Primer combination for identifying phellinus species and identification method

Abstract

The invention discloses a primer combination for identifying phellinus species, which comprises a primer combination 1, a primer combination 2 and a primer combination 3, the primer combinations respectively correspond to amplified fragment lengths of 676bp, 238bp and 152bp, and the primer combinations can specifically identify mulberry phellinus, poplar phellinus and manchurian phellinus. Aiming at the primer combination, the optimal reaction system and condition of multiple PCR are finally determined by testing the reaction condition and system of each pair of primers, and the identification method is quick, efficient, high in resolution ratio and good in accuracy, can quickly and accurately distinguish different species of phellinus, and has very high applicability and economic value.

Description

Technical Field

[0001] The present invention relates to the field of molecular biological detection, and in particular to a primer combination and an identification method for identifying species of the genus Phellinus. Background Art

[0002] In recent years, with the increase in people's demand for health care, the demand for mulberry mushroom has also greatly increased due to its excellent anti-tumor, immunity-enhancing, antioxidant, blood sugar-lowering and anti-inflammatory effects. Among them, mulberry mushroom has the greatest medicinal value.

[0003] Phellinus belongs to the Basidiomycetes, Hymenomycetes, Polyporales, and the genus Phellinus. It is a kind of precious edible and medicinal fungi. There has been controversy over the species of Phellinus for a long time, which is very rare among medicinal fungi. There are many species of this kind of large, hard, yellow-black-brown polyporus, which look similar, and it is difficult to identify them by appearance. The records of Phellinus in many ancient Chinese books have lasted for two thousand years. The statements about the growth environment, morphological characteristics and medicinal effects of Phellinus came from different people in different eras. The Phellinus they described was not a single species, but included many different fungi with similar appearances. Since ancient times, the species of Phellinus have been limited by the lack of identification technology, and there is no way to distinguish similar species of Phellinus.

[0004] At present, rDNA ITS sequence analysis technology is mostly used at home and abroad, combined with phylogenetic tree construction and BLAST analysis to identify Phellinus igniarius. Wang Weike et al. (Journal of Zhejiang Agricultural Sciences, 2019, 31(02):307-314) used rDNA ITS sequence analysis technology to calculate genetic distance and construct phylogenetic tree. Through BLAST analysis, they successfully identified Phellinus igniarius from mulberry, Phellinus igniarius from poplar and Phellinus igniarius from horse. Xu Xin et al. (Journal of Beijing Agricultural College, 2019, 34(01):20-27) used DNA barcode technology, through PCR amplification, sequencing, alignment and phylogenetic tree analysis, and combined with morphological characteristics, they found that ITS and NL were the best DNA barcodes for molecular identification of Phellinus igniarius, providing a reference for the rapid identification of Phellinus igniarius fungi. CN114058727A discloses an ISSR marker primer, identification reagent and application for identifying mulberry linterus, which has strong identification specificity and high accuracy, but the technology can only specifically identify mulberry linterus and cannot identify multiple types of linterus; CN118147355A discloses a primer probe and a method for rapidly detecting Chinese linterus fungi, which can identify a large number of linterus, but requires the use of fluorescent quantitative PCR technology, which is complicated and cumbersome. Summary of the invention

[0005] In view of the deficiencies of the prior art, the present invention provides a primer combination and an identification method for identifying species of the genus Phellinus based on the use of conventional molecular detection technology and targeting the common genus Phellinus.

[0006] To achieve the above object, the technical solution of the present invention is as follows:

[0007] A primer combination for identifying species of Phellinus, including primer combination 1, primer combination 2, and primer combination 3, wherein the sequence of primer combination 1 is SEQ: ID: NO: 1-2; the sequence of primer combination 2 is SEQ: ID: NO: 3-4; and the sequence of primer combination 3 is SEQ: ID: NO: 5-6.

[0008] The primer name of SEQ:ID:NO:1 is SR-F, and the sequence information is 5'-CATTATCGAGTTTTGAAAGCGAG-3';

[0009] The primer name of SEQ:ID:NO:2 is SR-R, and the sequence information is 5'-AAAGGTGTCAAGAAGGAG*G*TG-3';

[0010] The primer name of SEQ:ID:NO:3 is YR-F, and the sequence information is 5'-CATTATCGAGTTTTGAAAGCGAG-3';

[0011] The primer name of SEQ:ID:NO:4 is YR-R, and the sequence information is 5'-TTCACCCGACGCACTCCCG*C*TC-3';

[0012] The primer name of SEQ:ID:NO:5 is BR-F, and the sequence information is 5'-CATTATCGAGTTTTGAAAGCGAG-3';

[0013] The primer name of SEQ: ID: NO: 6 is BR-R, and the sequence information is 5'-CGATTACTTACAAGAACCTCAG*A*TT-3'.

[0014] It should be noted that * represents the sulfur modification of the primer.

[0015] Furthermore, the length of the amplified fragment of the primer combination 1 is 676 bp; the length of the amplified fragment of the primer combination 2 is 238 bp; and the length of the amplified fragment of the primer combination 3 is 152 bp.

[0016] The present invention also provides a method for identifying species of Phellinus linteus, comprising the following steps:

[0017] S1. Extracting genomic DNA of Phellinus linteus to be tested;

[0018] S2, using the genomic DNA of Phellinus linteus to be tested as template DNA and the primer combination of the above scheme as primers, performing PCR amplification to obtain an amplified product;

[0019] S3. Perform gel electrophoresis on the amplified product. When the length of the amplified fragment is 676 bp, the mulberry linterus to be tested is determined to be mulberry linterus; when the length of the amplified fragment is 238 bp, the mulberry linterus to be tested is determined to be poplar mulberry linterus; when the length of the amplified fragment is 152 bp, the mulberry linterus to be tested is determined to be Psoriatica foetida.

[0020] Preferably, the genomic DNA concentration of Phellinus linteus to be tested is 10-50 ng.

[0021] Preferably, the PCR amplification system is as follows: initial denaturation temperature of 98°C, initial denaturation time of 3 minutes; denaturation temperature of 98°C, denaturation time of 10s; annealing temperature of 55°C, annealing time of 5s or 15s; extension temperature of 72°C; after 30-35 cycles, final extension at 72°C for 5 minutes.

[0022] Compared with the prior art, the beneficial effects of the present invention are as follows: first, the present invention uses multiple pairs of primers to accurately identify the species of Phellinus at the molecular level. Compared with traditional morphological and single-pair primer identification, this technology has higher identification reliability. By combining ordinary PCR technology with high-fidelity enzymes and multiplex PCR technology, it can quickly and effectively identify poplar mulberry, horse mulberry, and mulberry mulberry, and has the advantages of high specificity, high sensitivity, and low cost, and has certain practical application value for production and research and development; secondly, in the identification of Phellinus species in the present invention, each amplified fragment is one, and the sizes are different; finally, the experimental process of the present invention is simple and fast, and can be implemented in current domestic DNA laboratories. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The electropherograms of three sequenced samples are shown;

[0024] Figure 2 The results of TA cloning (Note: Figure A is Control, Figure B is Sample; DNA was successfully inserted into the vector and formed a single colony after culture);

[0025] Figure 3 The electrophoresis pattern of bacterial solution PCR (Note: 1-10 represents bacterial solution No. 1-10, which is obtained by culturing single colonies after picking clones);

[0026] Figure 4 The sequencing results of three different varieties of Phellinus igniarius;

[0027] Figure 5The electrophoresis identification patterns of three sequenced Phellinus linteus samples (Note: from left to right, they are single and multiplex PCR of Populus linteus, Psoriatica linteus, and Mulberry linteus);

[0028] Figure 6 The effect of different concentrations of PCR template on amplification effect;

[0029] Figure 7 The mPCR electrophoresis profiles of 8 samples (Note: 1-8 are SH1-SH8 respectively). DETAILED DESCRIPTION

[0030] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0031] The molecular biological detection techniques used in the present invention are all conventional techniques and will not be described in detail.

[0032] Example 1

[0033] 1. Primer design

[0034] According to the gene sequences of Poplar Phellinus, Horse Phellinus, and Mulberry Phellinus in GeneBank, primers were designed using PrimerPremier5.0 software and synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. Specific primers include sequencing primers and molecular switch detection primers, a total of 2 types of primers.

[0035] Phellinus linteus specific molecular switch detection related primers: According to the specific sequences of poplar mulberry, horse mulberry and mulberry mulberry, one detection primer was designed for each, and according to the base distribution characteristics of the three primers, a common forward primer was designed to form a specific detection primer pair for the three mulberry.

[0036] Primer combination 1 included forward primer SR-F (CATTATCGAGTTTTGAAAGCGAG) and reverse primer SR-R (AAAGGTGTCAAGAAGGAG*G*TG), and the length of the amplified PCR product was 676 bp;

[0037] Primer combination 2 included forward primer YR-F (CATTATCGAGTTTTGAAAGCGAG) and reverse primer YR-R (TTCACCCGACGCACTCCCG*C*TC), and the length of the amplified PCR product was 238 bp;

[0038] Primer combination 3 included forward primer BR-F (CATTATCGAGTTTTGAAAGCGAG) and reverse primer BR-R (CGATTACTTACAAGAACCTCAG*A*TT), and the length of the amplified PCR product was 152 bp;

[0039] 2. Phellinus igniarius samples

[0040] In this experiment, three different genera of Phellinus igniarius were selected as material samples, and the specific information is as shown in Table 1:

[0041] Table 1 Origin and sources of different species of Phellinus linteus

[0042]

[0043] 3. Extraction of Phellinus igniarius genomic DNA

[0044] The DNA of Phellinus igniarius samples No. 9, 10 and 11 were extracted according to common molecular biology techniques, and the DNA concentration and quality were tested.

[0045] 4. PCR reaction and agarose gel electrophoresis

[0046] According to the common molecular biology technique, PCR reaction was carried out on the DNA of the three samples of Phellinus linteus, and the reaction products were subjected to agarose gel electrophoresis. The electrophoresis results are as follows: Figure 1 As shown, the target band was successfully obtained.

[0047] 5. Use E Coli.JM109 competent cells for TA cloning and recombinant plasmid identification

[0048] Pick a single colony from a fresh plate and inoculate it into a test tube containing 5ml LB medium, shake at 37℃ for 8-12h. Transfer the bacteria into 200ml LB medium and continue to culture until the OD value is 0.3-0.5, then place on ice for 20min. Collect the bacteria in a pre-cooled 30ml centrifuge tube and centrifuge at 6000rpm for 5min at 4℃. After removing the supernatant, invert the centrifuge tube for 10-20sec to remove droplets. Add 10ml pre-cooled 0.1M CaCl2 to resuspend the bacteria and repeat the centrifugation step. Add 1ml pre-cooled CaCl2 to the centrifuge tube to resuspend the bacteria and store at 4℃. Take 100μl from the prepared competent cells for transformation and check the transformation efficiency after 14 hours. After mixing the competent cells with an equal volume of -20℃ pre-cooled 0.1M CaCl2-glycerol, divide them into -20℃ pre-cooled microcentrifuge tubes and immediately transfer them to -80℃ for storage.

[0049] Refer to the instructions of the TA cloning kit to clone the control DNA fragment and the general DNA fragment. The purified PCR product was cloned into the pMD18-T Vector. If the DNA was successfully inserted into the vector, white colonies would grow when cultured overnight on the LB / Amp plate. The transformation efficiency of the Control group was over 90%, that is, more than 90% of the white colonies after the Control Insert was cloned contained the Insert DNA fragment, and the ratio of white colonies reached 98.1% ( Figure 2 ). Randomly select 10 colonies and place them in 1 mL LB / Amp liquid medium and shake culture for 3-4 hours until turbidity occurs.

[0050] Take 1 μl of the turbid bacterial solution cultured above, use the designed primers and Taq enzyme to perform ordinary PCR. The results of electrophoresis detection are as follows: Figure 3 As shown, Figure 3 The target bands were successfully obtained from bacterial cultures No. 1-10.

[0051] 6. Sequencing verification of Phellinus igniarius samples

[0052] Three bacterial cultures were randomly selected from the above positive clones and sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for sequencing. The feedback sequencing results were then compared with the sequences recorded in GeneBank by BLAST homology analysis. The results were as follows: the DNA fragment homology was 100%, that is, the sample numbered 9 was Populus lindera, the sample numbered 10 was Populus lindera, and the sample numbered 11 was Populus lindera.

[0053] Example 2

[0054] 1. Molecular switches recognize specific sites

[0055] To further test its specificity and sensitivity through experiments, including the annealing temperature in the PCR program, three pairs of specific detection primers were finally determined, including three pairs of reverse detection primers: YR, BR, and SR, corresponding to poplar mulberry, horse mulberry, and mulberry mulberry, respectively; and a common forward primer. Then, the three pairs of primers were used to perform PCR and multiplex PCR using a high-fidelity DNA polymerase with a selected sequenced mulberry template. By fine-tuning the reaction system and the number of PCR cycles, the optimal PCR program was determined (see Table 2), and the conditions of the multiplex PCR reaction system were consistent with Table 2.

[0056] Table 2 PCR reaction conditions for identification of Phellinus igniarius species

[0057]

[0058] The sequence of the Phellinus linteus samples that have been sequenced can be found at Figure 4The final result of the PCR reaction is as follows ( Figure 5 , Note: From left to right are the single PCR and multiplex PCR of Poplar Phellinus, Psoriatica lindracea and Mulberry Phellinus lindracea respectively). The electrophoresis result of Poplar Phellinus lindracea showed that the YR primer was extended by a high-fidelity DNA polymerase, while its BR and SR primers were not extended, which proved that it was Poplar Phellinus lindracea, and this result was consistent with the sequencing result. The BR primer of Psoriatica lindracea was extended, while the YR and SR primers were not extended, proving that it was Psoriatica lindracea, which was consistent with the sequencing result. The SR primer of Mulberry Phellinus lindracea showed a band, while the YR and BR primers had no bands, proving that it was Mulberry Phellinus lindracea, which was consistent with the sequencing result. This is the molecular switch effect, from which it can be seen that the target band is visible when the primer is completely matched with the template, and no visible band is visible when it is not completely matched, which is sufficient to show that the primers designed by the present invention have high specificity and effectiveness.

[0059] 2. Determination of the specificity and sensitivity of detection primers

[0060] The molecular switch technology mentioned above has the characteristics of strong specificity and high sensitivity because it is mediated by high-fidelity DNA polymerase. However, when the DNA template concentration is too high or too low, false positives will occur or the target product will not be detected. Therefore, to avoid the above situation, this experiment determined the optimal annealing temperature and number of cycles, and selected poplar mulberry lindera samples. The template concentrations were: 100pg (0.1ng), 1ng, 10ng, 50ng, 100ng, and multiplex PCR was used for detection and analysis. The results showed ( Figure 6 ), the best band effect was obtained when the template concentration was 10ng, and it was acceptable at 50ng (a faint mixed band appeared), and the other band effects were not ideal. Although the correct bands could be successfully obtained at each concentration, and no false positives or undetectable target products occurred, relatively reliable results could be obtained when the template amount was 10ng-50ng.

[0061] 3. Validation of multiplex PCR

[0062] Multiplex PCR was performed on all samples except the sequencing samples. The results after agarose gel electrophoresis showed that the bands numbered 1-3 were located at about 238bp, which was consistent with the amplification length of the designed YR primers and was presumed to be Populus lindera; the bands numbered 4-7 were located at about 152bp, which was consistent with the amplification length of the designed BR primers and was presumed to be Phellinus lindera; the band numbered 8 was located at about 676bp, which was consistent with the amplification length of the designed SR primers and was presumed to be Phellinus lindera. It can be seen that the multiplex PCR results further verified the accuracy of the above identification experiment.

[0063] Example 3

[0064] Identification results of the samples of Phellinus linteus amplified by the primers designed by the present invention

[0065] The samples of Phellinus linteus numbered 1-9 were sequenced and compared, and the varieties of the 11 samples of Phellinus linteus were determined as follows: the true varieties of the samples numbered 1, 2, 3, and 9 were poplar Phellinus linteus; the true varieties of the samples numbered 4, 5, 6, 7, and 10 were P. linteus linteus; the true varieties of the samples numbered 8 and 11 were mulberry Phellinus linteus. Among them, the merchants informed the purchase of the Phellinus linteus samples numbered 1, 2, and 3 as mulberry Phellinus linteus, but after testing, they were actually poplar Phellinus linteus; the Phellinus linteus sample numbered 7 was informed as mulberry Phellinus linteus, but it was actually P. linteus linteus linteus. The test results of the remaining samples were consistent with the merchants' notification.

[0066] Table 3 Identification results of Phellinus igniarius varieties

[0067]

[0068] The present invention hopes to establish a fast, easy, accurate, reliable, low-cost detection method with excellent sensitivity and specificity by using the molecular switch technology of high-fidelity enzymes, which is used for the identification of Phellinus igniarius in production and research and development. Since these Phellinus igniarius fungi are highly homologous, DNA molecular identification is difficult, and false positives often occur when using ordinary PCR identification. Therefore, we have improved the specificity and sensitivity of the detection through repeated experiments. The molecular switch technology, combined with common molecular biology and microbiology instrument consumables such as ordinary PCR instruments, can be widely applied. Although the above embodiment has made a detailed description of the present invention, it is only a part of the embodiments of the present invention rather than all the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all belong to the scope of protection of the present invention.

Claims

1. A primer combination for identifying species of Phellinus linteus, characterized in that: Including primer combination 1, primer combination 2, primer combination 3; Among them, the sequence of primer combination 1 is SEQ:ID:NO:1-2; The sequence of primer combination 2 is SEQ:ID:NO:3-4; The sequence of primer combination 3 is SEQ: ID: NO: 5-6.

2. A primer combination for identifying species of Phellinus according to claim 1, characterized in that: The length of the amplified fragment of the primer combination 1 is 676 bp; the length of the amplified fragment of the primer combination 2 is 238 bp; and the length of the amplified fragment of the primer combination 3 is 152 bp.

3. A method for identifying species of Phellinus linteus, characterized in that: The following steps are involved: S1. Extracting genomic DNA of Phellinus linteus to be tested; S2, using the genomic DNA of the tested Phellinus linteus as a template, performing PCR amplification using a primer combination to obtain an amplified product; S3. Perform gel electrophoresis on the amplified product. When the length of the amplified fragment is 676 bp, the mulberry linterus to be tested is determined to be mulberry linterus; when the length of the amplified fragment is 238 bp, the mulberry linterus to be tested is determined to be poplar mulberry linterus; when the length of the amplified fragment is 152 bp, the mulberry linterus to be tested is determined to be Psoriatica foetida.

4. A method for identifying species of Phellinus according to claim 3, characterized in that: The genomic DNA concentration of Phellinus igniarius to be tested is 10-50ng.

5. The method for identifying the species of Phellinus according to claim 3 or 4, characterized in that: The PCR amplification system is as follows: initial denaturation temperature of 98°C, initial denaturation time of 3 minutes; denaturation temperature of 98°C, denaturation time of 10s; annealing temperature of 55°C, annealing time of 5s or 15s; extension temperature of 72°C; after 30-35 cycles, the final extension is at 72°C for 5 minutes.

Images