TWIST1 gene methylation detection primer probe system and kit thereof

Abstract

The invention discloses a TWIST1 gene methylation detection primer probe system and a kit thereof. The TWIST1 gene methylation detection primer probe system comprises an amplification primer pair, a probe a for detecting methylated genes and a probe a'for detecting unmethylated genes, the amplification primer pair comprises an upstream primer and a downstream primer, the nucleotide sequences of the upstream primer and the downstream primer are as shown in SEQ ID NO.1-SEQ ID NO.2, the nucleotide sequence of the probe a is as shown in SEQ ID NO.3, and the nucleotide sequence of the probe a'is as shown in SEQ ID NO.4; the 5'end of the probe a and the 5 'end of the probe a' are provided with different reporter fluorophores. The bladder cancer detection kit can be used in the aspects of bladder cancer detection, auxiliary diagnosis, recurrence prediction, curative effect evaluation and the like, and has the advantages of high sensitivity, strong specificity, low detection cost, convenience in material taking, easiness in sample storage and the like.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a TWIST1 gene methylation detection primer probe system and a kit thereof. Background Art

[0002] Bladder cancer (BC) refers to a malignant tumor that occurs on the bladder mucosa. It is a common urinary system tumor disease and one of the top ten common tumors in the body. Bladder cancer can occur at any age, but mostly occurs in people over 50 years old. The incidence rate increases with age, and the incidence rate in men is 3-4 times that in women. Bladder cancer can be divided into non-muscle-invasive bladder cancer (NMIBC) and muscle-invasive bladder cancer (MIBC) according to the treatment model and disease prognosis. It can be divided into bladder urothelial carcinoma, bladder squamous cell carcinoma and bladder adenocarcinoma according to the tissue origin, of which bladder urothelial carcinoma accounts for more than 90%. The most common clinical feature of bladder cancer is painless hematuria visible to the naked eye, often accompanied by irritating symptoms such as frequent urination, urgency and pain when urinating. The treatment effect of bladder cancer is closely related to the clinical stage. Early bladder cancer usually has a better prognosis. Early detection of bladder cancer can increase the chance of surgical preservation of the bladder and improve the overall survival rate. Early diagnosis and treatment are the key to improving the cure rate. At the same time, the recurrence rate of bladder cancer is 50%-70%, ranking first among all solid tumors. Among them, 10-20% of recurrent patients will develop into invasive bladder cancer. Therefore, prognosis monitoring should also be taken seriously. How to detect bladder tumors as early as possible and how to detect the recurrence of bladder tumors in time after surgery are of great clinical significance.

[0003] At present, the main examination methods for the bladder include urine examination, imaging examination and cystoscopy. In urine examination, routine urine examination can detect microscopic hematuria at an early stage, and urine exfoliated cell examination can detect tumor cells, but the detection sensitivity of both is low, and it is easy to miss early tumors; imaging examination includes ultrasound examination, X-ray angiography and CT, among which ultrasound examination is widely used in the diagnosis of bladder cancer and the screening of patients with hematuria, and CT urography plays an irreplaceable role in evaluating the stage of the disease, but such methods are not sensitive enough for smaller tumors and cannot make a clear diagnosis; cystoscopy is currently a reliable method for diagnosing bladder cancer, and the biopsy pathological results are the gold standard for diagnosing bladder cancer. The cystoscope enters the bladder through the urinary tract for visual observation, finds early tumors and takes samples for biopsy, but the method is an invasive operation, which will cause physical discomfort to patients who need long-term follow-up observation, and the economic burden is heavy. Therefore, it is necessary to develop a non-invasive and reliable new bladder cancer marker and detection technology to improve the early detection rate of bladder cancer, improve the treatment effect of bladder cancer, and reduce the mortality rate of bladder cancer.

[0004] Epigenetics has been a hot topic in tumor research in recent years. Epigenetic changes such as DNA methylation, histone modification, chromatin remodeling, and non-coding RNA regulation are all considered to be closely related to the occurrence of tumors. Among them, DNA methylation is the most common epigenetic change, which can regulate cell proliferation, apoptosis, and differentiation, and its level is closely related to the biological characteristics of tumors. Current studies have shown that bladder cancer, like many other cancers, is the result of the long-term action of multiple carcinogenic factors. Its pathological process is a complex process of accumulation of multi-gene mutations, involving abnormal methylation of multiple oncogenes and tumor suppressor genes, most of which are hypermethylation of tumor suppressor genes, which often leads to transcriptional silencing of tumor suppressor genes. Abnormal DNA methylation usually occurs in the early stages of cancer and runs through the occurrence and development of cancer. Once its methylation state is formed, it needs to be continuously stimulated by the external environment for a long time before it changes. Therefore, the detection of DNA methylation indicators can be used as an important biological indicator for cancer diagnosis, early screening, and prognosis.

[0005] TWIST1 is a highly conserved transcription factor in the basic helix-loop-helix protein family. Its mRNA is most highly expressed in placental tissue and plays an important role in embryogenesis and development. It participates in the regulation of epithelial-mesenchymal transition, thereby affecting tumor invasion and metastasis. TWIST1 overexpression or promoter methylation is common in metastatic tumors. At present, studies on the correlation between bladder tumors and TWIST1 genes at home and abroad include the correlation analysis between TWIST1 protein expression and tumors, and the detection of methylation levels in urine specimens. Isabelle Renard et al. (Identification and validation of the methylated TWIST1 and NID2 genes through real-time methylation-specific polymerase chain reaction assays for the noninvasive detection of primary bladder cancer in urine samples.) found that the detection rate of TWIST1 methylation in bladder cancer urine samples reached 88%, and the specificity reached 94%.

[0006] Existing methods have certain limitations, such as relatively low specificity and insufficient sensitivity for early bladder cancer, such as urine tests. Cystoscopy and tissue biopsy are invasive, which will increase the pain and discomfort of patients and cause a relatively large psychological burden. Therefore, it is urgent to develop new products to meet market demand. Summary of the invention

[0007] Technical problems solved: In response to the above technical problems, the present invention provides a TWIST1 gene methylation detection primer probe system and a kit thereof, which has the advantages of being painless, non-invasive, accurate, sensitive, convenient and affordable, and effectively solves the problems of difficult, invasive, high-cost and complex procedures in bladder cancer detection.

[0008] Technical solution: In the first aspect, the present invention provides a TWIST1 gene methylation detection primer probe system, comprising an amplification primer pair, a probe a for detecting methylated genes, and a probe a' for detecting unmethylated genes; the amplification primer pair comprises an upstream primer and a downstream primer, and the nucleotide sequence thereof is shown in SEQ ID NO.1-SEQ ID NO.2, the nucleotide sequence of probe a is shown in SEQ ID NO.3, and the nucleotide sequence of probe a' is shown in SEQ ID NO.4; the 5' ends of the probe a and the probe a' are provided with different reporter fluorescent groups: SEQ ID NO.1: CGGTTTTACGGATTTAGAGGGTTT; SEQ ID NO.2: AACAACCCCATCCGAAATAACTATAAC; SEQ ID NO.3: TGGGCGAGATGAGATAT; SEQ ID NO. 4: TGGTTTTATGGATTTAGAGGGTTT.

[0009] Preferably, the final concentration of each primer used in the PCR reaction is 900 nM, and the final concentration of each probe used in the PCR reaction is 250 nM.

[0010] Preferably, the reporter fluorescent group is FAM or VIC.

[0011] Preferably, the probability of TWIST1 gene methylation = the number of copies of the fluorescence carried by the reporter probe a ÷ (the number of copies of the fluorescence carried by the reporter probe a + the number of copies of the fluorescence carried by the reporter probe a').

[0012] In a second aspect, the present invention provides a TWIST1 gene methylation detection kit comprising the primer-probe system described in the first aspect.

[0013] Beneficial effects: This kit is relatively quick to operate, has high patient compliance, avoids the discomfort and risks caused by invasive operations, can accurately identify, reduces the occurrence of false positives and false negatives, and is suitable for a wide range of people. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 is a schematic diagram of the test results of sample 1 in Example 1 of the present invention; Figure 2It is a schematic diagram of the detection results of sample 2 in Example 1 of the present invention. DETAILED DESCRIPTION

[0015] The present invention is described in detail below in conjunction with the accompanying drawings and specific embodiments: Example 1

[0016] The steps of using the primer-probe system of the present invention to detect the methylation probability of the sample to be tested (the sample verified by pyrophosphate sequencing and BSP sequencing) are as follows: 1. Pretreatment of the sample to be tested: Use a DNA methylation modification kit (EZ DNA Methylation-Lightning, KitZYMO RESEARCH) to treat the DNA of the sample to be tested with sulfite to obtain a sulfite-treated sample; 2. Synthesize primers and probes: According to the sequence in Table 1 below, entrust Nanjing Kebai Biotechnology Co., Ltd. to complete the synthesis.

[0017] Table 1 Primer-probe system of the present invention

[0018] Note: The 5' end of the probe TWIST1-Methy-PC1 is modified with FAM, and the 5' end of TWIST1-Methy-PT1 is modified with VIC; 3. Use Bio-Rad's ddPCR supermix for probes to test the samples after sulfite treatment: 3.1. Prepare the PCR reaction system as shown in Table 2 below: Table 2 PCR reaction system

[0019] Note: The concentration of the DNA after sulfite treatment is 50 ng / μL, the concentrations of the upstream primer and the downstream primer in the amplification primer pair are both 900 nM, and the concentrations of probes a and a' are both 250 nM.

[0020] 3.2. The setting of the reaction program is shown in Table 3 below: Table 3 PCR reaction procedure

[0021] Note: The heating rate is 2°C / sec., the cover temperature is set to 105°C, and the sample volume is set to 40 μL.

[0022] 3.3 Results and Analysis The experimental results are as follows Figure 1-Figure 2 The corresponding data are shown in Table 4 below: Table 4 Experimental results

[0023] The results show that the method of the present invention can directly quantify the methylation probability, has higher efficiency, and the data is more intuitive. In addition, compared with other sequencing methods, the method of the present invention takes less time and is more efficient. Example 2

[0024] Positive samples and negative samples were mixed in different proportions, as shown in Table 5 below, and the primer-probe system of the present invention was used for detection according to Example 1. Table 5 Sample combinations with different proportions and test results

[0025] The results show that the probe of the present invention exhibits high specificity and appropriate sensitivity during the detection process and is capable of detecting the target substance in the positive sample. Example 3

[0026] Low-frequency samples were prepared and tested using the primer-probe system of the present invention according to Example 1. The results are shown in Table 6 below: Table 6 Detection results of low-frequency samples

[0027] As shown in Table 6, the error between the theoretical value and the actual value is within 5%, and the sensitivity and specificity of the primer probe are relatively ideal, which can accurately reflect the situation of the sample. Furthermore, even for low-copy and low-concentration samples, the accuracy and sensitivity of the detection can be guaranteed.

[0028] In molecular biology experiments, the sensitivity and specificity of primer probes are two key indicators for evaluating the experimental results. Sensitivity refers to the ability of the probe to correctly identify and amplify the target sequence (i.e., positive sample), while specificity refers to the ability of the probe not to react with non-target sequences (i.e., negative sample) during the amplification process. When it is mentioned that "the error between the theoretical ratio and the actual detection ratio is within 5%", it usually means that the accuracy of the experimental results is very high and very close to the expected theoretical value. This high degree of accuracy can indirectly reflect that the sensitivity and specificity of the primer probe are relatively excellent.

[0029] Sensitivity analysis: If the sensitivity of the primer is not high, then even if the target sequence exists in the sample (positive sample), the actual positive ratio detected may be lower than the theoretical value due to insufficient amplification efficiency. However, since the error between the actual detection ratio and the theoretical ratio is within 5%, it means that the primer can efficiently amplify the target sequence, that is, the sensitivity is high.

[0030] Specificity analysis: If the primers are not specific, they may react with non-target sequences (negative samples) during the amplification process, resulting in the actual positive ratio being higher than the theoretical value. However, the error between the actual detection ratio and the theoretical ratio is very small (within 5%), indicating that the primers hardly react with non-target sequences during the amplification process, that is, the specificity is very high.

[0031] Therefore, when the error between the theoretical ratio and the actual detection ratio is within 5%, it can be considered that the sensitivity and specificity of the primer probe are relatively excellent. This excellent performance enables the primer probe to distinguish the positive and negative proportions in the sample well, providing reliable data support for subsequent molecular biology experiments.

[0032] In summary, the experimental results not only verified the accuracy and reliability of the primer probe, but also further demonstrated its wide application value in molecular biology research.

[0033] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. TWIST1 gene methylation detection primer probe system, characterized in that: It includes an amplification primer pair, a probe a for detecting methylated genes, and a probe a' for detecting unmethylated genes; The amplification primer pair includes an upstream primer and a downstream primer, the nucleotide sequences of which are shown in SEQ ID NO.1-SEQ ID NO.2, the nucleotide sequence of probe a is shown in SEQ ID NO.3, and the nucleotide sequence of probe a' is shown in SEQ ID NO.4; The 5' ends of the probe a and the probe a' are provided with different reporter fluorescent groups.

2. The TWIST1 gene methylation detection primer-probe system according to claim 1, characterized in that: The final concentration of each primer used in the PCR reaction was 900 nM, and the final concentration of each probe used in the PCR reaction was 250 nM.

3. The TWIST1 gene methylation detection primer-probe system according to claim 1, characterized in that: The reporter fluorescent group is FAM or VIC.

4. The TWIST1 gene methylation detection primer-probe system according to claim 1, characterized in that: The probability of TWIST1 gene methylation = the number of copies of the fluorescence carried by reporter probe a ÷ (the number of copies of the fluorescence carried by reporter probe a + the number of copies of the fluorescence carried by reporter probe a').

5. A TWIST1 gene methylation detection kit comprising the primer-probe system according to any one of claims 1 to 4.

Images