A porcine chimeric embryo culture medium and its application in effectively enhancing the in vitro chimeric ability of porcine embryonic stem cells.

By adjusting the composition of the porcine chimeric embryo culture medium and combining it with auxiliary technologies, the problem of low chimeric efficiency of porcine embryonic stem cells in existing technologies has been solved, achieving efficient synchronous development and integration of stem cells and embryos, and improving chimeric efficiency and survival rate.

CN119351317BActive Publication Date: 2026-01-06HUAZHONG AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411586849.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-08
Publication Date
2026-01-06
Estimated Expiration
2044-11-08

AI Technical Summary

Technical Problem

Existing porcine embryonic stem cell chimerism technology suffers from high in vivo operation costs and complexity, and the culture medium cannot provide a suitable growth environment, resulting in limited survival rate and functional integration ability of stem cells in the embryo, thus affecting the developmental potential of chimeric embryos.

Method used

By adjusting the composition of the porcine chimeric embryo culture medium, including removing XAV-939 and WH-4-023, adding Y-27632 and activin A, and combining it with fetal bovine serum, the culture medium composition was optimized to promote the synchronous development of stem cells and embryos. At the same time, chimeric conditions were optimized by overexpressing the anti-apoptotic factor BCL2, fluorescently labeled mCherry, microinjection, and laser-assisted hatching techniques.

Benefits of technology

It significantly enhances the proliferation and differentiation capacity of stem cells, creates an ideal growth environment, promotes the overall development of the embryo, improves chimerism efficiency and survival rate, and supports the integration of stem cells and embryos.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119351317B_ABST
    Figure CN119351317B_ABST
Patent Text Reader

Abstract

The application discloses a pig chimeric embryo culture medium and application thereof in effectively improving in-vitro chimeric ability of pig embryo stem cells, and belongs to the technical field of bioengineering.The pig chimeric embryo culture medium is characterized in that growth factors, nutrients and other key components in the culture medium are accurately controlled, so that a neutral culture environment for promoting synchronous development of stem cells and embryos is created.On this basis, the application combines overexpression of anti-apoptotic factors, optimization of microinjection conditions and adoption of laser-assisted hatching means, so as to further improve chimeric efficiency, effectively support integration of stem cells and embryos and improve chimeric efficiency, thereby providing a reliable in-vitro tool for evaluating chimeric ability and pluripotency of pig stem cells.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, and more specifically to a porcine chimeric embryo culture medium and its application in effectively enhancing the in vitro chimeric ability of porcine embryonic stem cells. Background Technology

[0002] Stem cell chimerism has become a key method in regenerative medicine and transgenic animal production. By injecting exogenous stem cells into embryos, stem cells are integrated with embryonic cells, allowing them to fulfill their functions during embryonic development. This provides an important pathway for studying embryonic development and producing transgenic animals. In large animals such as pigs, this technology not only enhances the regenerative potential and gene modification efficiency of chimeric individuals but also provides an effective in vitro tool for assessing the chimeric capacity and pluripotency of stem cells.

[0003] However, existing porcine embryonic stem cell chimerism technology has significant limitations. First, the in vivo chimerism procedure is costly and complex, limiting its widespread application. Second, significant physiological differences exist between stem cells and embryos, and existing culture media cannot provide a unified and suitable growth environment for both, thus limiting the survival rate and functional integration capacity of stem cells in the embryo and affecting the developmental potential of chimeric embryos.

[0004] Therefore, providing a porcine chimeric embryo culture medium and its application in effectively enhancing the in vitro chimeric ability of porcine embryonic stem cells is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0005] In view of this, the present invention provides a porcine chimeric embryo culture medium and its application in effectively enhancing the in vitro chimeric ability of porcine embryonic stem cells. By precisely controlling the growth factors, nutrients and other key components in the culture medium, a neutral culture environment that can promote the synchronous development of stem cells and embryos is created, and combined with other auxiliary means, the chimeric efficiency is maximized.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] A porcine chimeric embryo culture medium is prepared by mixing porcine zygotic culture medium (pEPSCM) with XAV-939 and WH-4-023 removed with porcine zygotic culture medium-3 (PZM-3) at a 1:1 ratio, adding Y-27632 to a final concentration of 10 μM, supplementing activin A to a final concentration of 20 ng / mL, and supplementing fetal bovine serum to a final concentration of 10%.

[0008] Furthermore, the porcine chimeric embryo culture medium contains the following components: KnockOut TMDMEM / F-12 (ThermoFisher) and embryonic water (Sigma) are mixed 1:1 and contain 0.9% non-essential amino acid solution, 0.9 mM glutamine, 0.45% penicillin-streptomycin, 0.225% N2 (ThermoFisher), 0.225% B27 (ThermoFisher), 10.15% fetal bovine serum, 0.0315 mg / ml vitamin C, and 0.045% mycoplasma antibiotic Primocin. TM 20 ng / ml activator A, 0.09 μM CHIR99021, 4.5 ng / ml leukemia inhibitory factor (LIF), 10 μM Y-27632, 0.045 mM β-mercaptoethanol, 47.62 mM sodium chloride, 4.41 mM potassium chloride, 155.24 μM potassium dihydrogen phosphate, 177.14 μM magnesium sulfate heptahydrate, 11.06 mM sodium bicarbonate, 3.24 μM gentamicin, 90 μM sodium pyruvate, 2.25 mM taurine, 0.45% amino acid solution, 1.28 mM calcium lactate, and 1.35 mg / ml bovine serum albumin.

[0009] Composition of porcine chimeric embryo culture medium: 90% of the total basal culture medium (45% pEPSCM and 45% PZM3), supplemented with 10% fetal bovine serum, and containing 20 ng / ml activin A and 10 μM Y-27632.

[0010] pEPSCM: Basic culture medium KnockOut TM DMEM / F-12, supplemented with 1% non-essential amino acid solution, 1mM glutamine, 1% penicillin-streptomycin, 0.5% N2 supplement, 0.5% B27 supplement, 0.07mg / ml vitamin C, and 0.1% mycoplasma antibiotic Primocin. TM 20 ng / ml activin A, 0.2 μM CHIR99021, 10 ng / ml leukemia inhibitory factor (LIF), 0.1 mM β-mercaptoethanol, 0.15 μM WH-4-023 and 2.5 μM XAV939, 0.3% fetal bovine serum.

[0011] PZM3: Add 105.83mM sodium chloride, 9.8mM potassium chloride, 344.97μM potassium dihydrogen phosphate, 393.64μM magnesium sulfate heptahydrate, 24.57mM sodium bicarbonate, 7.2μM gentamicin, 0.2mM sodium pyruvate, 1mM glutamine, 5mM taurine, 1% amino acid solution (Sigma), 1% non-essential amino acid solution (Sigma), 2.84mM calcium lactate, and 3mg / ml bovine serum albumin to the embryonic water and adjust the osmotic pressure to 297mOsm.

[0012] XAV-939 blocks the Wnt signaling pathway by increasing AXIN protein levels and promoting the phosphorylation and degradation of β-catenin. WH-4-023, as an Lck / Src kinase inhibitor, indirectly affects Wnt signaling by inhibiting Src kinase. The Wnt signaling pathway plays a crucial role in regulating stem cell differentiation and promoting the formation of specific cell types. Therefore, withdrawing XAV-939 and WH-4-023 can relieve the inhibition of Wnt signaling and optimize the stem cell differentiation process.

[0013] Y-27632 supports the normal proliferation and differentiation of stem cells by inhibiting apoptosis, promoting cell proliferation, and improving cell adhesion.

[0014] Fetal bovine serum contains abundant nutrients, hormones, and growth factors, which are essential for the growth and pluripotency maintenance of stem cells, while also significantly promoting embryonic development.

[0015] Activin A plays an important role in regulating stem cell proliferation and maintaining their pluripotency, and significantly promotes an increase in the number of inner cell masses in the embryo.

[0016] To further optimize the chimerism efficiency of stem cells and embryos, this invention employs other auxiliary methods to optimize the culture system of chimeric embryos.

[0017] (1) Overexpressing the anti-apoptotic factor BCL2 and fluorescently labeled mCherry in porcine embryonic stem cells not only enhances the anti-apoptotic ability of stem cells, but also facilitates the monitoring of cell survival status and distribution through fluorescent labeling technology.

[0018] (2) Pig parthenogenetic embryos were obtained in vitro. After 24 hours of embryonic development (day 1), embryos without cleavage were selected. After 96 hours of embryonic development (day 4), embryos in the morula stage were selected to ensure that the selected embryos were in the optimal chimerism state.

[0019] (3) After digesting the porcine embryonic stem cells, 10-12 stem cells were injected into the morula stage embryos using a microinjection instrument. Then, the culture medium was replaced with an optimized porcine chimeric embryo culture medium to provide a good environment for cell attachment and integration.

[0020] (4) The chimeric embryos cultured in porcine chimeric embryo culture medium for 18 hours were processed using a laser membrane breaking instrument. Specifically, the zona pellucida was thinned in one-quarter of the region. This is beneficial to promote the integration of stem cells and embryos and improve the chimeric efficiency.

[0021] As can be seen from the above technical solution, compared with the prior art, the present invention discloses a porcine chimeric embryo culture medium and its application in effectively improving the in vitro chimeric ability of porcine embryonic stem cells, which has the following beneficial effects:

[0022] The porcine chimeric embryo culture medium of this invention is a 1:1 mixture of pEPSCM (with XAV-939 and WH-4-023 removed) and PZM-3, with the addition of Y-27632, activator A, and fetal bovine serum. This optimized formulation significantly enhances the proliferation and differentiation capacity of stem cells, creates an ideal growth environment, promotes the overall development of the embryo, and is the foundation for achieving efficient chimerism.

[0023] Building upon this foundation, the present invention incorporates the following auxiliary methods to further enhance chimerism efficiency: overexpression of the anti-apoptotic factor BCL2 in porcine embryonic stem cells to enhance cell anti-apoptotic ability and improve survival rate; optimization of cell injection conditions to ensure chimeric embryos are in optimal condition, effectively supporting the integration of stem cells and embryos; and the use of laser-assisted hatching technology to promote the integration of stem cells and embryos, thereby improving chimerism efficiency. Attached Figure Description

[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0025] Figure 1 The piggybac TRE6H-BCL2-Hygro vector spectrum is shown;

[0026] Figure 2 The operation effect of the laser membrane breaking instrument on the zona pellucida of the embryo is shown. A quarter of the zona pellucida of the embryo was selected for local thinning treatment. The scale bar is 1:50μm.

[0027] Figure 3 This image shows the fluorescently labeled mCherry and bright-field plots of chimeric embryos at stages D4 and D7. The mCherry fluorescent labeling allows observation of the distribution of exogenous stem cells in the chimeric embryos, while the bright-field plot displays the overall morphology and developmental status of the embryos.

[0028] Figure 4 The staining and co-localization of trophoblast marker (CDX2) and stem cell marker mCherry were shown.

[0029] Figure 5 The staining and co-localization of the inner cell mass marker (SOX2) and the stem cell marker mCherry were shown.

[0030] Figure 6 The staining and co-localization of the primitive endoderm marker (SOX17) and the stem cell marker mCherry are shown.

[0031] Figure 7 The staining and localization of cell structural marker (E-cadherin) and stem cell marker mCherry are shown;

[0032] Figure 8 This study demonstrates the proliferation of stem cells in chimeric embryos after prolonged in vitro culture up to day 10. Detailed Implementation

[0033] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0034] Example 1

[0035] (I) Reagent source and preparation

[0036] source:

[0037] a: Porcine follicular fluid

[0038] Fresh ovarian tissue from pigs was collected from COFCO Meat Products Co., Ltd. in Wuhan, Hubei Province (collection period: September 2023 to August 2024). The tissue was placed in a 38°C saline thermos and transported to the laboratory within one hour. Follicular fluid, ranging from 2 to 8 mm from the ovarian surface, was then extracted using a syringe with a 12G needle and transferred to 50 mL centrifuge tubes. These tubes were incubated at 38°C for 30 minutes to allow the cumulus granulosa cell-oocyte complex (COCs) to settle at the bottom. The supernatant was then separated by centrifugation at 3000 rpm for 30 minutes and filtered through a 0.22 μm filter to obtain sterile porcine follicular fluid.

[0039] b: In vitro maturation medium for porcine oocytes: The following components were added to M199 basal culture medium (ThermoFisher-11150059) without HEPES: 10% porcine follicular fluid, 1 mg / mL cysteine, 0.44 mg / mL sodium pyruvate, 10 ng / mL epidermal growth factor, 50 ng / mL insulin, 5 IU / mL gonadotropin, 5 IU / mL human chorionic gonadotropin and 11.3 ng / mL kanamycin.

[0040] c: Operating medium: Based on embryonic water culture medium, supplemented with 10% NCSU23, 22mM sodium chloride, 5.5mM glucose, 0.57mM cysteine, 1% glutamine, 2.25mM taurine, 8.28mM taurine, 5% fetal bovine serum, and 2mM sodium hydroxide, adjusting the osmotic pressure to 297mOsm.

[0041] NCSU23: 100ml of embryonic water is supplemented with 6.3542g sodium chloride, 0.6563g potassium chloride, 0.1619g sodium dihydrogen phosphate, 0.5864g magnesium sulfate heptahydrate, 0.0750g kanamycin, and 10mg phenol red.

[0042] d: PVA-TLHEPES solution: Dissolve 6.6622 g of sodium chloride, 0.2311 g of potassium chloride, 0.1680 g of sodium bicarbonate, 0.0410 g of sodium dihydrogen phosphate, 1.443 ml of sodium lactate, 0.1017 g of magnesium chloride hexahydrate, 0.2940 g of calcium chloride dihydrate, 2.3830 g of HEPES, 0.0275 g of sodium pyruvate, 0.0750 g of kanamycin, 0.5000 g of polyvinyl alcohol, and 0.0100 g of phenol red in 1 L of ultrapure water, and adjust the osmotic pressure to 297 mOsm.

[0043] e: Electrofusion solution: The components of the electrofusion solution include 0.3 mol / L mannitol, 1 mmol / L calcium chloride dihydrate, 0.1 mmol / L magnesium chloride hexahydrate, and 0.5 mmol / L HEPES, with the pH adjusted to 7.2–7.4.

[0044] (II) Obtaining and culturing parthenogenetic embryos in pigs:

[0045] a: Collection and culture of GV-stage oocytes: Porcine ovaries were collected from COFCO Meat Products Co., Ltd. in Wuhan, Hubei Province (collection period: September 2023 to July 2024) and placed in a 38℃ physiological saline thermos, then transported to the laboratory within 1 hour. Follicular fluid from follicles 2–8 mm in diameter (GV stage) on the surface of the ovary was then extracted using a syringe equipped with a 12G needle and injected into 50 mL centrifuge tubes. The centrifuge tubes were placed in a 38℃ incubator and incubated for 30 minutes. At this time, cumulus-oocyte complexes (COCs) would deposit at the bottom of the centrifuge tube. After discarding the supernatant follicular fluid, an equal volume of PVA-TLHEPES solution was added, and the tubes were gently inverted to resuspend the COCs. Finally, the liquid was poured into a 100 mm culture dish, and well-shaped COCs were selected under a stereomicroscope using a 500 μm glass needle. These COCs were then cultured in porcine oocyte in vitro maturation medium for 42 hours, after which mature oocytes were collected.

[0046] b: Collection of mature oocytes: After culturing for 42 hours, take a 0.5 mL centrifuge tube and add 400 μL of M199 basal culture medium without HEPES containing 0.1% (v / v) hyaluronidase. Then, place the cultured mature COCs into the centrifuge tube and digest at 38.5℃ for 5 minutes, followed by centrifugation at 1000 rpm for 1 minute. Use a 200 μm glass needle to aspirate the COCs from the bottom of the centrifuge tube and wash them three times in PVA-TLHEPES solution to thoroughly remove the cumulus granulosa cells on the zona pellucida of the oocytes. Finally, under a stereomicroscope, use a glass needle to perform blow-aspiration operations on the oocytes to select the oocytes that have extruded the first polar body; these are the mature oocytes.

[0047] c: Parthenogenetic Embryo Acquisition and Culture: Connect the electrofusion tank (3.2mm) and the electrofusion apparatus. Add 550μl of electrofusion solution to the electrofusion tank and set the electrofusion parameters as follows: pulse duration 40μs, 2 pulses, 640V voltage. After washing the selected mature oocytes in the electrofusion solution, transfer them into the electrofusion tank. Use a pipette to quickly move the oocytes so that the contact surface of the injected oocytes is perpendicular to the direction of the electric field of the electric pulse, and then start the electric pulse. After the electric pulse is completed, parthenogenetic embryos are obtained (marked as day 0). They are aspirated, washed in PZM-3 that has been pre-balanced the day before, and finally transferred to embryo culture wells containing PZM-3 and cultured in a constant temperature incubator at 38.5℃. Embryos generally develop to the morula stage after four days of culture, and embryos generally develop to the blastocyst stage after seven days of culture.

[0048] (III) Construction of a porcine embryonic stem cell line overexpressing the anti-apoptotic factor BCL2:

[0049] a: Preparation of mouse fetal fibroblast feeder layer: Healthy, age-appropriate ICR mice were naturally bred. Fetuses 13.5 days gestation were removed from the mother's uterus and washed with phosphate-buffered saline (PBS) in a clean bench to remove blood. The placenta and fetal membranes were detached using sterile forceps, washed, and transferred to a clean petri dish containing PBS. After carefully separating the fetal head, tail, limbs, and internal organs, the remaining portion was transferred to a 1.5 ml centrifuge tube and minced with sterile scissors to a diameter not exceeding 0.2 mm. Each embryo was resuspended in 500-1000 ml of 0.05% trypsin (Sigma), and all were transferred to a 50 ml centrifuge tube. The tubes were digested in a 37°C water bath for 5 minutes, then mixed by pipetting, and finally digested in a 37°C water bath for another 5 minutes. After terminating digestion with an equal volume of D10 medium (based on DMEM-Gibco medium supplemented with 10% fetal bovine serum, 1% glutamine, and 1% penicillin-streptomycin), cells were seeded into 100 mm dishes. Culture conditions were 5% CO2, 37°C, and saturated humidity. The medium was changed the following day to remove non-adherent cells. When cells reached over 90% confluence, 3 ml of 0.05% trypsin was added to each dish and digested at 37°C for 3 min. Cells were then transferred to centrifuge tubes and an equal volume of D10 medium was added to terminate digestion. Cells were centrifuged at 200 g for 3-5 min, the supernatant was discarded, and the cells were resuspended in D10 medium and passaged to passage P1 at a 1:3 ratio. When passage P1 cells reached 90% confluence, they were treated with 1 mg / ml mitomycin C (working concentration) for 12 h to stop cell proliferation. Cells were washed three times with DPBS (Thermo Fisher Scientific), digested, and collected. The cell pellet was resuspended in somatic cell cryopreservation solution and aliquoted into cryovials. The cells were then cryopreserved using a gradient cooling method. Finally, the cells were transferred to liquid nitrogen for long-term storage.

[0050] b: Establishment, passage, and cryopreservation of porcine embryonic stem cells: Embryos were flushed from the uterus of sows 5.5 days post-mating and transferred to preheated embryo manipulation medium. The zona pellucida was removed and the inner cell mass (ICM) isolated using a pipette slightly smaller in diameter than the embryo through repeated aspiration and blowing. The isolated ICM was transferred to a small dish containing pEPSCM and rinsed twice before being transferred to wells containing 10 μM Y27632. The wells were incubated at 38.5°C, 5% CO2, and 5% O2 for 2 days. On the third day, pEPSCM containing 10 μM Y27632 was added to the wells. On the fourth day, the original culture medium was removed, and fresh pEPSCM containing 10 μM Y27632 was added. From this point onward, the pEPSCM containing 10 μM Y27632 was replaced daily until clones emerged; this process takes approximately 7 to 10 days. After cloning, the culture medium was replaced with normal pEPSCM without Y27-632 until the clones reached a certain size and morphology, at which point they were marked as generation P0. Generation P0 clones were picked out with a glass needle and transferred to a PCR tube containing 10 μL of 0.05% trypsin, and digested in a 37°C incubator for 3 minutes. When the clones were slightly loosened, they were dispersed using a pipette and seeded onto feeder cells in a 48-well plate (the feeder cells were thawed two days in advance), and porcine embryonic stem cell culture medium containing 10 μL of Y27-632 was added. Once the clones reached a certain morphology, normal passage culture was performed. The passage cryopreservation procedure was as follows: porcine embryonic stem cells were cultured in small dishes (35 mm), the culture medium was discarded, and residual culture medium was washed away with 1 mL of PBS. 750 μL of 0.05% trypsin was added, and digestion was performed in a 37°C incubator for 3 minutes, followed by termination of the digestion process with an equal volume of D10 culture medium. Next, centrifuge at 200g for 3 minutes at room temperature, discard the supernatant, and resuspend the cells in 1.5mL of pEPSCM. Then, seed the cells onto mouse fetal fibroblast feeder cells at a 1:3 ratio, adding 5% fetal bovine serum and 5μM Y-27632 to promote cell growth and stability. After 12 to 24 hours, replace the culture medium with normal pEPSCM, changing the medium daily. After 2 to 3 days, the cells can be passaged again or cryopreserved.

[0051] c: Overexpression of the anti-apoptotic factor BCL2 (sequence shown in SEQ ID NO.1), fluorescently labeled mCherry:

[0052] BCL2 sequence:

[0053] ATGGCGCACGCTGGGAGAACAGGGTATGATAACCGGGAAATAGTGATGAAGTACATCCACTATAAGCTGTCGCAGAGGGGCTACGAGTGGGATGCCGGAGACGCGGGCGCCGCGTCCCCGGGGGCCGCTCCCGCACCGGGCATCTTCTCCTGTACTCAGCCCGGTGCCACCTGTGGTCCACCTGACCCTGCGCCAGGCCGGCGATGACTTCTCTCGTCGCTACCGCCGCGACTTTGCCGAGATGTCCAGCCAGCTGCACCTGACTCCCTTCACCGCGAGGGGACGCTTTGCCACGGTGGTGGAGGAGCTCTTCAGGGATGGGGTGAACTGGGGGAGGATTGTGGCCTTCTTTGAGTTCGGTGGGGTCATGTGTGTGGAGAGCGTCAACCGGGAGATGTCGCCCCTGGTGGACAACATCGCCCTGTGGATGACTGAGTACCTGAACCGGCACCTGCACACCTGGATCCAGGATAACGGAGGCTGGGATGCCTTTGTGGAGCTGTATGGGCCCAGCATGCGGCCTCTATTTGATTTCTCCTGGCTGTCTCTGAAGGCGCTGCTCAGTCTGGCCCTGGTGGGAGCTTGCATCAC CCTGGGTGC CTATCTGGGCCATAAG ; SEQ ID NO.1.

[0054] (1) Construction of plasmid: Piggybac TRE6H-BCL2-Hygro (vector map see Figure 1 ):

[0055] 1) Using porcine ovarian cDNA as a template and BCL2-F / R as primers, perform PCR amplification; the specific primer sequences are as follows: [[ID=十二]]

[0056] BCL2-F:

[0057] GTACCACTTCCTACCCTCGTAAAGGAAGCTT ATGGCGCACGCTGGGAG AAC ; SEQ ID NO.2;

[0058] BCL2-R:

[0059] CCTGGGTGCCTATCTGGGCCATAAGGGATCCGGTGTCGACGACTACAA AG; SEQ ID NO. 3.

[0060] Prepare the PCR reaction system according to the PrimeSTAR GXL DNA Polymerase instructions: 10 μL of 5×PrimeSTAR GXL Buffer, 4 μL of dNTP Mixture (2.5 mM each), 1.5 μL of BCL2-F (10 μM), 1.5 μL of BCL2-R (10 μM), 0.5 μg of ovarian cDNA template, 1 μL of PrimeSTAR GXL DNA Polymerase, and double-distilled water to a final volume of 50 μL.

[0061] The PCR reaction procedure is as follows:

[0062]

[0063] The PCR products were identified by electrophoresis. If the band sizes were correct, the PCR products were purified and recovered according to the FastPure Gel DNA Purification and Recovery Kit instructions. After measuring the concentration with Nanodrop, the products were stored at -20°C.

[0064] 2) Plasmid linearization

[0065] Plasmid piggybac-TRE6H-EOMES-HygroB See TianXu, Peng Su, Linhui Wu, OCT4regulates WNT / β-catenin signaling and prevents mesoendoderm differentiation by repressing EOMES in porcine pluripotent stem cells; Cellular Physiology.

[0066] The enzyme digestion system was prepared according to the NEB high-fidelity enzyme operation system: 5 μg plasmid piggybac-TRE6H-EOMES-HygroB, 2.5 μl high-fidelity enzyme HindIII, 2.5 μl high-fidelity enzyme BamH1, and 5 μl NE Buffer. TM Add r2.1 and double-distilled water to a final volume of 50 μl. The PCR reaction was carried out at 37°C for two hours. The digested products were then identified by electrophoresis. If the band sizes were correct, the PCR products were purified and recovered according to the FastPure Gel DNA Purification and Recovery Kit instructions. After measuring the concentration with Nanodrop, the products were stored at -20°C.

[0067] 3) Connection

[0068] Prepare the reaction system according to the BM Seamless Cloning Kit: 100-200 ng of BCL2 PCR amplification product, 20-50 ng of linearized plasmid piggybac-TRE6H-EOMES-HygroB, 5 μL of 2×Seamless Cloning Mix, and double-distilled water to a final volume of 10 μL.

[0069] Set the PCR instrument to 50℃ and incubate for 30 minutes.

[0070] 4) Transformation and Selection: Remove DH5α (Vazyme) chemicompetent cells from the -80℃ freezer and thaw on ice. Add 2-3 μL of ligation product to 50 μL of competent cells, mix gently, and incubate on ice for 15 min. Heat shock in a 42℃ water bath for 45 s, then incubate on ice for 2 min. Add 450 μL of antibiotic-free LB liquid medium and revive at 37℃ 200 rpm for 1 h in a shaker. Centrifuge at 2500g for 3 min, discard 400 μL of supernatant, resuspend the bacterial pellet in the remaining medium, and add to LB solid culture dishes containing 0.1% AMP antibiotic. Spread evenly and incubate upside down in a 37℃ incubator for 12-14 h. Pick single colonies for PCR identification. For correctly identified colonies, extract plasmids, remove endotoxins, and perform plasmid mini-preparation according to Omega... Follow the instructions for use of the Endo-free Plasmid DNA MiniKit II kit. After measuring the concentration, store at -20°C.

[0071] (2) pcDNA3.1-mCherry was used for visual labeling of stem cells and was purchased from AddGene (catalog number: 128744).

[0072] After thawing frozen embryonic stem cells (generally those within passage 20), discard the culture medium and wash once with DPBS. Add 750 μL of 0.05% trypsin to each dish and incubate at 37°C for 3 min. Use a pipette to disperse the clones into single cells and add an equal volume of D10 culture medium to stop the digestion. Centrifuge at 200g at room temperature for 2-3 min and discard the supernatant. Add 1 mL of Opti-MEM (ThermoFisher) to resuspend and rinse once, then centrifuge again, discard the supernatant, and resuspend the cells in 100 μL of Opti-MEM and add plasmids (2 μg Piggybac TRE6H-BCL2-Hygro, 2 μg pcDNA3.1-mCherry). Carefully transfer the cell suspension to a 2 mm electroporation cuvette using a 200 μL pipette, label it, and then place it in a Nucleofector. TMIn the 2b Manual electroporator, electroporation was performed using the prescribed program. After electroporation, the cells were transferred to new mouse fetal fibroblast feeder cells as soon as possible using a fine-tipped pipette.

[0073] (iv) Cell digestion and injection

[0074] Porcine embryonic stem cells were seeded into 35 mm culture dishes. After discarding the culture medium, the cells were washed with 1 mL of PBS to remove residual culture medium. 700 μL of type II collagenase was added, and the mixture was incubated at 37°C for 6 minutes until cell clonal clusters were observed floating under a microscope. The supernatant was then transferred to a 1.5 mL centrifuge tube, and an equal volume of D10 culture medium was added to terminate the digestion. Next, the cells were centrifuged at 1000 rpm for 3 minutes at room temperature, and the supernatant was discarded. The cells were resuspended in 500 μL of TrypLE (ThermoFisher), and digested at 37°C for 2 minutes, again terminating the digestion with an equal volume of D10 culture medium. After centrifugation at 1000 rpm for 3 minutes at room temperature, the supernatant was discarded, and the cells were resuspended in 500 μL of pEPSCM containing 10 μM MY-27632. At this point, the cells were in the form of cell clonal clusters.

[0075] Embryos at the 8-cell stage after parthenogenetic activation and culturing in PZM-3 for 3 days were selected and placed in a 20 μL droplet containing 0.01% cytochalasin (MCE). Digested cells were placed in a 20 μL droplet containing PVA / PBS (0.25 g PVA (Sigma) dissolved in 100 ml PBS). The injection tray also included a 20 μL droplet containing 25% trypsin for washing. 10–12 porcine embryonic stem cells were aspirated using a hydraulic syringe and injected into the embryos. Embryos at the morula stage after parthenogenetic activation and culturing in PZM-3 for 4 days were selected and injected with porcine embryonic stem cells in the same manner. The injected embryos were then cultured in PZM-3 medium until day seven, and the number of blastocysts was counted under a stereomicroscope. The results are shown in Table 1.

[0076] Table 1. Statistical analysis of the effects of stem cell injection at different embryonic stages on the development of chimeric embryos.

[0077]

[0078] As shown in Table 1, injecting stem cells at the 8-cell stage of the embryo leads to embryonic developmental arrest.

[0079] Embryos obtained from cell digestion and injection in step (IV) above, on day four after injection, were cultured in mixtures of PZM-3 and pEPSCM in different proportions until day seven. The number of blastocysts was observed under a stereomicroscope, and the number of blastocysts containing mCherry fluorescent labels was observed under a fluorescence microscope. The results are shown in Table 2.

[0080] Table 2. Statistical analysis of the effects of different ratios of Pzm3 and pEPSCM mixed culture medium on chimeric embryo development.

[0081]

[0082] As shown in Table 2, the overall embryonic development effect is best when PZM-3 and pEPSCM are in a 1:1 ratio.

[0083] Embryos obtained from cell digestion and injection in step (IV) above, on day four after injection, were placed in PZM-3 and pEPSCM (1:1). XAV939 was removed from PZM-3 and pEPSCM (1:1), and then PZM-3 and pEPSCM (without XAV939) were mixed with WH-4-023 (1:1) and cultured until day seven. The number of blastocysts was observed under a stereomicroscope, and the number of blastocysts containing mCherry fluorescent labels was observed under a fluorescence microscope. Subsequently, blastocysts were collected for immunofluorescence staining.

[0084] The immunofluorescence staining procedure is as follows:

[0085] Fixation: Place the chimeric embryos in a fixative solution (0.4g PFA (Sigma) dissolved in 10ml PBS) at room temperature and let stand for 30 minutes.

[0086] Washing: Wash three times with washing solution (0.05g PVA (Sigma) dissolved in 100ml PBS).

[0087] Permeabilization: The embryos were transferred to permeabilization solution (20 μl Triton-X100-Sigma dissolved in 10 ml PBS), incubated at room temperature for 30 minutes, and then washed three times with washing solution.

[0088] Blocking: Transfer the embryos to the blocking solution (Beyotime P0023B) and let them stand at room temperature for 2 hours.

[0089] Primary antibody incubation: Embryos were incubated for 24 hours in antibody dilution (Beyotime) containing 0.5% SOX2 antibody (SantaCruz, labeled inner cell mass, mouse antibody).

[0090] Washing: Wash three times again with detergent.

[0091] Secondary antibody incubation: Transfer the embryos to an antibody dilution containing 0.1% (v / v) fluorescent secondary antibody (Beyotime Alexa Fluor 488) and incubate at room temperature for 1 hour.

[0092] DAPI staining: Finally, the blastocyst is placed on a glass slide containing DAPI (Beyotime nuclear staining agent) and pressed.

[0093] The number of inner cell clusters was counted under a fluorescence microscope. The results are shown in Table 3.

[0094] Table 3. Statistical analysis of the effects of XAV-939 and WH-4-023 on chimeric embryo development in culture medium.

[0095]

[0096] As shown in Table 3, the removal of XAV-939 and WH-4-023 can significantly promote the chimerism efficiency of embryos and the development of the inner cell mass.

[0097] Embryos obtained from cell digestion and injection in step (IV) above, after injection on day 4, were placed in a mixture of PZM-3 and pEPSCM (1:1) with XAV939, WH-4-023, and activin A removed, designated as the 0 ng activin A supplement group; embryos injected on day 4 were placed in a mixture of PZM3 and pEPSCM (1:1) with XAV939 and WH-4-023 removed, and activin A concentration was supplemented to 20 ng / ml, designated as the 20 ng / ml supplement group; both groups of embryos were cultured to day 7, and the number of blastocysts was observed under a stereomicroscope, and the number of blastocysts containing mCherry fluorescent labeling was observed under a fluorescence microscope. Subsequently, blastocysts were collected for immunofluorescence staining (using SOX2 antibody to label the inner cell mass). The results are shown in Table 4.

[0098] Table 4. Effects of different concentrations of activin A on chimeric embryo development.

[0099]

[0100] Table 4 shows that 20 ng / ml activin A has the best effect on promoting the development of chimeric embryos.

[0101] (V) Laser-Assisted Hatching: Before laser-assisted hatching, the embryos obtained on day four after cell digestion and injection in step (IV) are cultured in porcine chimeric embryo culture medium for 18 hours to ensure the embryos are in a suitable state and developing stably. The cultured chimeric embryos are then transferred to a micromanipulation platform suitable for laser operation. The laser membrane-breaking device is activated, and the laser intensity and pulse parameters are calibrated according to the diameter of the zona pellucida of the embryo to ensure suitability for zona pellucida treatment. Generally, the laser energy and duration should be sufficient to thin the zona pellucida without damaging the internal structure of the embryo. The embryo is observed under a microscope, and a quarter of the zona pellucida is selected as the target area for laser thinning. After precise positioning under the microscope, the selected quarter of the zona pellucida is thinned using the laser membrane-breaking device. The laser pulse should gradually reduce the thickness of the zona pellucida, ensuring it is thin enough for embryo hatching without rupturing. After laser thinning, the treated area is carefully observed under a microscope to confirm that the thickness of the zona pellucida has been significantly reduced and that the embryonic structure has not been damaged. If necessary, the laser parameters can be adjusted appropriately and supplementary treatments can be performed. The treated chimeric embryos were cultured at 38.5℃ and 5% CO2 until the seventh day, the blastocyst stage, and the hatching rate and changes in overall morphology were observed. Figure 2 The image shows the specific area of ​​the embryo that has undergone laser thinning. Figure 3 The image shows the morphological characteristics of an embryo that has developed to the blastocyst stage after laser-assisted development.

[0102] (vi) Detection of stem cell proliferation and differentiation in chimeric embryo development:

[0103] Embryos developed to day 7 after laser-assisted hatching (step 5) were collected and subjected to immunofluorescence staining. CDX2 was used as a marker for trophoblast cells, SOX2 as a marker for the inner cell mass, SOX17 as a marker for the primitive endoderm, and stem cells carried mCherry red fluorescent markers. The specific operating steps are as follows:

[0104] Fixation: Place the chimeric embryos in a fixative solution (0.4g PFA dissolved in 10ml PBS) at room temperature and let stand for 30 minutes.

[0105] Washing: Wash three times with washing solution (0.05g PVA dissolved in 100ml PBS).

[0106] Permeabilization: The embryos were transferred to permeabilization solution (20 μl Triton-X100 (Sigma) dissolved in 10 ml PBS), incubated at room temperature for 30 minutes, and then washed three times with washing solution.

[0107] Blocking: Transfer the embryo to the blocking solution and let it stand at room temperature for 2 hours.

[0108] Primary antibody incubation: Embryos were placed in dilutions containing the following antibodies and incubated at 4°C for 24 hours:

[0109] 0.5% SOX2 antibody (Santa Cruz, labeling inner cell clusters, murine antibody)

[0110] 1% CDX2 antibody (BiogeneX, labeling trophoblast, murine antibody)

[0111] 0.3% SOX17 antibody (R&D Company, labeling primitive endoderm, sheep-derived antibody)

[0112] 0.5% E-cadherin (Abcam, labeling cell structures, murine antibody)

[0113] Washing: Wash three times again with detergent.

[0114] Secondary antibody incubation: The embryos were transferred to an antibody dilution containing 0.1% (v / v) fluorescent secondary antibody (the secondary antibody corresponding to the mouse antibody was Beyotime's anti-mouse Alexa Fluor 488, the secondary antibody corresponding to the rabbit antibody was Beyotime's anti-rabbit Alexa Fluor 549, and the secondary antibody corresponding to the goat antibody was Beyotime's horseradish enzyme-labeled rabbit anti-goat IgG (H+L)) and incubated at room temperature for 1 hour.

[0115] DAPI staining: Finally, the blastocyst is placed on a glass slide containing DAPI mounting solution and pressed into a slide.

[0116] The cells were observed under a fluorescence microscope to count the number of different cell types in the chimeric embryos and the chimerism of stem cells. Figure 4 The study demonstrated the colocalization of the embryonic trophoblast marker CDX2 and the stem cell fluorescent marker mCherry, indicating that stem cells successfully integrated into the embryo and completed the process of differentiation into the trophoblast. Figure 5 The study demonstrated the colocalization of the embryonic inner cell mass marker SOX2 and the stem cell fluorescent marker mCherry, indicating that stem cells successfully integrated into the embryo and completed the process of differentiation into the inner cell mass. Figure 6 The study demonstrated the colocalization of the embryonic primitive endoderm marker SOX17 and the stem cell fluorescent marker mCherry, indicating that stem cells successfully integrated into the embryo and completed the process of differentiation into the primitive endoderm. Figure 7 The study demonstrates the colocalization of the cellular structural marker (E-cadherin) and the stem cell fluorescent marker mCherry, indicating that stem cells integrate well with surrounding cells, contributing to the maintenance of the overall structure and integrity of the embryo. This intercellular connection helps the embryo maintain its complete morphology and function during development.

[0117] (vii) Delayed in vitro culture of chimeric embryos:

[0118] Chimeric embryos hatched on day 7 were transferred to in vitro delayed culture medium, with half of the medium replaced daily. The in vitro delayed culture medium was a 1:1 mixture of Advanced DMEM / F-12 (ThermoFisher) and Neurobasal (ThermoFisher), supplemented with 1% N2 and 0.5% B27 medium, and supplemented with 1% glutamine, 1% penicillin-streptomycin, 20 ng / ml activin A, and 10 μM Y-27632. Embryos were collected on day 10 for immunofluorescence staining. Figure 8 This indicates that the delayed development system of chimeric embryos significantly promotes further proliferation of stem cells.

[0119] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A pig chimeric embryo culture medium, characterized by, KnockOut™ DMEM / F-12 mixed with embryo water 1:1, 0.9% non-essential amino acid solution, 0.9 mM glutamine, 0.45% penicillin-streptomycin, 0.225% N2, 0.225% B27, 10.15% fetal bovine serum, 0.0315 mg / ml vitamin C, 0.045% mycoplasma antibiotic Primocin™, 20 ng / ml activin A, 0.09 µM CHIR99021, 4.5 ng / ml leukemia inhibitory factor, 10 µM Y-27632, 0.045 mM β-mercaptoethanol, 47.62 mM sodium chloride, 4.41 mM potassium chloride, 155.24 µM potassium phosphate monobasic, 177.14 µM magnesium sulfate heptahydrate, 11.06 mM sodium bicarbonate, 3.24 µM gentamicin, 90 µM sodium pyruvate, 2.25 mM taurine, 0.45% amino acid solution, 1.28 mM calcium lactate, and 1.35 mg / ml bovine serum albumin.

2. The method of claim 1, wherein the porcine chimeric embryo culture medium is prepared by the steps of: The specific steps are as follows: after mixing pEPSCM without XAV-939 and WH-4-023 with PZM-3 at a ratio of 1:1, adding Y-27632 to a final concentration of 10 µM, supplementing activin A to a final concentration of 20 ng / mL, and supplementing fetal bovine serum to a final concentration of 10.15%; The pEPSCM is composed of the following components: base medium KnockOut™ DMEM / F-12, and adding 1% non-essential amino acid solution, 1 mM glutamine, 1% penicillin-streptomycin, 0.5% N2 supplement, 0.5% B27 supplement, 0.07 mg / ml vitamin C, 0.1% mycoplasma antibiotic Primocin™, 20 ng / ml activin A, 0.2 µM CHIR99021, 10 ng / ml leukemia inhibitory factor, 0.3% fetal bovine serum, 0.1 mM β-mercaptoethanol, 0.15 µM WH-4-023, and 2.5 µM XAV939; The PZM-3 is composed of the following components: adding 105.83 mM sodium chloride, 9.8 mM potassium chloride, 344.97 µM potassium phosphate monobasic, 393.64 µM magnesium sulfate heptahydrate, 24.57 mM sodium bicarbonate, 7.2 µM gentamicin, 0.2 mM sodium pyruvate, 1 mM glutamine, 5 mM taurine, 1% amino acid solution, 1% non-essential amino acid solution, 2.84 mM calcium lactate, 3 mg / ml bovine serum albumin in embryo water, and adjusting the osmotic pressure to 297 mOsm.

3. The application of a porcine chimeric embryo culture medium according to claim 1 in improving the in vitro chimeric ability of porcine embryonic stem cells.

4. A method for improving the in vitro chimeric efficiency of pig embryonic stem cells, characterized in that, The specific steps are as follows: (1) overexpressing anti-apoptotic factors BCL2 and fluorescent marker mCherry in porcine embryonic stem cells; (2) obtaining porcine parthenogenetic embryos in vitro, and selecting embryos at the stage of mulberry at 96 hours of embryonic development; (3) after the digestion of porcine embryonic stem cells, 10-12 stem cells are injected into the embryos in the stage of spongy using micro-injection instrument, and then the porcine chimeric embryo culture medium in claim 1 is used for culture; (4) the chimeric embryo cultured for 18 hours in the porcine chimeric embryo culture medium in claim 1 is treated using a laser membrane breaking instrument, and the treatment is performed on the quarter area of the zona pellucida.

Citation Information

Patent Citations

  • Special culture medium and method for culturing porcine trophoderm stem cells

    CN104946581A

  • Method for improving chimeric capability of ES cells of mouse to epiblasts of early embryos

    CN107365740A