate.

[0033] 2. Experimental results After the eggs were treated with dsTuHel31B solution, the TuHel31B The relative expression of the gene decreased by 64.59% ( Figure 3 ), indicating that immersion treatment with dsTuHel31B solution can cause a strong RNAi effect in the two-spotted spider mite, resulting in a significant decrease in the expression level of the TuHel31B gene in the body, thereby leading to the death of the two-spotted spider mite or inhibiting reproduction.

[0034] The above example is based on the transcriptome library of Tetranychus urticae, and screens out a gene that is highly lethal and affects reproduction: TuHel31B genes, and developed the use of TuHel31B The technology of controlling the two-spotted spider mite by soaking the eggs with dsRNA of the gene (dsTuHel31B). In this example, the eggs of the two-spotted spider mite were soaked in 20 μL of dsTuHel31B and dsGUS solution synthesized by the kit until the solution was absorbed and dried. The eggs were left on the peach leaves until they hatched, and the mortality rate of the two-spotted spider mite was observed and recorded. Finally, the fluorescence quantitative PCR (qPCR) method was used to detect and analyze the TuHel31B The expression level of the gene in two-spotted spider mites after treatment with dsTuHel31B and dsGUS. The results showed that the eggs soaked in exogenous dsTuHel31B solution had a very obvious lethal effect on two-spotted spider mites.

[0035] The above content is a further detailed description of the present invention in combination with a specific preferred embodiment. It cannot be determined that the specific embodiments of the present invention are limited to this. For ordinary technicians in the technical field to which the present invention belongs, several simple deductions or substitutions can be made without departing from the present invention, which should be regarded as belonging to the present invention and the scope of patent protection determined by the submitted claims.

Claims

1. A method for preventing and controlling two-spotted spider mites TuHel31B Target gene, the TuHel31B The nucleotide sequence of the target gene is shown in SEQ ID NO.

1.

2. A dsRNA for controlling two-spotted spider mite, using the TuHEL31B The target gene synthesizes dsRNA, the nucleotide sequence of which is shown in SEQ ID NO. 2; the preparation of the dsRNA comprises the following steps: S1. Using the cDNA sequence of Tetranychus urticae as a template, design primer pairs, perform PCR amplification, and synthesize TuHel31B Gene fragments; S2, TuHel31B The gene fragment was used as a template to design a primer sequence pair containing the T7 promoter sequence; S3, obtaining a dsRNA synthesis template by PCR amplification; S4. Synthesize dsRNA in vitro.

3. A kind of TuHel31B Application of dsRNA of a target gene, the application comprising any of the following: 1) TuHel31B Use of the target gene or the dsRNA in controlling two-spotted spider mites; 2) TuHel31B Use of the target gene or the dsRNA in preventing pests of two-spotted spider mites and / or preparing products for preventing and controlling two-spotted spider mites; 3) Use of the TuHel31B target gene or the dsRNA in promoting the death of two-spotted spider mites and / or preparing products that promote the death of two-spotted spider mites; the use refers to reducing the amount of eggs laid by adult two-spotted spider mites, thereby reducing their reproductive capacity.

Images