EB virus nucleic acid detection kit based on digital PCR method

Abstract

The invention relates to an EB (Epstein-Barr) virus nucleic acid detection kit based on a digital PCR (Polymerase Chain Reaction) (dPCR) method and a use method thereof. The detection kit comprises a dPCR primer premix solution, and the dPCR primer premix solution comprises a primer and a probe of the EB virus and further comprises a primer and a probe of an internal standard. The detection kit provided by the invention is matched with a digital PCR instrument for use, has the advantages of high specificity, good accuracy, avoidance of missing detection and the like, and is especially suitable for detection of EB virus DNA in a peripheral blood sample.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology, and in particular to an Epstein-Barr virus nucleic acid detection kit based on a digital PCR (dPCR) method. Background Art

[0002] Epstein-Barr virus (EBV), also known as human gammaherpesvirus IV, belongs to the family of herpesviruses and is a herpesvirus that is tropic to human lymphocytes. EBV is a double-stranded DNA virus with a genome length of about 172kb. It is a linear molecule in the virus particle. After entering the infected cell, its DNA becomes circular and can replicate itself. Latently infected EBV in lymphocytes can express: 2 types of RNA that are not translated into proteins (EBV-encoded RNAs, EBERs), including EBER1 and EBER2; 6 types of nuclear antigens, including EBNA1, EBNA2, EBNA3A, EBNA3B, EBNA3C and LP; 2 types of latent membrane proteins (latent membrane proteins, LMPs), including LMP1 and LMP2A / B.

[0003] EB virus has the biological characteristics of specifically infecting human and certain primate B cells in vitro and in vivo, and it is mainly transmitted through saliva. Asymptomatic infection often occurs in young children. More than 90% of children aged 3 to 5 have been infected with EB virus, and more than 90% of adults have antibodies to the virus, which are mostly latent infections. EB virus infection is widespread in the human population. It mainly infects epithelial cells and B lymphocytes in the human oropharynx. It is closely related to infectious mononucleosis, African childhood malignant lymphoma (Burkitt lymphoma), nasopharyngeal carcinoma and other diseases, and is listed as one of the human tumor viruses that may cause cancer.

[0004] At present, the most common test for EB virus is the serological test for specific antibodies. This method is based on the specific binding reaction between antibodies and antigens, and the infection of EB virus is determined by detecting the antibody level in the serum. However, the test results of this method are affected by the immune ability of the person himself. People with weak immune ability may not be able to produce enough antibodies, which may lead to inaccurate test results. Secondly, there are methods such as cell culture detection and in situ hybridization detection, which can more directly detect the EB virus itself or its nucleic acid. However, the detection rate of these methods may be affected by factors such as uneven distribution of the virus in the body and low viral load, making it difficult to accurately detect, and methods such as cell culture and in situ hybridization also have the disadvantages of complex operation and long detection time.

[0005] As a popular molecular detection method, fluorescent quantitative PCR has the advantages of being simple and fast, but the quantification of this method needs to rely on a standard curve, and the copy number or concentration of the target gene is determined by comparing the fluorescence signal intensity of the unknown sample with the standard sample. Because different experimental conditions, reagent batches, and instrument performance may affect the accuracy of the standard curve, the quantitative results of fluorescent quantitative PCR are relatively certain. In addition, when the amount of EB virus is very small, the fluorescence signal generated by the target molecule during the PCR amplification process is very weak and easily affected by background noise, resulting in the sensitivity of this detection method being limited.

[0006] Therefore, there is still a need in the art for a virus detection method with higher sensitivity. Summary of the invention

[0007] In order to improve the sensitivity of EB virus nucleic acid detection, the present invention adopts the method of digital PCR. Digital PCR technology is called the "third generation" PCR technology in the industry. Unlike qPCR, digital PCR technology disperses the diluted reaction system into multiple separated tiny independent reaction units (droplets), each of which contains or does not contain target molecules. After PCR amplification is completed, the fluorescent signals of all droplets are identified and counted to obtain the number of negative and positive droplets. The concentration of the target molecule is calculated by the Poisson distribution principle, thereby achieving absolute quantification of the target molecule. The result judgment of digital PCR does not depend on the standard curve and is not affected by the PCR amplification efficiency. In addition, the digital PCR detection system uses droplet processing to separate rare detection fragments from a large amount of complex background, and the detection sensitivity and accuracy are further improved.

[0008] However, in the actual development of the EB virus nucleic acid detection kit, the design of the primer probe combination encountered some problems: the conventional Taqman probe design method is used, and the design of the upstream and downstream primers is difficult. Because the Taqman probe not only needs to match the target nucleic acid (that is, specifically bind), but also the matching position is the position between the target nucleic acid matched by the upstream primer and the downstream primer, resulting in a smaller design space for the upstream and downstream primers and greater design difficulty. In addition, the primer design also needs to meet some other requirements, such as the GC content within 45% to 55%, avoiding mismatched bases, avoiding continuous repeated bases, the primer Tm value within the appropriate range, avoiding primer dimers, etc., which further increases the difficulty of designing the upstream and downstream primers.

[0009] To this end, the present invention has innovatively designed the primer-probe combination in the kit: the probe does not match the target nucleic acid of the EB virus, and only the upstream primer and the downstream primer match the target. The advantage of such a design is that the difficulty of designing the upstream and downstream primers is greatly reduced.

[0010] However, the above-mentioned improvements alone are far from sufficient for the product development of the Epstein-Barr virus nucleic acid detection kit.

[0011] This kit is designed based on the digital PCR method and needs to be used in conjunction with a digital PCR instrument. A digital PCR instrument refers to an instrument that can generate droplets and spread them in reaction wells, perform PCR amplification, and perform fluorescent photography on the reaction wells. Because the digital PCR instrument takes fluorescent photos of the droplets spread in the reaction wells at the end of the PCR reaction. When taking fluorescent photos, some interesting phenomena were unexpectedly discovered: compared with lower photography temperatures, higher photography temperatures can obtain clearer photo results (both negative and positive droplets can be identified more clearly). Therefore, in order to obtain clearer photography results, try using very low-temperature photography methods, for example, taking photos at a temperature above room temperature of 25°C, or taking fluorescent photos at 40-60°C.

[0012] However, some new problems have been discovered with this very warm photography method: while higher photography temperatures yield clearer negative droplet photo results, they also increase the brightness of negative droplets, leading to increased fluorescent background, unclear threshold division, and even incorrect judgment of positive and negative droplets, affecting the accuracy of detection results.

[0013] In order to find out the reason why the brightness of negative droplets increases with the increase of photographing temperature, after many attempts, it was finally found that by improving the structure of the probe, it is possible to reduce the fluorescence intensity of negative droplets without reducing the fluorescence brightness of positive droplets, making the threshold division of positive and negative droplets clearer.

[0014] Based on this, one of the purposes of the present invention is to provide an Epstein-Barr virus nucleic acid detection kit based on a digital PCR method. The kit includes a dPCR primer premix, which includes primers and probes for Epstein-Barr virus and internal standards; wherein, The upstream primer F of Epstein-Barr virus is: ACCTTGCTCGTATCTCTTCCAGACGAATTCGTGGTGGTGACGGGCCCCGCAGATGACCC; The downstream primer R of EB virus is: GTCCAGTGCTTGGGCCTT; The probe P for EB virus is: CCAGACGAATTCGTGGTGGTGACGGGTCTGG; The upstream primer F0 of Epstein-Barr virus is: ACCTTGCTCGTATCTCTT.

[0015] The above-mentioned "based on digital PCR method" means that the use of the kit is based on the principle of digital PCR, and the kit is used in conjunction with a digital PCR instrument. In certain embodiments, the digital PCR method refers to the use of the kit in conjunction with a photographic digital PCR instrument. In certain embodiments, the digital PCR instrument refers to an instrument that uses vibration-type droplet generation technology to generate droplets and spreads them into reaction wells, and performs overall fluorescence photography detection on the reaction wells after amplification. In certain embodiments, the digital PCR instrument is the D 600 series digital PCR analysis system produced by Mike Biotech.

[0016] In certain embodiments, the concentration of the upstream primer F0 of Epstein-Barr virus in the above-mentioned dPCR primer premix is ​​the same as the concentration of its downstream primer R; the concentration of the upstream primer F0 of Epstein-Barr virus in the dPCR primer premix is ​​4 to 10 times the concentration of its upstream primer F; the concentration of the upstream primer F0 of Epstein-Barr virus in the dPCR primer premix is ​​2 to 5 times the concentration of its probe P.

[0017] In certain embodiments, the dPCR primer premix further includes internal standard primers and probes. The upstream primer of the internal standard is: CTCAGCTCCAGAGGATGT; The downstream primer of the internal standard is: CCTGGATGGTCTTTAAGAAGGAAAGATC; The internal standard probe is: TCCAAATTCCCAAGGACCACC; The fluorescent group modified with the internal standard probe is different from that of the EB virus probe.

[0018] In certain embodiments, in the above dPCR primer premix, the fluorescent reporter gene modified at the 5' end of the Epstein-Barr virus probe is ROX, and the quencher group modified at the 3' end is BHQ2; the fluorescent reporter group modified at the 5' end of the internal standard probe is HEX, and the quencher group modified at the 3' end is BHQ1.

[0019] In certain embodiments, the concentrations of the upstream primer and the downstream primer of the internal standard in the dPCR primer premix are the same; the concentrations of the upstream primer and the probe of the internal standard in the dPCR primer premix are the same as the concentrations of the upstream primer F0 and the probe P of the Epstein-Barr virus, respectively; the working concentrations of the primers and the probe of the Epstein-Barr virus and the internal standard in the dPCR primer premix are 50-1000 nM, respectively (that is, the working concentrations of the primers and the probe of the Epstein-Barr virus and the internal standard in the dPCR primer premix are both within the range of 50-1000 nM).

[0020] In certain embodiments, the working concentrations of the primers and probes for Epstein-Barr virus and internal standard in the above dPCR primer premix are: Epstein-Barr virus upstream primer F: 80 nM; EB virus downstream primer R: 400nM; Epstein-Barr virus probe P: 200 nM; Epstein-Barr virus upstream primer F0: 400 nM; Upstream primer of internal standard: 400 nM; Downstream primer of internal standard: 400 nM; Internal standard probe: 200 nM.

[0021] In certain embodiments, the above-mentioned Epstein-Barr virus nucleic acid detection kit also includes a blank control, a negative control and a positive control; the blank control is nuclease-free water; the negative control is 100 copies / μL of human genomic DNA; the positive control contains 100 copies / μL of Epstein-Barr virus standard plasmid and 100 copies / μL of human genomic DNA.

[0022] Another object of the present invention is to provide a method for using an Epstein-Barr virus nucleic acid detection kit, comprising the following contents: (1) Mixing the dPCR primer premix of the present invention with an amplification reagent and a sample to be tested to obtain a reaction system; the amplification reagent includes a DNA polymerase and dNTPs; (2) randomly distributing the reaction system into more than 5,000 droplets, some of which contain the target of the sample to be tested, and the remaining droplets do not contain the target of the sample to be tested; the droplets are spread evenly in the reaction well; (3) Performing PCR amplification on the droplets in the reaction well; (4) Perform fluorescence photography on the reaction wells and obtain the number of targets in the sample to be tested based on the number of droplets with signals in the reaction wells.

[0023] In step (2), “some droplets contain the target of the sample to be tested, and the remaining droplets do not contain the target of the sample to be tested” means that each droplet contains the target of the sample to be tested or does not contain the target of the sample to be tested. Theoretically, each droplet contains at most 1 target of the sample to be tested. However, in actual operation, a very small number of droplets may contain 2 or a few targets of the sample to be tested. The situation where a droplet contains multiple targets is very rare and has little effect on the calculation of the target quantitative value. Therefore, each droplet containing 0 target, 1 target, 2 targets or a few targets is within the scope of protection of the present invention.

[0024] In some embodiments, the amplification reagent in step (1) includes DNA polymerase and dNTPs. In some embodiments, the amplification reagent may also include some reagents that promote PCR reaction, such as KCl, MgCl2, Tris-HCl, trehalose, (NH4)2SO4, etc.

[0025] In certain embodiments, the PCR amplification procedure in step (3) is: 95°C for 2 min; 95°C for 20 sec, 56°C for 30 sec, 30 to 50 cycles. In certain embodiments, the PCR amplification procedure is: 95°C for 2 min; 95°C for 20 sec, 56°C for 30 sec, 45 cycles.

[0026] In certain embodiments, the PCR amplification in step (3) includes the following: the upstream primer F and the downstream primer R of the Epstein-Barr virus specifically bind to the Epstein-Barr virus target and extend to generate a first amplicon; the first amplicon specifically binds to the upstream primer F0 and the probe, respectively, and during the extension of the upstream primer F0 with the first amplicon as the target, the probe is hydrolyzed, causing the fluorescent reporter group modified on the probe to emit light.

[0027] In some embodiments, the fluorescence photography in step (4) refers to placing the reaction well at a temperature of 40-60° C. for fluorescence photography. In some embodiments, the reaction well is placed at a temperature of 58° C. for fluorescence photography.

[0028] In certain embodiments, in step (4), the reaction wells are photographed for fluorescence detection, and the quantitative value of the target in the sample to be tested is calculated according to the number of droplets with signals and the number of droplets without signals in the reaction wells according to the Poisson distribution.

[0029] Beneficial Effects The advantages of the EB virus nucleic acid detection kit based on the digital PCR method of the present invention are: (1) Low difficulty in primer design and high specificity: The probe in the detection kit of the present invention is not identical or complementary to the EB target nucleic acid, and the probe is a sequence that is completely unrelated to the EB target nucleic acid. The design of the primer of the present invention is not limited by the probe, has low design difficulty, better specific binding with the EB target nucleic acid, and high specificity of the primer; the design of the probe of the present invention is not limited by the target, has a greater sequence difference with other nucleic acids (for example, HCV, HIV), and has high specificity of the probe; (2) Low requirement for target length: The length of the amplicon formed after the primers in the detection kit of the present invention bind to the target is 30-40 bp. When the length of the target is above 30-40 bp, it can be accurately detected, and is particularly suitable for the detection of EB virus DNA in peripheral blood samples; (3) Good accuracy: Based on the digital PCR method, the present invention optimizes the design of the primer probes in the detection kit, and the detection result has a low negative background, high signal-to-noise ratio and signal aggregation, and high detection accuracy; (4) Avoiding missed detection: The EBNA1 gene is a gene that is continuously expressed in EB virus-related cancers (nasopharyngeal carcinoma, Hodgkin lymphoma, Burkitt lymphoma) and is also the key to EB virus replication. The present invention designs specific primers and fluorescent probes for the highly conserved EBNA1 gene sequence in different strains of EB virus, which can avoid the possibility of missed detection and is suitable for detecting EB virus DNA in human whole blood, serum and plasma samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The result of fluorescence photography at 25°C in Example 2 (droplet image); Figure 2 The result of the fluorescence photography at 58°C in Example 2 (droplet image); Figure 3 The result of fluorescence photography at 58°C in Example 2 (ROX channel); Figure 4 The results of the specificity test in Example 3 (ROX channel); Figure 5 The detection result of the first set of primer probe groups in Example 4 (ROX channel); Figure 6 The detection result of the second set of primer probe groups in Example 4 (ROX channel); Figure 7 The detection result of the third set of primer probe groups in Example 4 (ROX channel); Figure 8 This is the detection result of the fourth set of primer probe groups in Example 4 (ROX channel). DETAILED DESCRIPTION

[0031] The present invention will be described in detail below in conjunction with specific implementations and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific implementations and examples are used to illustrate the present invention, rather than to limit the present invention.

[0032] Example 1 The invention provides an Epstein-Barr virus nucleic acid detection kit based on a digital PCR method.

[0033] 1. Kit composition The kit consists of: dPCR primer premix, blank control, negative control and positive control. The dPCR primer premix contains primers and probes for Epstein-Barr virus and internal standard; the main component of the blank control is nuclease-free water; the negative control is 100 copies / μL human genomic DNA; the positive control contains 100 copies / μL of Epstein-Barr virus standard plasmid and 100 copies / μL of human genomic DNA.

[0034] The specific sequences of the primer probes included in the dPCR primer premix are shown in Table 1 (the amplicon length of EB is 39 bp): wherein Human-F, Human-R and Human-P are primer probes for internal standards.

[0035] Table 1 Primer / probe name Serial Number Sequence (5'-3') Modification EB-F SEQ ID NO.1 ACCTTGCTCGTATCTCTTCCAGACGAATTCGTGGTGGTGACGGGCCCCGCAGATGACCC / EB-R SEQ ID NO.2 GTCCAGTGCTTGGGCCTT / EB-P SEQ ID NO.3 CCAGACGAATTCGTGGTGGTGACGGGTCTGG 5'ROX, 3'BHQ2 EB-F0 SEQ ID NO.4 ACCTTGCTCGTATCTCTT / Human-F SEQ ID NO.5 CTCAGCCTCCAGAGGATGT / Human-R SEQ ID NO.6 CCTGGATGGTCTTTAAGAAGGAAAGATC / Human-P SEQ ID NO.7 TCCAAATTCCCAAGGACCACC 5'HEX, 3'BHQ1 2. How to use the kit The method of using the EB virus nucleic acid detection kit of the present invention is as follows: 2.1 Reagent preparation (performed in the reagent preparation area) 2.1.1 Take out each component from the kit, place it at room temperature, wait for the temperature to equilibrate to room temperature, mix well, and centrifuge for standby use.

[0036] 2.2 Sample processing (carried out in the sample processing area) 2.2.1 Extraction of cell-free nucleic acid (cfDNA) from plasma samples Plasma samples were extracted using the magnetic bead-based large-volume free nucleic acid extraction kit (Tiangen, DP710-01) produced by Tiangen Biochemical Technology (Beijing) Co., Ltd. The specific operation steps were carried out according to its product instructions.

[0037] 2.2.2 Sample addition Add 10 μL of blank control, positive control and nucleic acid of the sample to be tested to the PCR reaction tube with dPCR primer premix and amplification reagent to form a reaction system with a final volume of 25 μL. Cover the tube tightly, mix well, centrifuge at low speed to remove bubbles and set aside.

[0038] Each reaction system includes the following working concentrations of dPCR primer premix and amplification reagent, as shown in Table 2: Table 2

[0039] 2.3 Droplet preparation, PCR amplification and photo detection based on digital PCR instrument Place the PCR reaction tube with the sample added on the sample rack of the digital PCR instrument for droplet preparation and PCR amplification; droplet preparation is to randomly distribute the reaction system into more than 5,000 droplets, each droplet contains the target of the sample to be tested or does not contain the target of the sample to be tested, and the above droplets are spread in the reaction well. Perform PCR amplification on each droplet in the reaction well, and the reaction conditions are: denaturation at 95℃ for 2min; denaturation at 95℃ for 20sec, extension at 56℃ for 30sec, and a total of 30 to 50 cycles.

[0040] After PCR amplification is completed, the reaction wells are photographed for fluorescence detection, and the number of targets in the sample to be tested is obtained based on the number of droplets with signals in the reaction wells.

[0041] For example, the D 600 series digital PCR analysis system of MicroBio can be used for droplet preparation, PCR amplification and photo detection. The specific contents are as follows: 2.3.1 Page Settings Open the application software, select Design-Task in sequence, select the sample tube and the corresponding position; in the property item, select the probe method for the experimental method, select 20k for the number of single sample droplets, and select 1nL for the droplet volume; in the program item, check Oiling-Printing-PCR temperature control, check Constant temperature photography, and set the temperature to 58°C; check Customization in the print item, check Synchronous printing of the photography position in the photography position item; select the corresponding wells in the print position and photography position; set the photography option item as shown in Table 3, and click Apply.

[0042] Table 3

[0043] 2.3.2 Set the PCR program and cycle parameters in the method interface. The settings are shown in Table 4: Table 4

[0044] 2.3.3 After the settings are completed, save the file, click Run-Confirm Consumables, open the caps of the PCR 8-tube strips in turn, and put the PCR 8-tube strips into the instrument sample slot; confirm the injection needle and position; put the waste liquid box, liquid removal cotton and 32-well plate in place. Click Start Experiment, and then confirm the Run Experiment again to start running.

[0045] 2.4. Results The results are automatically saved after the test is completed. The thresholds of different targets are adjusted according to the corresponding blanks (the principle of setting the threshold line is to just exceed the fluorescence background value of the blank control, and the highest point of the fluorescence background value of the sample is taken as the basis). The results are viewed in the analysis data interface.

[0046] Results of blank control: no positive droplets in ROX channel and HEX channel; negative control: no positive droplets in ROX channel, and obvious aggregation of positive droplets in HEX channel; results of positive control: obvious aggregation of positive droplets in ROX channel, and obvious aggregation of positive droplets in HEX channel.

[0047] Example 2 Photographic Temperature Screening of EB Virus Nucleic Acid Detection Kit The Epstein-Barr virus nucleic acid detection kit of Example 1 was tested according to the method of Example 1. The detection object was 100 copies / μL of Epstein-Barr virus plasmid, and the photography temperature was set to 25°C and 58°C respectively (that is, the fluorescence channel photography was performed at 25°C and 58°C respectively). The droplet image of the fluorescence photography at 25°C is as follows: Figure 1 As shown; the droplet image taken by fluorescence at 58℃ is shown Figure 2 As shown, the 1D graph of its ROX channel is as follows Figure 3 shown.

[0048] from Figure 1 and Figure 2 It can be seen that when taking pictures at room temperature (25°C), only positive droplets can be identified, and negative droplets cannot be accurately identified, which affects the accuracy of the target nucleic acid quantitative value; when taking pictures at 58°C, negative droplets and positive droplets can be well identified.

[0049] And, from Figure 3 It can be seen that by using the EB virus nucleic acid detection kit of the present invention, fluorescence photography is performed at 58° C., and the negative background obtained is low and the positive signal concentration is high, achieving a good signal-to-noise ratio and a clear threshold division effect.

[0050] Example 3 Specificity test of EB virus nucleic acid detection kit 1. Solution (1) E4 copies / mL (E4 represents 10 to the fourth power) of HIV, HBV, and HCV standard substances were extracted, 10 μL of the sample was added to each reaction, and the HIV, HBV, and HCV samples were tested using the Epstein-Barr virus nucleic acid detection kit of Example 1; at the same time, Epstein-Barr virus plasmid and negative control substances were used as controls; (2) Negative results of HIV, HBV, and HCV samples were used as the standard for evaluating reagent specificity; (3) Instruments and equipment: MicroBio D600 digital PCR analysis system.

[0051] 2. Results The test results are shown in Table 5 and Figure 4 shown. Figure 4The test sample 1 is HBV, the test sample 2 is HCV, the test sample 3 is HIV, the test sample 4 is EB, and the test sample 5 is a negative control.

[0052] Table 5

[0053] 3. Conclusion From Table 5 and Figure 4 It can be seen that the EB virus nucleic acid detection kit of the present invention detects HIV, HBV, and HCV standard substances with a concentration of E4 copies / ml without false positive droplets, indicating that the specific performance of the kit of the present invention is good. In addition, since the analysis software version used by the D 600 digital PCR analysis system in this embodiment is different from that in Example 2, the vertical coordinate reference value is different, but it does not affect the signal-to-noise ratio and the quantitative value.

[0054] Example 4 Primer and probe screening for EB virus nucleic acid detection kit Four sets of specific primer probe groups were designed for the EBNA1 gene sequence of EB virus, and they were mixed with internal standard primer probes (SEQ ID NO.5-7) in one tube to perform digital PCR detection on EB virus plasmid. Except that the primer probe sequence of EB virus was different from that in Example 1, the dosage of primer probes, other components and their contents, and the specific detection method were the same as those in Example 1.

[0055] The sequences of the initial screening primer probe set are shown in Table 6: Table 6

[0056] In the primer probe sets in Table 6, the probes are not complementary to the target nucleic acid of EB virus, and the probes are identical to the 5' end of the upstream primer F. Among them, the probes in the first set of primer probe sets cannot form a stem-loop structure by themselves; the probes in the second, third and fourth sets of primer probe sets can form a stem-loop structure by themselves, and the sequences of the probes and F0 are the same. The difference between these three sets of primer probe sets lies mainly in the different positions where the upstream and downstream primers match the target.

[0057] The above four sets of primer probes were mixed with internal standard primer probes (SEQ ID NO. 5-7) and then digital PCR was performed. The test results were as follows: Figures 5 to 8 As shown in the figure, test samples 7, 8, 11, 12, 19, and 20 are blank controls (NTC), and the remaining test samples are all EB virus positive samples.

[0058] from Figures 5 to 8It can be seen that: the positive signal and negative signal in the first set of primer-probe combination are not clearly divided, and the positive signal value is low, which may be related to the low luminescence efficiency of the probe in this set of primer-probe combination; the threshold division of the fourth set of primer-probe combination is relatively clear, which can well distinguish positive and negative signals, but there are problems such as poor aggregation of positive signals and low signal-to-noise ratio; the EB virus positive signal of the second and third sets of primer-probe groups is focused, with a high signal-to-noise ratio (4:1), but there is 1 false positive droplet in NTC. Therefore, the sequences of the above four sets of primer-probe groups need to be further improved.

Claims

1. A Epstein-Barr virus nucleic acid detection kit based on a digital PCR method, comprising a dPCR primer premix, wherein the dPCR primer premix comprises primers and probes of Epstein-Barr virus; characterized in that: The upstream primer F of the Epstein-Barr virus is: ACCTTGCTCGTATCTCTTCCAGACGAATTCGTGGTGGTGACGGGCCCCGCAGATGACCC; The downstream primer R of the EB virus is: GTCCAGTGCTTGGGCCTT; The Epstein-Barr virus probe P is: CCAGACGAATTCGTGGTGGTGACGGGTCTGG; The upstream primer F0 of the Epstein-Barr virus is: ACCTTGCTCGTATCTCTT.

2. The Epstein-Barr virus nucleic acid detection kit according to claim 1, characterized in that: The concentration of the upstream primer F0 of Epstein-Barr virus in the dPCR primer premix is ​​the same as the concentration of its downstream primer R; the concentration of the upstream primer F0 of Epstein-Barr virus in the dPCR primer premix is ​​4 to 10 times the concentration of its upstream primer F; the concentration of the upstream primer F0 of Epstein-Barr virus in the dPCR primer premix is ​​2 to 5 times the concentration of its probe P.

3. The Epstein-Barr virus nucleic acid detection kit according to claim 1, characterized in that: The dPCR primer premix also includes internal standard primers and probes. The upstream primer of the internal standard is: CTCAGCTCCAGAGGATGT; The downstream primer of the internal standard is: CCTGGATGGTCTTTAAGAAGGAAAGATC; The internal standard probe is: TCCAAATTCCCAAGGACCACC; The fluorescent group modified with the internal standard probe is different from that of the EB virus probe.

4. The Epstein-Barr virus nucleic acid detection kit according to claim 3, characterized in that: The fluorescent reporter gene modified at the 5' end of the EB virus probe is ROX, and the quencher group modified at the 3' end is BHQ2; the fluorescent reporter group modified at the 5' end of the internal standard probe is HEX, and the quencher group modified at the 3' end is BHQ1.

5. The Epstein-Barr virus nucleic acid detection kit according to claim 3, characterized in that: The concentrations of the upstream primer and the downstream primer of the internal standard in the dPCR primer premix are the same; the concentrations of the upstream primer and the probe of the internal standard in the dPCR primer premix are the same as the concentrations of the upstream primer F0 and the probe P of the Epstein-Barr virus, respectively; the working concentrations of the primers and the probe of the Epstein-Barr virus and the internal standard in the dPCR primer premix are 50-1000 nM, respectively.

6. The Epstein-Barr virus nucleic acid detection kit according to claim 5, characterized in that: The working concentrations of the primers and probes for EB virus and internal standard in the dPCR primer premix are: Epstein-Barr virus upstream primer F: 80 nM; EB virus downstream primer R: 400nM; Epstein-Barr virus probe P: 200 nM; Epstein-Barr virus upstream primer F0: 400 nM; Upstream primer of internal standard: 400 nM; Downstream primer of internal standard: 400 nM; Internal standard probe: 200 nM.

7. The Epstein-Barr virus nucleic acid detection kit according to claim 1, characterized in that: The detection kit also includes a blank control, a negative control and a positive control; the blank control is nuclease-free water; the negative control is 100 copies / μL of human genomic DNA; the positive control contains 100 copies / μL of Epstein-Barr virus standard plasmid and 100 copies / μL of human genomic DNA.

8. The method for using the Epstein-Barr virus nucleic acid detection kit according to any one of claims 1 to 7, characterized in that: It includes the following: (1) Mixing the dPCR primer premix according to any one of claims 1 to 6 with an amplification reagent and a sample to be tested to obtain a reaction system; the amplification reagent comprises a DNA polymerase and dNTPs; (2) randomly distributing the reaction system into more than 5,000 droplets, some of which contain the target of the sample to be tested, and the remaining droplets do not contain the target of the sample to be tested; the droplets are spread evenly in the reaction well; (3) Performing PCR amplification on the droplets in the reaction well; (4) Perform fluorescence photography on the reaction wells and obtain the number of targets in the sample to be tested based on the number of droplets with signals in the reaction wells.

9. The method of use according to claim 8, characterized in that: The procedure of PCR amplification in step (3) is: React at 95℃ for 2min; react at 95℃ for 20sec, react at 56℃ for 30sec, and repeat for 30~50 cycles.

10. The method of use according to claim 8, characterized in that: The fluorescence photography described in step (4) refers to placing the reaction well at a temperature of 40 to 60° C. for fluorescence photography.

Images