A Herpetospermum pedunculosum Gene, Herpetospermum pedunculosum Indel Molecular Marker, Herpetospermum pedunculosum Detection Product and Their Application in Herpetospermum pedunculosum Sex Identification

Abstract

The present invention belongs to the technical field of plant genes and molecular markers, and specifically relates to a Herpetospermum pedunculosum gene, a Herpetospermum pedunculosum Indel molecular marker, a Herpetospermum pedunculosum detection product, and their application in the sex identification of Herpetospermum pedunculosum. The Herpetospermum pedunculosum gene of the present invention is a gene specifically present in male Herpetospermum pedunculosum plants and does not exist in female plants. Based on the polymorphism of the Herpetospermum pedunculosum gene in male and female Herpetospermum pedunculosum plants, the present invention also provides a Herpetospermum pedunculosum Indel molecular marker and amplification primers for the Herpetospermum pedunculosum Indel molecular marker. The Herpetospermum pedunculosum Indel molecular marker and amplification primers can efficiently identify the sex of Herpetospermum pedunculosum plants with an accuracy of up to 100%; at the same time, the identification effect is applicable to Herpetospermum pedunculosum of different populations and different developmental stages, and thus the sex of Herpetospermum pedunculosum can be identified before flowering, which has great guiding value for the cultivation, breeding and large-scale production of Herpetospermum pedunculosum.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genes and molecular markers, and particularly relates to a pomelo gene, a pomelo Indel molecular marker, a pomelo detection product and applications thereof in pomelo sex identification. Background Art

[0002] Herpetospermum umpedunculosum belongs to the genus Herpetospermum in the Cucurbitaceae family. It is an annual, dioecious, climbing herb found in thickets, forest edges, and roadsides on hillsides at altitudes between 2,300 and 3,500 meters. Its seeds contain alkaloids, tannins, sterols, amino acids, and triterpenes, and possess the properties of clearing heat, detoxifying, and softening the liver. It is primarily used to treat icteric infectious hepatitis and indigestion, and is widely used in Tibetan medicine.

[0003] At present, the field mostly uses artificial cultivation to plant the melon, and seed propagation is the main method of planting the melon. The seeds of the melon are used as medicinal materials, and the economic value of female plants is much higher than that of male plants. However, due to the dioecious nature of the melon, it is impossible to distinguish between male and female from the morphology of the seeds; the morphological characteristics of male and female plants during the vegetative period are very similar, and it is impossible to accurately identify the male and female before flowering. In addition, the proportion of female melon plants in natural populations is relatively low. If the male plants are artificially removed after flowering, the excessive male plants that have grown will occupy a large amount of space and land resources, which will result in a waste of resources and low yields. Therefore, it is necessary to identify the sex of the melon plants during the seedling stage and before the seedling stage, and to provide more resources and space for the female plants by artificially removing a certain amount of male plants to increase seed yield.

[0004] Traditional plant sex identification is mostly based on the external morphology of male and female plants, or based on their physiological and biochemical differences, chromosome karyotypes, isozyme maps, specific protein content and nucleotide differences. However, these methods mostly determine the differences between male and female plants based on the morphology of mature individuals, and the accuracy of seedling identification is low. With the development of molecular biotechnology, more and more methods using molecular markers are used for sex identification of dioecious plants, which has improved the above problems. For example, in some studies, the sex of tangerine melon was identified based on specific SCAR molecular markers. However, there are currently no genes in the field that can identify the sex of tangerine melon and no Indel molecular markers developed based on the genes. Summary of the Invention

[0005] The object of the present invention is to provide a pomelo gene, a pomelo Indel molecular marker, a pomelo detection product and their application in pomelo sex identification. The pomelo gene is a gene that specifically exists in male pomelo plants and does not exist in female plants. The Indel molecular marker developed based on the above characteristics can realize the identification of pomelo, especially the sex identification of pomelo.

[0006] The present invention provides a P. melanocarpa gene, the nucleotide sequence of the P. melanocarpa gene is shown as SEQ ID NO: 1 or SEQ ID NO: 2.

[0007] The present invention also provides a Cucurbita oleracea Indel molecular marker, wherein the Cucurbita oleracea Indel molecular marker has a deletion or insertion polymorphism of a nucleotide as shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0008] The present invention also provides amplification primers for the Indel molecular marker of the melon described in the above technical solution, and the nucleotide sequences of the upstream primer and the downstream primer of the amplification primer are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

[0009] The present invention also provides the use of the pomelo gene described in the above technical solution, the pomelo Indel molecular marker described in the above technical solution, or the amplification primer described in the above technical solution in one or more of the reagents, kits, liquid probes and chips used for pomelo detection.

[0010] The present invention also provides a product for detecting melon, which includes the amplification primers described in the above technical solution; the type of the product includes one or more of a reagent, a kit, a liquid probe and a chip.

[0011] The present invention also provides the use of the pomelo gene described in the above technical solution, the Indel molecular marker described in the above technical solution, the amplification primer described in the above technical solution, or the pomelo detection product described in the above technical solution in identifying pomelo.

[0012] Preferably, the identifying of the pear melon includes identifying the sex of the pear melon.

[0013] Preferably, the tangerine melon includes a tangerine melon whose developmental stage is the seedling stage and / or before the seedling stage.

[0014] Preferably, the identification is performed based on the PCR amplification band or PCR amplification sequence of the P. melanocarpa Indel molecular marker.

[0015] The present invention also provides a method for identifying the sex of a melon, comprising the following steps:

[0016] Using the genomic DNA of the to-be-tested melon as a template, PCR amplification is performed using the amplification primers described in the above technical solution to obtain a PCR amplification product;

[0017] Performing electrophoresis detection on the PCR amplification product to obtain an electrophoresis detection result;

[0018] The sex of the tested tangerine is identified according to the electrophoresis test result:

[0019] When the electrophoresis test results show a specific PCR amplification band of 369 bp, the tested tangerine is a male plant;

[0020] When the result of the electrophoresis test shows that there is no specific PCR amplification band of 369 bp, the tested tangerine is a female plant.

[0021] Beneficial effects:

[0022] The present invention provides a Ponzu gene, the nucleotide sequence of which is shown in SEQ ID NO: 1 or SEQ ID NO: 2. The Ponzu gene of the present invention is a gene that specifically exists in male Ponzu plants and does not exist in female plants.

[0023] Based on the polymorphism of the pomelo gene in male and female pomelo plants, the present invention also provides a pomelo Indel molecular marker and an amplification primer for amplifying the pomelo Indel molecular marker. The pomelo Indel molecular marker and amplification primer can efficiently identify the sex of pomelo plants with an accuracy of up to 100%. At the same time, the identification effect is applicable to pomeloes of different populations and different developmental stages, and thus can realize the sex identification of pomelo before flowering, which has high guiding value for the cultivation, breeding and large-scale production of pomelo. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments are briefly introduced below.

[0025] Figure 1 This is the comparison result of the specific genomic fragments in the male plants of Melon officinalis in Example 1;

[0026] Figure 2 This is a graph showing the gel electrophoresis results of the PCR primer pair M-219605R in four population samples of Glechoma longituba in Example 2;

[0027] Figure 3 This is a graph showing the gel electrophoresis test results of the PCR primer pair chr573789139 in four population samples of Glechoma longituba in Comparative Example 1;

[0028] Figure 4 This is a graph showing the gel electrophoresis test results of the PCR primer pair 960-CDS-1 in Comparative Example 2 in four population samples of Glehnia littoralis;

[0029] Figure 5 This is a graph showing the gel electrophoresis test results of the PCR primer pair chr5-9-p1 in Comparative Example 3 in four population samples of G.

[0030] Figure 6 This is a graph showing the gel electrophoresis test results of the PCR primer pair 6797098-1FA in four population samples of Glehnia littoralis in Comparative Example 4;

[0031] Figure 7 This is a graph showing the gel electrophoresis test results of the PCR primer pair 21965-FS-5 in comparative example 5 in four population samples of Melon officinalis. DETAILED DESCRIPTION

[0032] The present invention provides a P. melanocarpa gene, the nucleotide sequence of the P. melanocarpa gene is shown as SEQ ID NO: 1 or SEQ ID NO: 2.

[0033] The present invention discovered a gene that is specific to male Cucurbita oleracea plants by resequencing a Cucurbita oleracea population. The gene is absent in female Cucurbita oleracea plants. Furthermore, alignment revealed a single nucleotide polymorphism (SNP) at base 145 of the gene. The SNP exhibited a G / T polymorphic variation. The nucleotide sequence of the Cucurbita oleracea gene obtained is shown in SEQ ID NO: 1 or SEQ ID NO: 2, and is specifically as follows:

[0034] The nucleotide sequence shown in SEQ ID NO: 1 is: 5'-TCCCGTCATCGGCGAGTTTCTTA ACGCAGGTTCGCTCAAGGATGTGAGCTGTCCCGTCAACGAAGACCTCTCACTTTCAACTAACAAAGAATCTCCGTTTCTTGTCTCCCTTGGCGCTAATGAAAGCGTCAGTCATTCTGTGGC GTCGGAACCGTCTTCAACGACGTCGTTTCTAGGCATCATTCGGCGGGGCTTGCCCTTTGATCTCAACGAACCTCCGCCGTATTGGCTGTAAATGAACCGATTGCGCGTAGAAGCGAAATTTCAGTACTTATTTTCTTCTCTTAACATCCTTTGTTCTATTTACTTGTATTATCCGCAATCATTTTCTGCAATTGAACTTAAAAGGCTGTCGCCTCTCCTTCAGAA-3';

[0035] The nucleotide sequence shown in SEQ ID NO: 2 is: 5'-TCCCGTCATCGGCGAGTTTCTTA ACGCAGGTTCGCTCAAGGATGTGAGCTGTCCCGTCAACGAAGACCTCTCACTTTCAACTAACAAAGAATCTCCGTTTCTTGTCTCCCTTGGCGCTAATGAAAGCGTCAGTCATTCTGTGGC T TCGGAACCGTCTTCAACGACGTCGTTTCTAGGCATCATTCGGCGGGGCTTGCCCTTTGATCTCAACGAACCTCCGCCGTATTGGCTGTAAATGAACCGATTGCGCGTAGAAGCGAAATTTCAGTACTTATTTTCTTCTCTTAACATCCTTTGTTCTATTTACTTGTATTATCCGCAATCATTTTCTGCAATTGAACTTAAAAGGCTGTCGCCTCTCCTTCAGAA-3'.

[0036] The bases in bold italics in the sequence of SEQ ID NO: 1 or SEQ ID NO: 2 are the positions where SNP sites exist.

[0037] The present invention also provides a Cucurbita oleracea Indel molecular marker, wherein the Cucurbita oleracea Indel molecular marker has a deletion or insertion polymorphism of a nucleotide as shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0038] The present invention also provides amplification primers for the Indel molecular marker of the melon described in the above technical solution, and the nucleotide sequences of the upstream primer and the downstream primer of the amplification primer are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

[0039] The nucleotide sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4 of the present invention are as follows:

[0040] The nucleotide sequence shown in SEQ ID NO: 3 is: 5'-TCCCGTCATCGGCGAGTTTCT-3'; the nucleotide sequence shown in SEQ ID NO: 4 is: 5'-TTCTGAAGGAGAGGCGACAGC-3'.

[0041] The present invention also provides the use of the P. arguta gene described in the above technical solution, the P. arguta Indel molecular marker described in the above technical solution, or the amplification primer described in the above technical solution in one or more of the following reagents, kits, liquid phase probes, and chips for P. arguta detection. As one embodiment, the product of the present invention is a kit.

[0042] The present invention also provides a product for detecting melon, comprising the amplification primers described in the above technical solution; the product includes one or more of a reagent, a kit, a liquid phase probe, and a chip. As an embodiment, the product of the present invention is a kit. As an embodiment, the product of the present invention further includes a PCR amplification reagent. The present invention does not specifically limit the source and specifications of the PCR amplification reagent; PCR amplification reagents from conventional sources in the art can be used.

[0043] Based on the polymorphism of the pomelo gene in male and female pomelo plants, the present invention further provides a pomelo Indel molecular marker and an amplification primer for amplifying the pomelo Indel molecular marker. The pomelo Indel molecular marker and the amplification primer can efficiently identify the sex of pomelo plants with an accuracy of up to 100%. At the same time, the identification effect is applicable to pomeloes of different populations and different developmental stages, and can further realize the sex identification of pomeloes before flowering, which has high guiding value for the cultivation, breeding and large-scale production of pomelo.

[0044] Based on the above advantages, the present invention also provides the use of the pomelo gene described in the above technical solution, or the Indel molecular marker described in the above technical solution, or the amplification primer described in the above technical solution, or the pomelo detection product described in the above technical solution in identifying pomelo. As an embodiment, the identification of pomelo described in the present invention includes identifying the sex of pomelo. As an embodiment, the pomelo described in the present invention includes pomelo whose developmental stage is the seedling stage and / or before the seedling stage; as another embodiment, the pomelo is a pomelo whose developmental stage is the seedling stage. As an embodiment, the present invention performs the identification based on the PCR amplification band or PCR amplification sequence of the Indel molecular marker.

[0045] The present invention also provides a method for identifying the sex of a melon, comprising the following steps:

[0046] Using the genomic DNA of the to-be-tested melon as a template, PCR amplification is performed using the amplification primers described in the above technical solution to obtain a PCR amplification product;

[0047] Performing electrophoresis detection on the PCR amplification product to obtain an electrophoresis detection result;

[0048] The sex of the tested tangerine is identified according to the electrophoresis test result:

[0049] When the electrophoresis test results show a specific PCR amplification band of 369 bp, the tested tangerine is a male plant;

[0050] When the result of the electrophoresis test shows that there is no specific PCR amplification band of 369 bp, the tested tangerine is a female plant.

[0051] As an embodiment, the present invention extracts genomic DNA of the tested tangerine. The present invention does not particularly limit the extraction method of the genomic DNA, and can be extracted by conventional extraction methods in the field, such as extraction using a commercially available kit or the traditional CTAB method. As an embodiment, the tangerine to be tested in the present invention includes tangerines whose developmental stage is the seedling stage and / or before the seedling stage; as another embodiment, the tangerine is a tangerine whose developmental stage is the seedling stage. In a specific embodiment, the tangerine is a tangerine leaf in the seedling stage.

[0052] After obtaining the genomic DNA of the melon to be tested, the present invention performs PCR amplification using the amplification primers described in the above technical solution to obtain a PCR amplification product. As an embodiment, the PCR amplification system of the present invention includes the following components: 2×TaqPCRMasterMix 12.5μL, upstream primer 1μL with a concentration of 10μM / L, downstream primer 1μL with a concentration of 10μM / L, genomic DNA 1μL and ddH2O 9.5μL. As an embodiment, the PCR amplification procedure of the present invention is: pre-denaturation at 95℃ for 5min; denaturation at 95℃ for 30s, annealing at 55℃ for 30s, extension at 72℃ for 30s, for a total of 37 cycles; extension at 72℃ for 7min.

[0053] After obtaining the PCR amplification product, the present invention performs electrophoresis detection on the PCR amplification product to obtain an electrophoresis detection result. In one embodiment, the electrophoresis detection of the present invention is agarose gel electrophoresis detection; in another embodiment, the agarose gel is 1% to 2% agarose gel.

[0054] The present invention identifies the sex of the tested tangerine melon based on the results of the electrophoresis test: when the result of the electrophoresis test shows a 369bp specific PCR amplification band, the tested tangerine melon is a male plant; when the result of the electrophoresis test does not show a 369bp specific PCR amplification band, the tested tangerine melon is a female plant. As an embodiment, when the electrophoresis test results show other situations besides the above two situations, retesting is performed to confirm whether the problem is caused by the experimental operation.

[0055] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below with reference to the accompanying drawings and embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0056] Example 1

[0057] The steps for discovering the bollenmead gene are as follows:

[0058] 1. Sample Collection

[0059] The samples were 20 male and 24 female leaves of Cucurbita oleracea collected in Shangri-La in 2022. The collected leaf materials were preserved in silica gel for subsequent total DNA extraction and PCR amplification experiments.

[0060] 2. Genomic DNA Extraction and Resequencing

[0061] Genomic DNA was extracted from 20 male and 24 female individuals of the melon using the CTAB method. DNA quality and quantity were assessed using 0.8% agarose gel, a Nanodrop 2000 spectrophotometer, and a Qubit fluorescence spectrophotometer. Specifically, the A260 / A280 ratio of approximately 1.8 was used to assess DNA quality using the spectrophotometer, indicating that the DNA purity met the requirements for library construction and sequencing. The Qubit fluorescence spectrophotometer accurately quantified DNA, and the total amount of DNA required for a single library was greater than or equal to 10 ng.

[0062] Genomic DNA from each individual was randomly fragmented into 350-base-pair fragments. Libraries were prepared using the Vazyme NDM607-01 kit and paired-end sequencing was performed on the Illumina PE 150 platform.

[0063] Fastp 0.12.4 was used with default parameters to control the quality of the raw data and obtain clean data. Then, the read data from 20 male and 24 female plants were aligned with the reference genome using BWA0.7.17-r1188 and default parameters, and the duplicate read data were deduplicated using Picard software; Indel (insertion and deletion variation) detection was performed using the genome analysis software GATK4.2.2.0, and multiple specific genomic fragments were found in male samples of Ponzu, while female samples of Ponzu did not contain such specific genomic fragments. The nucleic acid sequences of the multiple genomic fragments are shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:9; At the same time, through comparison, it was found that the specific genomic fragments shown in SEQ ID NO:1 or SEQ ID NO:2 also had individual differences in different male samples of Ponzu, and there was a C / T polymorphic SNP site in some male samples of Ponzu (such as Figure 1 Therefore, the nucleotide sequence of this specific genomic fragment is shown in SEQ ID NO: 1 or SEQ ID NO: 2, and the SNP site is located at base position 145 of the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2. This specific genomic fragment has 86.42% similarity to the ethylene-responsive transcription factor 12 gene (NCBI: LOC111025114) from bitter melon (Momordica charantia).

[0064] The nucleotide sequence shown in SEQ ID NO:5 is as follows: 5'-GCCCTAGCTCACGGAATTTGTG AAGGTATATGGATTGACAGGATACTCGAAGAACTGAAATTATCTCAAAATGATCCTATACGAAAATATTGTGATAACAAGGCGATCATCGCTATAACTCATAATCATGTTCTACATGATAGGACAGCATATTGAAGTTGACAAGCATTTCATAAAGGAGAAGATTGATGCAGGTGTAATATGTTGTTAGGACACCACCTAACGGAATCAAGAACAACGATGTATTGCAATGAAAAGGTAAAAGAATTACAAGATAAGCAAGTGTTTAAAGGTACTTGCACCCTCCCATCTTGAGAACTATCTCAAGCCCTAATCCACTTAACCATTGACTACCTTCCTCTAATCTCACTCCCTCTATTTATAACCATATACTCTAACTAACTTCCTAAGTAATTACCCTATATGCCCTTACTACTAAACTTACAAAGGATAAACAACAATTAACCAATTAAGATAAAGATTTTGAAAAGATAAAACAGGCAAAAGATTTAGAAAGAGAACACCAGGAGGAAGCCTTCAGGCAGGCTGCTTCATACAATCTAGCC-3';

[0065] The nucleotide sequence shown in SEQ ID NO:6 is: 5'-AGGAGTGAGAAAGAGGCCGTG GGGGCGTTACGCAGCTGAGATTCGCGATCCATGGAAGAAGAGCAGGGTATGGCTCGGTACTTTTGACACACCGGAAGAGGCTGCTCATGCTTACGACGGAGCTGCCAGGTCTCTACGTGGTGCGAAAGCAAAAACTAACTTTCCCCCGCCGATTAAGGCTGGTCTCTCCTTCGACCTTAACGTCTCCTCTGGATCTCACTTGTGTACCTCCCACTCCGGTCATCCCGTCATCGGCGAGTTTCTTAACGCAGGTTCGCTCAAGGATGTGAGCTGTCCCGTCAACGAAGACCTCTCACTTTCAACTAACAAAGAATCTCCGTTTCTTGTCTCCCTTGGCGCTAATGAAAGCGTCAGTCATTCTGTGGCGTCGGAACCGTCTTCAACGACGTCGTTTCTAGGCATCATTCGGCGGGGCTTGCCCTTTGATCTCAACGAACCTCCGCCG-3';

[0066] The nucleotide sequence shown in SEQ ID NO:7 is: 5'-GCCCTAATCCACTTAACCATTGA CTACCTTCCTCTAATCTCACTCCCTCTATTTATAACCATATACTCTAACTAACTTCCTAAGTAATTACCCTATATGCCCTTACTACTAAACTTATCAACAAGTTGGCTATGGAAGATATCTACAAGCAAGCTCGAGGGGGAGTGTTGGATTTCCTTGATATCTTTTATAATATTTGTTGTGTATTATGTGTATAATTACTATTTTTTTTTAAACAGGACACAAAAGTTTTCATTGA-3';

[0067] The nucleotide sequence shown in SEQ ID NO:8 is as follows: 5'-CAATTGTTAGCCTAGTCCTAGTT CATTTCTGAAATTTCTGATTTTGGCTCCGACCTCTCTCTCTACTTTGTGAACGATTTCTCTTAAAGATTCTTCGCTCAACTGACTCTAACTCTCTCTCGTACTCTAGATTGGTCCATTGGTTTCAAAGATACTTGTTATTCTTACTTGCTTGTTTGTGGTGTAAAATAATGTTATTCTCTAAGAATTTGTGATTTCTGTTCTTGTCGCTATGTTTTAACTTGTGTTGGGTTTGTTGTTTTCCAGCTCTATGAATTTTGATTAGTTTTTCGGATGGCTTTATTTTTTCGTAGCTACTAAATGTTGTGGATCTGGAGTAGGCTTTTTTTTTTCTCTCCGAGATTATAATTTTTGTTTTACTTCTTTGCTTTCTTATGATTTTGTTCATTTTCTTACATGAGTCTGTTTGTTTTTTACAATTTTGTGGCATCTATGTTGTCTGAATTTGAACTTTGAAAATGCGGGACACATGTAATATTGGTTTGCATAAACTATTTCCATGTCTTGGACTGAGCCTCTGTTTCTTCTTAGATTACTTATTTTGTTCATTAAATTGGAGGAAGATACAACAGATTATTCAGGTGAAAGGAGTTTTTTGTAATACAAAAGCAGAAGTTTATAACTATTTGGTTGGCCGAGTAACAATGTTTGTTATTAACCTATTCTTAAACGGAAATTCCTAATA-3';

[0068] The nucleotide sequence shown in SEQ ID NO: 9 is: 5'-TAGCTAAAATTGTTGTACCTCGC -3'.

[0069] Example 2

[0070] Development of Indel markers and amplification primers for Ponzu (Ponzu) and identification of Ponzu sex

[0071] 1. Indel markers and amplification primers for P. melanocarpa

[0072] Based on the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 of the pear gene obtained in Example 1, the PCR primer pair M-219605R for identifying the sex of pear was designed using Oligo software. The primer information is shown in Table 1.

[0073] Table 1 Amplification primer pair M-219605R of the Indel marker of P. melanocarpa and its related information

[0074]

[0075] 2. Identification of the sex of the melon

[0076] 2.1 Sample collection

[0077] Leaf samples from 80 plants of the four populations were collected: 12 male and 12 female Melon species from the Shangri-La Alpine Botanical Garden in Yunnan; 12 male and 12 female Melon species from Wengshang Village in Shangri-La in Yunnan; 10 female and 12 male Melon species from Geza Village in Shangri-La in Yunnan; and 5 male and 5 female Melon species from Chentang in Tibet. All 80 samples were collected from mature Melon species. All leaf material was preserved in silica gel.

[0078] 2.2 Extraction of genomic DNA

[0079] The genomic DNA of the 80 plants in step 2.1 was extracted using the CTAB method.

[0080] 2.3 PCR amplification

[0081] Using the genomic DNA extracted in step 2.2 as a template, the PCR primers in step 1 were used to amplify M-219605R to obtain a PCR amplification product. The amplification system is as follows:

[0082] PCR amplification system:

[0083]

[0084] PCR amplification procedure:

[0085] Pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s, for a total of 37 cycles; extension at 72°C for 7 min.

[0086] 2.3 Electrophoresis detection

[0087] The PCR amplification products obtained in step 2.2 were detected by electrophoresis on 1% to 2% agarose gel and observed and recorded under ultraviolet light. Figure 2 As shown, Figure 2 The marker used in the experiment is BM5000+DNAMarker (the brand of the marker is Biomed). The markers used in the following comparative examples are the same and will not be described in detail.

[0088] Depend on Figure 2 It can be concluded that when the PCR primer pair M-219605R of the present invention was used to detect four population samples, male samples of P. melanocarpa had an amplification product of 369 bp, while female samples had no PCR product, and the detection accuracy rate reached 100%.

[0089] Comparative Example 1

[0090] Based on the nucleotide sequence shown in SEQ ID NO: 5 of the Ponzu gene obtained in Example 1, the PCR primer pair chr573789139 for identifying the sex of Ponzu was designed using Oligo software. The primer information is shown in Table 2.

[0091] Table 2 PCR primer pair nucleotide sequence of chr573789139

[0092] chr573789139 primer Sequence (5'-3') serial number Upstream primer GCCCTAGCTCACGGAATTTGTGAAG SEQ ID NO: 10 Downstream primer GGCTAGATTGTATGAAGCAGCCTGC SEQ ID NO:11

[0093] The primers in Table 2 were used to identify the sex of the melon. The detection samples, PCR amplification system, PCR amplification procedure and electrophoresis detection process were the same as in Example 2. The results are shown in FIG. Figure 3 shown.

[0094] Depend on Figure 3 It can be concluded that the PCR primer pair chr573789139 cannot accurately identify the gender of the tangerine peel sample.

[0095] Comparative Example 2

[0096] Based on the nucleotide sequence shown in SEQ ID NO: 6 of the Ponzu gene obtained in Example 1, the PCR primer pair 960-CDS-1 for identifying the sex of Ponzu was designed using Oligo software. The primer information is shown in Table 3.

[0097] Table 3 Nucleotide sequence of PCR primer pair 960-CDS-1

[0098] 960-CDS-1 primer Sequence (5'-3') serial number Upstream primer AGGAGTGAGAAAGAGGCCGTG SEQ ID NO:12 Downstream primer CGGCGGAGGTTCGTTGAGATC SEQ ID NO:13

[0099] The primers in Table 3 were used to identify the sex of the melon. The detection samples, PCR amplification system, PCR amplification procedure and electrophoresis detection process were the same as in Example 2. The results are shown in FIG. Figure 4 shown.

[0100] Depend on Figure 4 It can be concluded that the PCR primer pair 960-CDS-1 cannot accurately identify the gender of the Ponzu samples.

[0101] Comparative Example 3

[0102] Based on the nucleotide sequence shown in SEQ ID NO: 7 of the Ponzu gene obtained in Example 1, the PCR primer pair chr5-9-p1 for identifying the sex of Ponzu was designed using Oligo software. The primer information is shown in Table 4.

[0103] Table 4 Nucleotide sequence of PCR primer pair chr5-9-p1

[0104] chr5-9-p1 primer Sequence (5'-3') serial number Upstream primer GCCCTAATCCACTTAACCATTG SEQ ID NO:14 Downstream primer TCAATGAAAACTTTTGTGTCCTG SEQ ID NO:15

[0105] The primers in Table 4 were used to identify the sex of the melon. The detection samples, PCR amplification system, PCR amplification procedure and electrophoresis detection process were the same as in Example 2. The results are shown in FIG. Figure 5 shown.

[0106] Depend on Figure 5 It can be concluded that the PCR primer pair chr5-9-p1 cannot accurately identify the gender of the melon samples.

[0107] Comparative Example 4

[0108] Based on the nucleotide sequence shown in SEQ ID NO: 8 of the Ponzu gene obtained in Example 1, the PCR primer pair 6797098-1FA for identifying the sex of Ponzu was designed using Oligo software. The primer information is shown in Table 5.

[0109] Table 5 Nucleotide sequences of PCR primer pair 6797098-1FA

[0110] 6797098-1FA primer Sequence (5'-3') serial number Upstream primer CAATTGTTAGCCTAGTCCTAGTTCATTTC SEQ ID NO:16 Downstream primer TATTAGGAATTTCCGTTTAAGAATAGGTT SEQ ID NO: 17

[0111] The primers in Table 5 were used to identify the sex of the melon. The test samples, PCR amplification system, PCR amplification procedure and electrophoresis detection process were the same as in Example 2. The results are shown in Table 5. Figure 6 shown.

[0112] Depend on Figure 6 It can be concluded that the PCR primer pair 6797098-1FA cannot accurately identify the gender of the melon samples.

[0113] Comparative Example 5

[0114] Based on the nucleotide sequence shown in SEQ ID NO: 9 of the Ponzu gene obtained in Example 1, the PCR primer pair 21965-FS-5 for identifying the sex of Ponzu was designed using Oligo software. The primer information is shown in Table 6.

[0115] Table 6 Nucleotide sequence of PCR primer pair 21965-FS-5

[0116] 21965-FS-5 primer Sequence (5'-3') serial number Upstream primer TAGCTAAAATTGTTGTACCTCG SEQ ID NO: 18 Downstream primer TAGAGATGTCCATTTAACTTGCT SEQ ID NO: 19

[0117] The primers in Table 5 were used to identify the sex of the melon. The test samples, PCR amplification system, PCR amplification procedure and electrophoresis detection process were the same as in Example 2. The results are shown in Table 5. Figure 7 shown.

[0118] Depend on Figure 7 It can be concluded that the PCR primer pair 21965-FS-5 cannot accurately identify the gender of the melon samples.

[0119] From the above examples, it can be concluded that although the genomic fragments shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9 obtained by sequencing are all genomic fragments that specifically exist in male plants of Ponzu and do not exist in female plants of Ponzu, a large number of experiments have verified that the genomic fragments shown in SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9 and the primers designed based on them cannot achieve the function of distinguishing the sex of Ponzu. It can be seen that the Ponzu Indel molecular markers and primers described in the present invention can achieve specific amplification of the Ponzu gene and accurately distinguish the sex of Ponzu with an accuracy rate of 100%.

[0120] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. Amplification primers for Indel molecular markers for identifying the sex of Herpetospermum pedunculosum, characterized in that, The nucleotide sequences of the upstream primer and the downstream primer of the amplification primer are shown in SEQ ID NO:3 and SEQ ID NO:4 respectively.

2. Use of the amplification primer according to claim 1 in the preparation of a reagent or kit for detecting the sex of Herpetospermum pedunculosum.

3. A Herpetospermum pedunculosum sex detection product, characterized in that The product comprises the amplification primer according to claim 1; the type of the product is a reagent or a kit.

4. Use of the amplification primer according to claim 1 or the Herpetospermum pedunculosum sex detection product according to claim 3 in identifying the sex of Herpetospermum pedunculosum, characterized in that, When a specific PCR amplification band of 369 bp is present in the amplification product, the Herpetospermum pedunculosum to be tested is a male plant; when a specific PCR amplification band of 369 bp is not present in the amplification product, the Herpetospermum pedunculosum to be tested is a female plant.

5. The application according to claim 4, wherein The Herpetospermum pedunculosum includes Herpetospermum pedunculosum at the seedling stage and / or before the seedling stage.

6. A method for identifying the gender of Herpetospermum pedunculosum, characterized in that, Comprising the following steps: Using the genomic DNA of the Herpetospermum pedunculosum to be tested as a template, and performing PCR amplification with the amplification primer according to claim 1 to obtain a PCR amplification product; Performing electrophoresis detection on the PCR amplification product to obtain an electrophoresis detection result; Identifying the sex of the Herpetospermum pedunculosum to be tested according to the electrophoresis detection result: When a specific PCR amplification band of 369 bp is present in the result of the electrophoresis detection, the Herpetospermum pedunculosum to be tested is a male plant; When a specific PCR amplification band of 369 bp is not present in the result of the electrophoresis detection, the Herpetospermum pedunculosum to be tested is a female plant.

Images