Preparation method and application of biosensor for catalyzing hairpin assembly cascade amplification based on PDA-SiO2 nanoparticles

Abstract

The invention relates to the technical field of biomedical detection, in particular to a preparation method and application of a biosensor for catalyzing hairpin assembly cascade amplification based on PDA-SiO2 nanoparticles. F-B-H1 and H2 free hairpin DNA probes of a 3 '-end fluorescence receptor (BHQ-1) are attached to the surfaces of the PDA-SiO2 nanoparticles, so that a PDA-SiO2 nanoparticle-based catalytic hairpin (CHA) probe is assembled through Van der Waals force between the PDA-SiO2 nanoparticles and a suspended single-chain part of the hairpin DNA probes. Based on target trigger signal amplification and the strong fluorescence quenching capability of PDA-SiO2, the method is used for ultrasensitively and conveniently monitoring CT-DNA in living cells; by integrating the PDA-SiO2 nano particles and the CHA technology, the low detection limit of the CT-DNA is realized.

Description

Technical Field

[0001] The present invention relates to the field of biomedical detection technology, and in particular to a method for preparing a biosensor based on catalytic hairpin assembly cascade amplification of PDA-SiO2 nanoparticles and its application. Background Art

[0002] Cancer is also called malignant tumor. The cause of cancer is not fully understood. It is mainly manifested in abnormal differentiation and proliferation of cells, and has biological characteristics such as invasiveness and metastasis. The number of people who died from cancer accounts for 23.91% of all deaths. In addition, in the past decade, the incidence of cancer has increased by about 3.9% each year, and the mortality rate of cancer has increased by about 2.5% each year. Nowadays, cancer is one of the major public health issues that seriously threaten the health of the Chinese population.

[0003] However, statistics released by the American Cancer Society show that in the United States, the incidence and mortality of cancer have been on a downward trend in the past 20 years. The reason is that, against the backdrop of an increasing global cancer incidence, the incidence of cancer in the United States has been on a downward trend, and the widespread promotion of early cancer screening has played an important role. For example, breast cancer detected in the early stages through mammography and other detection methods has a five-year survival rate of 98.8% through treatment. If it is diagnosed in the late stages, the five-year survival rate drops sharply to 26.3%. Therefore, early diagnosis of cancer plays an important role in the diagnosis and treatment of cancer;

[0004] During the process of cancer cell proliferation, cancer cells will produce or stimulate non-cancer cells to produce a type of substance that marks the existence and growth of cancer cells, which is called cancer marker. By detecting cancer markers, cancers without solid tumors can be detected. A variety of cancer markers have been discovered, such as: epidermal growth factor receptor (EGFR), microRNA (miRNA), circulating tumor cells, circulating tumor DNA, prostate-specific antigen (PSA), carcinoembryonic antigen (CEA), human epidermal growth factor receptor 2 (HER2), tumor suppressor p53, alpha-fetoprotein (AFP), GSH, etc.

[0005] Circulating tumor DNA (ctDNA) is a free DNA molecule released into the blood by tumor cells and is part of circulating cell-free DNA (cfDNA). The mechanism generally accepted by researchers is that apoptotic and necrotic tumor cells release their fragmented DNA molecules into the blood circulation, thereby forming ctDNA. Since ctDNA originates from tumor cells, it carries genetic variation information of various tumors, such as microsatellite variation, single nucleotide variation, DNA methylation, and chromosome copy number variation. In addition, ctDNA exists in peripheral blood and can be extracted from plasma, so ctDNA is easy to obtain and minimally invasive to patients. Secondly, the half-life of ctDNA is very short, only 114 minutes, so the concentration of ctDNA in the blood can reflect the dynamic changes of the tumor in real time. Therefore, it is important to establish a rapid and sensitive method to detect CT-DNA. Based on this, researchers have developed a large number of DNA detection methods, such as colorimetric analysis, electrochemical analysis, surface enhanced Raman scattering, and fluorescence analysis. Among the above analysis methods, the fluorescence method has the advantages of easy operation, short time consumption, and low detection limit. Therefore, it has great application value in detecting CT-DNA.

[0006] Silica nanoparticles are an important class of nanomaterials with advantages such as simple preparation and separation, controllable size, large surface area, high biocompatibility and low toxicity. They have received extensive attention in recent years. These superior properties make SiO2 nanoparticles and their composites very competitive in application fields such as surface coatings, nanocomposites, drug carriers, and antibacterial materials. However, due to the lack of functional groups on the surface of SiO2 nanoparticles, their application is limited to a certain extent. In order to solve this problem, surface functionalization of SiO2 nanoparticles has been proposed. From another perspective, pure SiO2 nanoparticles are a class of optically transparent materials and cannot be used as fluorescence quenching materials for fluorescent DNA sensors. Therefore, it is necessary to surface modify SiO2 nanoparticles so that they have the ability of fluorescence quenching nanomaterials. Dopamine (DA) can be oxidatively polymerized under alkaline conditions to form a polydopamine (PDA) coating on the surface of the substrate material. Compared with other surface modification strategies, DA self-polymerization has the advantages of simple preparation method, good environment (room temperature), and good water solubility. However, there are few reports combining DNA amplification technology with dopamine-coated silica for cell fluorescence imaging.

[0007] The present invention uses PDA-modified SiO2 nanoparticles as fluorescence quenchers to prepare fluorescent DNA sensors. Under mild conditions, the surface of SiO2 nanoparticles is modified by using a PDA coating to simply synthesize PDA-SiO2 nanoparticles (PDA-SiO2 NPs). The PDA-SiO2 composite material has good water dispersibility, good biocompatibility and strong adsorption capacity. In addition, the PDA-SiO2 composite material is a nanomaterial that quenches fluorescence well, and this fluorescence quenching ability can be attributed to π-π stacking interaction. The present invention uses catalytic hairpin self-assembly technology to design hairpin structures FB-H1 and H2, and the hairpin DNA can be adsorbed on the surface of PDA-SiO2 NPs. Due to the fluorescence quenching effect of dopamine and the FRET between the BHQ-1 group modified by the H1 hairpin structure and FAM, the FAM fluorescence is quenched. However, when CT-DNA exists, the hairpin structure is opened to form dsDNA. Since the helical structure has a weak adsorption capacity for PDA-SiO2 NPs, the fluorescence is restored. Therefore, the proposed strategy can detect CT-DNA in serum simply and quickly.

[0008] The existing Chinese patent document CN201810275117.9 discloses a photoelectrochemical immunosensor for detecting CA125 and its preparation method and application. It uses the principle that PDA can quench the fluorescence of CdTe on the electrode substrate, uses the SiO2@PDA nanocomposite formed by dopamine DA self-polymerization deposition and wrapping SiO2 as the probe molecule, and CdTe as the photoelectric active substance to construct a photoelectrochemical immunosensor to detect tumor markers. The method of preparing a photoelectrochemical immunobiosensor for tumor marker detection using SiO2@PDA nanocomposite by the present invention has the characteristics of simple operation, low technical requirements, low price and easy miniaturization compared with traditional enzyme-linked immunosorbent and traditional optical methods. The fluorescence quencher SiO2@PDA used can increase the load of biological molecules and amplify the signal.

[0009] The existing Chinese patent document 202010450097.1 discloses a CHA-SERS biosensor for lead ion detection, its preparation method and application. The CHA-SERS biosensor uses single crystal silicon modified with silver nanoparticles as the SERS substrate, introduces CHA and DNAzyme into the system, thereby shortening the distance between the Raman signal molecule and the surface of the SERS substrate to achieve the effect of signal amplification. The CHA-SERS biosensor prepared by the present invention has high sensitivity, a minimum detection concentration of 0.42 pM, and good selectivity, and shows good specificity for other heavy metal ions. At the same time, it also expands the application scope of SERS biosensors and has good application prospects.

[0010] The above-mentioned reference document discloses the H1 and H2 hairpin structures, which are similar to the hairpin structure of the present technical solution. The working principle of the reference document is: introducing CHA signal amplification reaction in the SERS biosensor, 2+ In the presence of Pb 2+ Specific catalysis of Pb 2+ -Specific DNAzyme digestion reaction, the released initiator chain rS1 partially hybridizes with the stem end region sequence of the hairpin probe H1 fixed on the SERS active substrate to form an unstable intermediate rS1-H1, and at the same time, the H1 hairpin is opened, and the H1 probe is exposed to open the sequence of the hairpin probe H2, thereby hybridizing with the complementary sequence of the hairpin probe H2 marked with the Raman signal molecule R6G at one end. Since the hybridization energy of H1 and H2 is higher than the hybridization energy of H1 and rS1, H2 hybridizes with H1 through chain displacement to form a stable double-stranded structure H1-H2, and releases the initiator chain rS1. The released rS1 can trigger the next round of CHA, thereby promoting the generation of more H1-H2 double-stranded structures, thereby achieving the effect of signal amplification and improving the detection sensitivity.

[0011] Apoptotic and necrotic tumor cells release their fragmented DNA molecules into the blood circulation to form CT-DNA. CT-DNA exists in peripheral blood and can be extracted from plasma, so CT-DNA is easy to obtain and minimally invasive to patients. The half-life of CT-DNA is very short, only 114 minutes, so the concentration of CT-DNA in the blood can reflect the dynamic changes of the tumor in real time.

[0012] The present invention uses PDA-modified SiO2 nanoparticles as a fluorescence quencher to prepare a fluorescent DNA sensor. Using CHA as an amplification technology, a sensitive and simple DNA fluorescence analysis method based on PDA-SiO2NPs is established. In the absence of target CT-DNA, the hairpin structures FB-H1 and H2 are adsorbed on the surface of PDA-SiO2NPs through π-π stacking, the BHQ-1 group modified by the H1 hairpin structure and FAM FRET, FAM fluorescence quenching, and the fluorescence quenching effect of PDA-SiO2NPs further reduces the background of fluorescence detection. When the target CT-DNA exists, the CT-DNA hybridizes with the sticky end stem part of the hairpin structure H1, and the hairpin nanostructure of H1 is opened to produce a sticky end that is partially complementary to H2. Finally, due to more base complementarity between H2 and H1, the CT-DNA is replaced. The released CT-DNA will trigger the next round of hybridization. In this case, a single CT-DNA can cause the generation of a large number of double-stranded nanostructures, and the double-stranded DNA is released from the PDA-SiO2 nanoparticles, resulting in significant fluorescence enhancement. Therefore, the proposed strategy can simply and quickly detect CT-DNA in serum. In addition, the signal amplification technology can achieve low background signal interference and high sensitivity detection research by combining it with PDA-SiO2 nanoparticles. More importantly, this method significantly improves the specificity of detection. Compared with detection methods such as SERS, fluorescence detection is more conducive to the subsequent detection of targets in cells and in vivo. Summary of the invention

[0013] The purpose of the present invention is to provide a method for preparing a biosensor based on catalytic hairpin assembly cascade amplification of PDA-SiO2 nanoparticles (PDA-SiO2 NPs) and its application, which is used for ultra-sensitive and convenient monitoring of CT-DNA in living cells based on target trigger signal amplification and the powerful fluorescence quenching ability of PDA-SiO2; by integrating PDA-SiO2 nanoparticles and CHA technology, a low detection limit for CT-DNA is achieved.

[0014] In order to achieve the above technical objectives and the above technical effects, the present invention is implemented through the following technical solutions:

[0015] A method for preparing a biosensor for catalytic hairpin assembly cascade amplification based on PDA-SiO2 nanoparticles, comprising: attaching a FB-H1 / H2 free hairpin DNA probe with a 5'-end modified fluorophore (FAM) and a 3'-end fluorescent receptor (BHQ-1) to the surface of the PDA-SiO2 nanoparticles, so as to assemble a catalytic hairpin (CHA) probe based on the PDA-SiO2 nanoparticles through the van der Waals force between the PDA-SiO2 nanoparticles and the overhanging single-stranded part of the hairpin DNA probe, wherein the nucleotide sequence of the FB-H1 is shown in SEQ ID NO. 1, and the nucleotide sequence of the H2 is shown in SEQ ID NO. 2.

[0016] Further, the synthesis method of the PDA-SiO2 nanoparticles comprises:

[0017] Quickly add 7.5 mL of ammonia water, 27.5 mL of ethanol, 22.5 mL of ultrapure water, and 2.5 mL of TEOS into a mixed solution and stir at room temperature for 6 h; then, centrifuge the white suspension at 4200 r / min for 5 minutes and wash it several times with ultrapure water until the solution is neutral. Finally, dry the solution in a vacuum oven at 60°C to obtain white SiO2 powder.

[0018] White SiO2 powder (50 mg) was dispersed in 15 mL ultrapure water by ultrasonication, and Tris solution was added to adjust the pH to 9. 30 mg of dopamine hydrochloride was dissolved in 10 mL ultrapure water and added to the above solution. After reacting at room temperature for 10 h, the black suspension was centrifuged at 4500 r / min for 5 min and washed several times with ultrapure water until the solution was neutral, and dried in a vacuum oven at 60 °C to obtain PDA-SiO2 NPs.

[0019] On the other hand, the present invention provides a biosensor based on catalytic hairpin assembly cascade amplification of PDA-SiO2 nanoparticles prepared by the above method.

[0020] On the other hand, the present invention proposes the application of the above-mentioned biosensor based on catalytic hairpin assembly cascade amplification of PDA-SiO2 nanoparticles in CT-DNA detection.

[0021] In a PBS buffer (1X PBS 7.4) containing 25nM FB-H1, 25nM H2 and 700nM CT-DNA, the reaction was carried out at 30℃ for 15min, and then 150µg / ml PDA-SiO2 NPs were added for fluorescence detection. Fluorescence detection was performed using a F-7000 fluorescence spectrophotometer, with the excitation wavelength set to 485 nm and the emission spectrum recorded at 500 ~ 600 nm.

[0022] CHA results were detected by 12% polyacrylamide gel electrophoresis. Then, electrophoresis was run at 80 V for 120 min in 1xTBE buffer (88 mM Tris-acetate, 2 mM EDTA, pH 8.0). After GeneRed staining, the gel was imaged using GBOX-F3-E (GeneCompany Limited, USA).

[0023] Furthermore, the application includes fluorescence determination of CT-DNA and content determination of CT-DNA.

[0024] Furthermore, the fluorescence determination of CT-DNA specifically includes: adding FB-H1, H2, and PDA-SiO2 NPs to a buffer solution of PBS (1X PH 7.4) containing CT-DNA, reacting at 30°C for 15 minutes, exciting the fluorescence of FAM at 480nM, measuring the fluorescence emission spectrum in the range of 500~600nM, and setting the slit to 10nM; the parameters of the F-7000 fluorescence spectrophotometer are selected as follows: Scan Speed: 1200, Ex Slit: 5, Em Slit: 10, PMT Voltage: 700V.

[0025] Furthermore, the reaction concentration of FB-H1 and H2 was 1:(0.5-2.5).

[0026] Furthermore, FB-H1 and H2 were 25 nM, and PDA-SiO2 NPs were 150 µg / mL.

[0027] Furthermore, the CT-DNA content determination includes:

[0028] The prepared PDA-SiO2 NPs-based CHA probe was reacted with different concentrations of target ctDNA at 30°C for 15 min, and the fluorescence was measured on a F-7000 fluorescence spectrophotometer. The excitation wavelength of FAM was 480 nm, and the emission fluorescence at 520 nm was recorded to detect the concentration of ct-DNA.

[0029] Further, specifically: in the presence of 25nM FB-H1, 25nM H2 and (0, 0.5nM, 1nM, 2nM, 4nM, 6nM, 8nM, 10nM, 14nM, 16nM, 20nM, 25nM) CT-DNA, in PBS buffer (1X PBS 7.4), react at 30°C for 15min, then add 150µg / mL PDA-SiO2 NPs for fluorescence detection. Fluorescence detection was performed using a F-7000 fluorescence spectrophotometer, with the excitation wavelength set to 485 nm, the emission spectrum recorded at 500 ~ 600 nm, and the parameters selected were: Scan Speed: 1200, ExSlit: 5, Em Slit: 10, PMT Voltage: 700V. A standard curve was made with different CT-DNA concentrations as the horizontal axis and the peak fluorescence intensity at 520 nm as the vertical axis. A good linear relationship was obtained when the CT-DNA concentration ranged from 0 pM to 10.00 nM. The regression equation was ΔF = 33.66 (nM) + 632.69 (R2 = 0.995, n = 3). The detection limit was calculated to be 225 pM (LOD = 3σ / S). The results are comparable to or even lower than some enzyme-free DNA nanoassembly strategies for CT-DNA analysis listed in Table S2.

[0030] Beneficial effects of the present invention:

[0031] The present invention utilizes the excellent fluorescence quenching ability of PDA-SiO2 nanoparticles and catalytic hairpin assembly (CHA) technology to achieve high sensitivity and specific detection of circulating tumor DNA (CT-DNA). Specifically, in the absence of target CT-DNA, the hairpin structures FB-H1 and H2 are adsorbed on the surface of PDA-SiO2 NPs through π-π stacking, the BHQ-1 group modified by the H1 hairpin structure interacts with FAM through FRET, FAM fluorescence quenching, and the fluorescence quenching effect of PDA-SiO2 NPs further reduces the background of fluorescence detection. When the target CT-DNA is present, CT-DNA partially hybridizes with the sticky end stem of the hairpin structure H1, and the hairpin nanostructure of H1 is opened to produce a sticky end that is partially complementary to H2. Finally, due to more base complementarity between H2 and H1, CT-DNA is replaced. The released CT-DNA will trigger the next round of hybridization. In this case, a single CT-DNA can cause the generation of a large number of double-stranded nanostructures, and the double-stranded DNA is released from the PDA-SiO2 nanoparticles, resulting in significant fluorescence enhancement. Due to the high-intensity base complementarity between CT-DNA and H1 nucleic acid sequences, the accuracy of CHA action is ensured, thereby promoting high sensitivity and specificity of detection. CT-DNA exists in peripheral blood and can be extracted from plasma, so CT-DNA is easy to obtain and minimally invasive to patients. The half-life of CT-DNA is very short, only 114 minutes, so the concentration of CT-DNA in the blood can reflect the dynamic changes of the tumor in real time.

[0032] The present invention synthesizes PDA-SiO2 nanoparticles under mild conditions and utilizes its powerful surface functionalization properties to simply assemble catalytic hairpin (CHA) probes to achieve rapid detection; the present invention attaches FB-H1 and H2 probes modified with fluorophores (FAM) and fluorescent receptors (BHQ-1) to the PDA-SiO2 surface through van der Waals forces to successfully assemble CHA probes; compared with traditional detection methods such as electrochemical and chromatographic detection methods, the present invention is simpler and quicker to operate.

[0033] PDA-SiO2 nanoparticles have good water dispersibility and biocompatibility, and show high stability in biological environments. The dopamine coating generated by the self-polymerization of PDA can maintain the stability and functionality of the nanoparticles in various biological environments. In specific experiments, PDA-SiO2 nanoparticles stably adsorbed hairpin DNA probes on their surfaces through π-π stacking interactions, and were able to maintain their original performance through simple centrifugation and washing steps after the reaction was completed. This high stability and biocompatibility enables PDA-SiO2 nanoparticles to work effectively in both in vitro and in vivo environments, ensuring the accuracy and reliability of the test results.

[0034] The present invention significantly amplifies the detection signal through catalytic hairpin assembly (CHA) technology, achieving a detection limit of CT-DNA as low as picomolar (pM) level. In the specific experiment, FB-H1, H2, and PDA-SiO2 NPs were added to a PBS buffer solution containing CT-DNA, reacted at 30°C for 15 minutes, and the fluorescence of FAM was excited at a wavelength of 480nM to measure the fluorescence emission spectrum in the range of 500~600nM. This method can not only detect CT-DNA at extremely low concentrations, but also reflect the dynamic changes of tumors in real time through a rapid response mechanism. By gradually diluting the CT-DNA sample and measuring the fluorescence signal, a standard curve can be established and the content of CT-DNA in an unknown sample can be calculated. This real-time dynamic monitoring feature is of great significance for the early diagnosis and treatment effect evaluation of tumors, and helps to achieve personalized medicine and improve the treatment effect and survival rate of patients.

[0035] Of course, any product implementing the present invention does not necessarily need to achieve all of the advantages described above at the same time. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for describing the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative work.

[0037] Figure 1 It is a schematic diagram of the principle of the present invention;

[0038] Figure 2 Schematic diagram of the fluorescence response of the PDA-SiO2-based CHA probe to CT-DNA; (a): CT-DNA; (b): FB-H1+PDA-SiO2; (c): FB-H1+H2+PDA-SiO2; (d): FB-H1+CT-DNA+PDA-SiO2; (e): FB-H1+H2+CT-DNA+PDA-SiO2;

[0039] Figure 3 This is a diagram showing the further quenching effect of PDA-SiO2 on H1 fluorescence;

[0040] Figure 4Native-PAGE chart for CHA detection; M: DNA marker; 1: H1 (1µM); 2: H2 (1µM); 3.H1+CT-DNA (1µM +1µM); 4: H1+H2+CT-DNA (1µM +1µM +1µM); 5: H1+H2+CT-DNA (1µM +1µM +0.5µM); 6. H1+H2+CT-DNA (1µM +0.5µM +1µM); 7. H1+H2 (1µM +1µM) 8: CT-DNA(1µM); 9: CT-DNA(5µM).

[0041] Figure 5 is the fluorescence relationship diagram between the fluorescence intensity and different concentrations of ctDNA (0, 0.5, 1, 2, 4, 6, 8, 10, 14, 16, 20, and 25 nM);

[0042] Figure 6 It is the linear fitting standard curve diagram of CT-DNA concentration and fluorescence intensity;

[0043] Figure 7 is a graph of the specificity and stability of the biosensor; Mis-1 represents 1 base mismatch; Mis-2 represents 2 base mismatches; Mis-3 represents 3 base mismatches; Mis-4 represents 4 base mismatches; Mis-5 represents 5 base mismatches;

[0044] Figure 8 This is the optimization diagram of the CHA reaction conditions of the biosensor; A: optimal ratio of H1:H2; B: optimal incubation temperature for CHA reaction; C: optimal incubation time for CHA reaction; D: optimal addition amount of PDA-SiO2NPs. DETAILED DESCRIPTION

[0045] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0046] Example 1

[0047] The present embodiment describes a method for preparing a biosensor for catalytic hairpin assembly cascade amplification based on PDA-SiO2 nanoparticles, comprising: attaching a FB-H1 / H2 free hairpin DNA probe having a 5'-end modified fluorophore (FAM) and a 3'-end fluorescent receptor (BHQ-1) to the surface of the PDA-SiO2 nanoparticles, so as to assemble a catalytic hairpin (CHA) probe based on the PDA-SiO2 nanoparticles through van der Waals forces between the PDA-SiO2 nanoparticles and the pendant single-stranded portion of the hairpin DNA probe, wherein the nucleotide sequence of the FB-H1 is shown in SEQ ID NO. 1, and the nucleotide sequence of the H2 is shown in SEQ ID NO. 2.

[0048] In this embodiment, the synthesis method of the PDA-SiO2 nanoparticles includes:

[0049] Quickly add 7.5 mL of ammonia water, 27.5 mL of ethanol, 22.5 mL of ultrapure water, and 2.5 mL of TEOS into a mixed solution and stir at room temperature for 6 h; then, centrifuge the white suspension at 4200 r / min for 5 minutes and wash it several times with ultrapure water until the solution is neutral. Finally, dry the solution in a vacuum oven at 60°C to obtain white SiO2 powder.

[0050] White SiO2 powder (50 mg) was dispersed in 15 mL ultrapure water by ultrasonication, and Tris solution was added to adjust the pH to 9. 30 mg of dopamine hydrochloride was dissolved in 10 mL ultrapure water and added to the above solution. After reacting at room temperature for 10 h, the black suspension was centrifuged at 4500 r / min for 5 min and washed several times with ultrapure water until the solution was neutral, and dried in a vacuum oven at 60 °C to obtain PDA-SiO2 NPs.

[0051] On the other hand, the present invention provides a biosensor based on catalytic hairpin assembly cascade amplification of PDA-SiO2 nanoparticles prepared by the above method.

[0052] According to the principles reported in the existing literature and with reference to the ctDNA sequence, the research team designed the oligonucleotide sequences FB-H1 and H2 by themselves and commissioned Shanghai Shenggong Biotechnology Co., Ltd. to synthesize them at HPLC level. Before the experiment, the nucleotide powder was dissolved in up water to a 100µM storage solution. During the experiment, pH 7.5 (Tris.Cl + 10mM Mg 2+ ) Dilute the stock solution to the working concentration. (FB-H1 and H2) Denature at 95℃ for 5 min and gradually cool to room temperature.

[0053] On the other hand, the present invention proposes the application of the above-mentioned biosensor based on catalytic hairpin assembly cascade amplification of PDA-SiO2 nanoparticles in CT-DNA detection.

[0054] In a PBS buffer (1X PBS 7.4) containing 25nM FB-H1, 25nM H2 and 700nM CT-DNA, the reaction was carried out at 30℃ for 15min, and then 150µg / ml PDA-SiO2 NPs were added for fluorescence detection. Fluorescence detection was performed using a F-7000 fluorescence spectrophotometer, with the excitation wavelength set to 485 nm and the emission spectrum recorded at 500 ~ 600 nm.

[0055] CHA results were detected by 12% polyacrylamide gel electrophoresis. Then, electrophoresis was run at 80 V for 120 min in 1xTBE buffer (88 mM Tris-acetate, 2 mM EDTA, pH 8.0). After GeneRed staining, the gel was imaged using GBOX-F3-E (GeneCompany Limited, USA).

[0056] In this embodiment, the application includes fluorescence determination of CT-DNA and content determination of CT-DNA.

[0057] In this embodiment, the fluorescence determination of CT-DNA specifically includes: adding FB-H1, H2, and PDA-SiO2 NPs to a buffer solution of PBS (1X PH 7.4) containing CT-DNA, reacting at 30°C for 15 minutes, exciting the fluorescence of FAM at 480nM, measuring the fluorescence emission spectrum in the range of 500~600nM, and setting the slit to 10nM; the parameters of the F-7000 fluorescence spectrophotometer are: Scan Speed: 1200, Ex Slit: 5, Em Slit: 10, PMT Voltage: 700V.

[0058] In this embodiment, the reaction concentration of FB-H1 and H2 is 1:(0.5-2.5).

[0059] In this example, FB-H1 and H2 were 25 nM, and PDA-SiO2 NPs were 150 µg / mL.

[0060] In this embodiment, the CT-DNA content determination includes: in a PBS buffer (1X PBS7.4) containing 25nM FB-H1, 25nM H2 and (0, 0.5nM, 1nM, 2nM, 4nM, 6nM, 8nM, 10nM, 14nM, 16nM, 20nM, 25nM) CT-DNA, reacting at 30°C for 15min, and then adding 150µg / mL PDA-SiO2 NPs for fluorescence detection. Fluorescence detection uses an F-7000 fluorescence spectrophotometer, the excitation wavelength is set to 485 nm, the emission spectrum is recorded at 500 ~ 600 nm, and the parameters are selected as: Scan Speed: 1200, Ex Slit: 5, Em Slit: 10, PMT Voltage: 700V. A standard curve is made with different CT-DNA concentrations as the horizontal axis and the peak fluorescence intensity at 520 nm as the vertical axis. A good linear relationship was obtained when the CT-DNA concentration ranged from 0 pM to 10.00 nM. The regression equation was ΔF = 33.66 (nM) + 632.69 (R2 = 0.995, n = 3). The detection limit was calculated to be 225 pM (LOD = 3σ / S). The results are comparable to or even lower than some enzyme-free DNA nanoassembly strategies for CT-DNA analysis listed in Table S2.

[0061] Example 2

[0062] Materials and methods

[0063] Chemicals and reagents

[0064] Ammonia, anhydrous ethanol, tetraethyl orthosilicate (TEOS), dopamine hydrochloride, tris(hydroxymethyl)aminomethane (Tris). The oligonucleotide sequences used were provided by Shanghai Shenggong Biotechnology Co., Ltd. All chemicals and solvents used were of the highest chemical grade and were used directly. Before the experiment, the molecular beacon probes (FB-H1 and H2) were denatured at 95 °C for 5 min and then cooled to room temperature. Table 1 lists the oligonucleotide sequences used.

[0065] Table 1 Oligonucleotide sequences

[0066] Name Sequences(5' to 3') FB-H1 FAM-CCATCAGCTCCAACTACCACAAAGCTGATGGTTGTGGTAGTTGGA-BHQ-1 H2 CCACAACCATCAGCTTTTGTGGTAGTTGGAGCTGATGG CT-DNA TTGTGGTAGTTGGAGCTGATGG mis-1 TTGTGGTAGTTGCAGCTGATGG mis-2 TTGTGGTACTTGCAGCTGATGG mis-3 ATGTGGTACTTGCAGCTGATGG mis-5 ATGTCGTACTTCCAGCTGATGG

[0067] The 5' end of H1 is added with a FAM fluorescent group, and the 3' end is added with a quenching group BHQ. Dissolve in ultrapure water and prepare a storage concentration of 100 μmol / L. Store at -20°C. When used, use pH 7.5 (Tris.Cl + 10mM Mg 2+ ) was diluted to 1 μmol / L for testing. Denatured at 95°C for 5 min and cooled to room temperature to form a hairpin structure.

[0068] ctDNA detection was performed in a 400 µL reaction system. In 1*PBS buffer (pH 7.2), 1μM 10μL H1 (final concentration 25nM), 1μM 10μL H2 (final concentration 25nM) were incubated with PDA-SiO2 NPs at 30°C for 20 min to fully adsorb the hairpin DNA. The prepared PDA-SiO2 NPs-based CHA probe was stored in the dark at 4°C for further use.

[0069] The prepared PDA-SiO2 NPs-based CHA probe was reacted with different concentrations of target ctDNA (0.5 nM, 1 nM, 2 nM, 4 nM, 6 nM, 8 nM, 10 nM, 12 nM, 14 nM, 16 nM, 10 nM, 25 nM) at 30 ° C for 15 min, and the fluorescence was measured on a F-7000 fluorescence spectrophotometer. The excitation wavelength of FAM was 480 nm, and the emission fluorescence at 520 nm was recorded to detect the concentration of ctDNA.

[0070] Selective detection of probes

[0071] The prepared PDA-SiO2 NPs-based CHA probes were reacted with 1 μM 6 μL of CT-DNA, Mis-1, Mis-2, Mis-3, and Mis-5 (final concentration of 15 nM) at 30 °C for 15 min, and then the fluorescence was measured on a F-7000 fluorescence spectrophotometer. The excitation wavelength of FAM was 480 nm, and the emission fluorescence at 520 nm was recorded.

[0072] Synthesis of PDA-SiO2 NPs

[0073] Modified synthesis of SiO2 nanoparticles: Quickly add 7.5 mL of ammonia water, 27.5 mL of ethanol, 22.5 mL of ultrapure water, and 2.5 mL of TEOS to a mixed solution and stir at room temperature for 6 h. Then, centrifuge the white suspension at 4200 r / min for 5 minutes and wash it several times with ultrapure water until the solution is neutral. Finally, dry the solution in a vacuum oven at 60°C to obtain white SiO2 powder.

[0074] Synthesis of dopamine-coated SiO2: White SiO2 powder (50 mg) was dispersed in 15 mL ultrapure water by ultrasound, and Tris solution was added to adjust the pH to 9. 30 mg of dopamine hydrochloride was dissolved in 10 mL ultrapure water and added to the above solution. After reacting at room temperature for 10 h, the black suspension was centrifuged at 4500 r / min for 5 min and washed several times with ultrapure water until the solution was neutral, and dried in a vacuum oven at 60 °C to obtain PDA-SiO2 NPs.

[0075] Fluorescence measurement of CT-DNA fluorescence

[0076] In a buffer solution containing 25 nM FB-H1, 25 nM H2, 10 µg / mL PDA-SiO2 NPs and a series of CT-DNA concentrations in PBS (1X pH 7.4), the reaction was carried out at 37 °C for 15 min. The fluorescence of FAM was excited at 480 nM, and the fluorescence emission spectra were measured in the range of 500-600 nM, with the slit set to 10 nM.

[0077] Polyacrylamide gel electrophoresis (PAGE) analysis

[0078] The products of the amplification procedure were characterized using 12% polyacrylamide gel electrophoresis. Electrophoresis was then run at 80 V for 120 min in 1xTBE buffer (88 mM Tris-acetate, 2 mM EDTA, pH 8.0). After GeneRed staining, the gel was imaged using GBOX-F3-E (Gene Company Limited, USA).

[0079] Example 3

[0080] Principle Figure 1As shown, FB-H1 / H2 free hairpin DNA probes modified with fluorophore (FAM) at the 5' end and fluorescent acceptor (BHQ-1) at the 3' end were attached to the surface of PDA-SiO2 nanoparticles to assemble catalytic hairpin (CHA) probes based on PDA-SiO2 nanoparticles through van der Waals forces between PDA-SiO2 nanoparticles and the overhanging single-stranded part of the hairpin DNA probe. After sufficient adsorption, the fluorescence of FAM was effectively quenched by BHQ-1 and PDA-SiO2 due to the fluorescence energy transfer effect. The neck and overhanging parts of FB-H1 were partially complementary to the target CT-DNA. Therefore, the presence of CT-DNA can specifically trigger the hybridization between CT-DNA and FB-H1 through the sticky end of FB-H1. Then, the hairpin nanostructure of FB-H1 was opened to generate sticky ends complementary to the H2 part. Finally, CT-DNA was displaced due to more base complementarity between H2 and FB-H1. After the strand displacement and CHA reaction process, a double-stranded nanostructure was formed. Due to the weak affinity between double-stranded DNA and PDA-SiO2, double-stranded DNA is released from PDA-SiO2 nanoparticles and the fluorescence signal is restored. The released CT-DNA will repeatedly trigger the next round of hybridization. In this case, a single CT-DNA can cause the generation of a large number of double-stranded nanostructures, resulting in a significant fluorescence enhancement.

[0081] CT-DNA content test

[0082] In order to test the quenching ability of PDA-SiO2 ( Figure 2 ) and the response of the PDA-SiO2-based CHA probe to CT-DNA, followed by fluorescence measurement. Figure 2 It shows that even if the fluorescence quenching group BHQ-1 is modified on the hairpin probe H1, FB-H1 will still have a high fluorescence background, so it is necessary to add nanomaterials for fluorescence quenching. After incubating the FB-H1 hairpin probe with PDA-SiO2, the fluorescence decreased by about 57.6%. By optimizing the subsequent nanomaterial concentration conditions, a lower fluorescence background can be achieved, realizing a wider detection range.

[0083] After incubation of FB-H1 with H2, it was found that the fluorescence increased partially ( Figure 2 Curve c) indicates that there is nonspecific hybridization between the hairpin structure of FB-H1 and H2, and curves d and e indicate that CT-DNA can open the hairpin structure of FB-H1 for CHA amplification.

[0084] The structure formation and feasibility of the CHA reaction were then determined by 12% polyacrylamide gel electrophoresis (PAGE). Figure 2As can be seen from band 1 in B, in the absence of target CT-DNA, cross-hybridization between FB-H1 and H2 was almost blocked, but non-specific hybridization between FB-H1 and H2 still existed. After incubation with 700 nM CT-DNA, FB-H1 and H2 began to interact with each other, and obvious bands could be observed in band 3. Compared with bands 4, 5, and 6, the mobility of the main band in band 3 was relatively low, indicating that the generated FB-H1 / H2 complex had a larger molecular weight.

[0085] PDA-SiO2-based CHA probe for CT-DNA detection

[0086] After confirming the feasibility of the assay, the concentration ratio of the hairpin DNA probe was optimized, as this may affect the efficiency of the CHA-based reaction. With the total hairpin probe concentration constant, the concentration ratio of FB-H1:H2 was adjusted from 1:0.5 to 1:2.5 in the presence and absence of CT-DNA. Figure 8 The results of A showed that when the ratio of H2 increased, the fluorescence signal increased, but because too high a concentration of H2 would increase the nonspecific hybridization of FB-H1 and H2, a 1:1 FB-H1:H2 concentration was selected as the reaction concentration. Then, the reaction temperature ( Figure 8 ), too high or too low reaction temperature is not conducive to the amplification reaction of CHA, so 30℃ was selected as the reaction temperature ( Figure 8 B).

[0087] Kinetic studies showed that the fluorescence of the hairpin probe was significantly quenched by PDA-SiO2 within 10 min ( Figure 8 C). The fast quenching and response kinetics indicate that the biosensor can be efficiently fabricated and performed. Finally, the concentration of PDA-SiO2 was investigated because a high concentration of PDA-SiO2 nanospheres would result in a low background signal, while an excess of nanospheres might absorb the target gene in a nonspecific manner and reduce the signal. Figure 8 The results in D confirmed that 150 μg / ml PDA-SiO2 could reduce the fluorescence intensity by 72% to achieve a lower fluorescence background, so 150 μg / ml PDA-SiO2 was selected for subsequent fluorescence experiments.

[0088] Specificity and stability of biosensors

[0089] To evaluate the specificity of the CT-DNA sensing platform, the control alone or incubated with five-base mismatched DNA, three-base mismatched DNA, two-base mismatched DNA, or one-base mismatched DNA was simultaneously incubated with FB-H1 / H2-PDA-SiO2 at the concentration of CT-DNA, respectively. Figure 4As shown, only CT-DNA can induce significant fluorescence enhancement. The fluorescence enhancement produced by CT-DNA is 1.4 times that produced by other DNAs with single mismatch bases, indicating that the CT-DNA biosensor has excellent specificity due to the FB-H1 / H2 stem-loop structure.

[0090] Performance of CT-DNA assay

[0091] Performance of CT-DNA Assay Under the optimal experimental conditions, the fluorescence intensity of FB-H1 and PDA-SiO2 at an excitation wavelength of 485 nm was explored as a function of CT-DNA concentration. Figure 5 It can be observed that the fluorescence intensity at 520 nm is significantly enhanced when the target CT-DNA concentration ranges from 500 pM to 25.00 nM. Figure 6 A good linear relationship was obtained in the concentration range from 0 pM to 10.00 nM. The regression equation was ΔF=33.66(nM)+632.69(R2=0.995, n=3). The detection limit was calculated to be 225 pM (LOD=3σ / S).

[0092] Detection of CT-DNA in bovine serum samples

[0093] In order to verify the feasibility of this method for actual sample detection, CT-DNA was detected in 5% bovine serum samples. 2.50nM, 5.00nM and 8.50 nM CT-DNA were added to the bovine serum samples. As shown in Table 2, the calculated recovery rates were 107.18%~120.65%, and the RSD was 0.01%~0.03%, indicating that the detection system has good accuracy and has the potential to be applied to biochemical sample analysis.

[0094] Table 2 Detection recovery rates of CT-DNA at different concentrations

[0095] Sample Added(nM) Found(nM) Recovery(%) RSD(%) (n=3) 1 2.5 2.67 106.66 0.01 2 5 4.80 95.96 0.01 3 8.5 8.67 101.98 0.02

[0096] In summary, based on the target-triggered signal amplification and the strong fluorescence quenching ability of PDA-SiO2, the present invention designs a novel signal biosensor for ultrasensitive and convenient monitoring of CT-DNA in living cells. Because the PDA-SiO2 synthesis method is simple and the CHA amplification reaction does not require thermal cycling or enzymes, the proposed strategy is very convenient. The excellent amplification of CHA provides good sensitivity and specificity for monitoring CT-DNA. Due to its strong fluorescence quenching ability and low cytotoxicity, PDA-SiO2 can be used as a biocompatible gene carrier in the future. Therefore, the present invention provides a convenient, sensitive and specific biosensor for monitoring CT-DNA in serum.

[0097] The preferred embodiments of the present invention disclosed above are only used to help illustrate the present invention. The preferred embodiments do not describe all the details in detail, nor do they limit the invention to the specific implementation methods described. Obviously, many modifications and changes can be made according to the content of this specification. This specification selects and specifically describes these embodiments in order to better explain the principles and practical applications of the present invention, so that those skilled in the art can understand and use the present invention well. The present invention is limited only by the claims and their full scope and equivalents.

Claims

1. A method for preparing a biosensor based on catalytic hairpin assembly cascade amplification of PDA-SiO2 nanoparticles, characterized in that: include: The FB-H1 / H2 free hairpin DNA probe modified with a fluorophore FAM at the 5' end and a fluorescent receptor BHQ-1 at the 3' end is attached to the surface of PDA-SiO2 nanoparticles to assemble a catalytic hairpin CHA probe based on PDA-SiO2 nanoparticles through van der Waals forces between the PDA-SiO2 nanoparticles and the overhanging single-stranded portion of the hairpin DNA probe. The nucleotide sequence of FB-H1 is shown in SEQ ID NO. 1, and that of H2 is shown in SEQ ID NO.

2.

2. The method for preparing a biosensor based on catalytic hairpin assembly cascade amplification of PDA-SiO2 nanoparticles according to claim 1, characterized in that: The synthesis method of the PDA-SiO2 nanoparticles comprises: Rapidly add 7.5 mL of ammonia water, 27.5 mL of ethanol, 22.5 mL of ultrapure water, and 2.5 mL of TEOS into a mixed solution and stir at room temperature for 6 h; then, centrifuge the white suspension at 4200 r / min for 5 minutes and wash it with ultrapure water several times until the solution is neutral; finally, dry the solution in a vacuum oven at 60°C to obtain white SiO2 powder; The white SiO2 powder was dispersed in 15 mL of ultrapure water by ultrasound, and Tris solution was added to adjust the pH to 9; 30 mg of dopamine hydrochloride was dissolved in 10 mL of ultrapure water and added to the above solution; after reacting at room temperature for 10 h, the black suspension was centrifuged at 4500 r / min for 5 min and washed several times with ultrapure water until the solution was neutral, and dried in a vacuum oven at 60°C to obtain PDA-SiO2NPs.

3. A biosensor based on catalytic hairpin assembly cascade amplification of PDA-SiO2 nanoparticles prepared by the method as described in claim 1 or 2.

4. Use of the biosensor as claimed in claim 3 in CT-DNA detection.

5. The use according to claim 4, characterized in that: The applications include fluorescence determination of CT-DNA and content determination of CT-DNA.

6. The use according to claim 5, characterized in that: The fluorescence determination of CT-DNA specifically includes: adding FB-H1, H2, and PDA-SiO2 NPs to a PBS buffer solution containing CT-DNA, reacting at 30°C for 15 minutes, exciting the fluorescence of FAM at 480nM, measuring the fluorescence emission spectrum in the range of 500-600nM, and setting the slit to 10nM; the parameters of the F-7000 fluorescence spectrophotometer are: Scan Speed: 1200, Ex Slit: 5, Em Slit: 10, PMT Voltage: 700V.

7. The use according to claim 6, characterized in that: The reaction concentration of FB-H1 and H2 is 1:(0.5-2.5).

8. The use according to claim 6, characterized in that: FB-H1 and H2 were 25 nM, and PDA-SiO2 NPs were 150 μg / mL.

9. The use according to claim 5, characterized in that: The CT-DNA content determination includes: reacting the prepared PDA-SiO2 NPs-based CHA probe with different concentrations of target CT-DNA at 30°C for 15 minutes, and performing fluorescence determination on an F-7000 fluorescence spectrophotometer; the excitation wavelength of FAM is 480 nm, and the emission fluorescence at 520 nm is recorded to detect the concentration of CT-DNA.

Images