Genetically engineered fibroblast, preparation method thereof, culture medium for proliferating and / or differentiating B cells and application

Abstract

The invention provides genetically engineered fibroblasts, a preparation method thereof, a culture medium for proliferating and / or differentiating B cells and application, and belongs to the technical field of genetic engineering. The genetically engineered fibroblast contains a CD40L gene, an IL-2 gene, an IL-4 gene, an IL-21 gene and a BAFF gene, can express CD40L, IL-2, IL-21, IL-4 and BAFF, can promote B cells to be differentiated into plasma cells, supports proliferation of the B cells, and can prolong the in-vitro survival time of the B cells, so that long-term in-vitro culture and efficient amplification of the low-density B cells are realized. Experimental results show that the genetically engineered fibroblasts constructed by the invention can support in-vitro culture of B cells for more than 16 days, and in-vitro survival of the B cells is effectively maintained. In addition, the cell line can also significantly promote B cells to differentiate into plasma cells and secrete high-level antibodies.

Description

Technical Field

[0001] The present invention belongs to the field of gene engineering technology, and in particular relates to a genetically engineered fibroblast and a preparation method thereof, a culture medium for proliferation and / or differentiation of B cells, and applications thereof. Background Art

[0002] Isolating monoclonal antibodies produced by humans infected with pathogens is crucial for accurately locating antigen epitopes and optimizing vaccine design, with the goal of strengthening the body's defense against pathogen invasion. Traditional monoclonal antibody isolation methods such as hybridoma technology and phage display libraries are limited by many factors, such as immune tolerance challenges and cumbersome screening processes. In comparison, the in vitro separation of B cells to prepare monoclonal antibodies has shown significant advantages of simplicity and efficiency. It can activate B cells to secrete high concentrations of antibodies without the need for specific immune induction. The discovery of this technology provides a powerful tool for in-depth exploration of the basic principles and dynamic evolution of antigen immune responses. Therefore, the preparation of B cells is particularly important.

[0003] B lymphocytes (B lymphocytes) are referred to as B cells. B cells are important members of the immune system and mainly mediate humoral immune responses. B cells stimulated by antigens differentiate into plasma cells and produce antibodies against target antigens to resist the invasion of external microorganisms. B cells need the support of co-stimulatory signals and multiple cytokines during in vitro culture and differentiation into plasma cells, but the multiple cytokines in the culture medium are expensive, thereby increasing the cost of preparing plasma cells, and the preparation of the culture medium for the proliferation and / or differentiation of B cells requires the addition of multiple cytokines, and the preparation operation is complicated. Summary of the invention

[0004] In view of this, the purpose of the present invention is to provide a genetically engineered fibroblast and a preparation method thereof, a culture medium for proliferating and / or differentiating B cells and applications. The present invention utilizes genetically engineered fibroblasts to promote the proliferation and / or differentiation of B cells.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The invention provides a genetically engineered fibroblast, which contains CD40L gene, IL-2 gene, IL-4 gene, IL-21 gene and BAFF gene.

[0007] Preferably, the nucleotide sequence of the CD40L gene is the gene sequence at positions 92-877 in NM_000074.3; the nucleotide sequence of the IL-2 gene is the gene sequence at positions 286-747 in NM_000586.4; the nucleotide sequence of the IL-4 gene is the gene sequence at positions 63-524 in BC070123.1; the nucleotide sequence of the IL-21 gene is the gene sequence at positions 46-534 in BC066260.1; and the nucleotide sequence of the BAFF gene is the gene sequence at positions 180-1037 in BC020674.1.

[0008] Preferably, the fibroblasts are NIH3T3 cells.

[0009] The present invention provides a method for preparing the above-mentioned genetically engineered fibroblasts, comprising the following steps:

[0010] (1) CD40L recombinant plasmid, IL-4-T2A-BAFF recombinant plasmid and IL-2-T2A-IL-21 recombinant plasmid were co-transfected with lentiviral packaging plasmid into mammalian cells to obtain lentiviral CD40L, lentiviral IL-4-T2A-BAFF and lentiviral IL-2-T2A-IL-21;

[0011] (2) infecting fibroblasts with lentiviral CD40L, culturing and screening to obtain cells containing CD40L;

[0012] (3) Infecting cells containing CD40L with lentivirus IL-4-T2A-BAFF, culturing and screening to obtain cells containing CD40L, IL-4 and BAFF;

[0013] (4) Infecting cells containing CD40L, IL-4 and BAFF with lentivirus IL-2-T2A-IL-21, culturing and screening to obtain cells containing CD40L, IL-4, IL-2, IL-21 and BAFF, i.e., genetically engineered fibroblasts.

[0014] Preferably, the CD40L recombinant plasmid contains the CD40L gene as shown in the gene sequence at positions 92-877 in NM_000074.3; the IL-4-T2A-BAFF recombinant plasmid contains the IL-4-T2A-BAFF gene with a nucleotide sequence as shown in SEQ ID NO.2; and the IL-2-T2A-IL-21 recombinant plasmid contains the IL-2-T2A-IL-21 gene with a nucleotide sequence as shown in SEQ ID NO.4.

[0015] The present invention also provides a use of the above genetically engineered fibroblasts or the fibroblasts obtained by the preparation method in the preparation of a B cell proliferation agent and / or a B cell differentiation agent.

[0016] The present invention also provides a culture medium for proliferation and / or differentiation of B cells, wherein the culture medium comprises cytokines, and the cytokines comprise the above-mentioned genetically engineered fibroblasts or the fibroblasts obtained by the preparation method.

[0017] Preferably, the culture medium further comprises mitomycin C; the cytokine is the above-mentioned genetically engineered fibroblasts or the fibroblasts obtained by the preparation method;

[0018] The method for preparing the culture medium for proliferation and / or differentiation of B cells comprises the following steps: 7 The cells are inoculated into a culture bottle, and when the cells are confluent to 70-90%, mitomycin C with a final concentration of 9-11 μg / mL is added. After treatment for 1.5-2.5 hours, the mitomycin C is discarded to obtain the treated fibroblasts, that is, the culture medium for proliferation and / or differentiation of B cells.

[0019] The present invention also provides a method for preparing B cells, comprising the step of culturing B cells with the above-mentioned culture medium to allow the B cells to proliferate.

[0020] The present invention also provides a method for preparing plasma cells, comprising the step of culturing B cells with the above-mentioned culture medium to differentiate the B cells into plasma cells.

[0021] The present invention also provides a method for preparing an antibody, characterized in that it comprises the steps of culturing B cells with the above-mentioned culture medium to differentiate the B cells into plasma cells, and the plasma cells synthesizing and secreting antibodies.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] The present invention provides a genetically engineered fibroblast and a preparation method thereof, a culture medium and application for proliferation and / or differentiation of B cells. The genetically engineered fibroblast of the present invention expresses CD40L, IL-2, IL-21, IL-4 and BAFF, which can promote the differentiation of B cells into plasma cells, support the proliferation of B cells, and prolong the in vitro survival time of B cells, thereby realizing the long-term culture and efficient amplification of low-density B cells in vitro. Experimental results show that the genetically engineered fibroblast constructed by the present invention can support the in vitro culture of B cells for more than 16 days, and effectively maintain the survival of B cells in vitro. In addition, the cell line can also significantly promote the differentiation of B cells into plasma cells and secrete high levels of antibodies. This innovative culture system provides an efficient and stable platform for the in vitro culture of B cells and antibody production. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The expression of CD40L and BAFF molecules was detected by flow cytometry. A shows the expression of CD40L molecules by NIH3T3 cells after being infected with lentivirus CD40L for 3 days and screened by Puro for 14 days; B shows the expression of BAFF molecules by NIH3T3-CD40L cells after being infected with lentivirus IL-4-T2A-BAFF for 3 days and screened by G418 for 14 days;

[0025] Figure 2 The secretion levels of cytokines IL-2, IL-4, and IL-21 were detected by ELISA;

[0026] Figure 3 The positive rate of B cells was detected by flow cytometry;

[0027] Figure 4Figure 2 shows the effect of NIH3T3-CD40L-IL-2-IL-4-IL-21-BAFF cells as feeder cells co-cultured with B cells on the proliferation and differentiation of B cells. A shows the proliferation of B cells on the 2nd, 4th, 6th, 8th, 10th, 12th, 14th and 16th days after co-culture of B cells with NIH3T3-CD40L-IL-2-IL-4-IL-21-BAFF cells; B shows the proliferation of B cells on the 2nd, 4th, 6th, 8th, 10th, 12th, 14th and 16th days after co-culture of B cells with NIH3T3-CD40L-IL-2-IL-4 -IL-21-BAFF cells after co-culture; C is the B cell proliferation results of B cells co-cultured with NIH3T3-CD40L and NIH3T3-CD40L-IL-2-IL-4-IL-21-BAFF at different culture days; D is the IgG secretion level of B cells co-cultured with NIH3T3-CD40L and NIH3T3-CD40L-IL-2-IL-4-IL-21-BAFF and single B cells. DETAILED DESCRIPTION

[0028] The invention provides a genetically engineered fibroblast, which contains CD40L gene, IL-2 gene, IL-4 gene, IL-21 gene and BAFF gene.

[0029] In the present invention, the CD40L is a type II transmembrane cytokine of the tumor necrosis factor superfamily. The present invention expresses CD40L, B cell activating factor (BAFF), interleukin 2 (IL-2), interleukin 4 (IL-4) and interleukin 21 (IL-21) in genetically engineered fibroblasts, providing a more comprehensive cytokine signal stimulation for the proliferation and differentiation of B cells, thereby promoting the proliferation of B cells, the differentiation of B cells into plasma cells, and effectively maintaining the survival of B cells in vitro, with a survival of more than 16 days. The nucleotide sequence of the CD40L gene is the gene sequence at positions 92-877 in NM_000074.3; the nucleotide sequence of the IL-2 gene is the gene sequence at positions 286-747 in NM_000586.4; the nucleotide sequence of the IL-4 gene is the gene sequence at positions 63-524 in BC070123.1; the nucleotide sequence of the IL-21 gene is the gene sequence at positions 46-534 in BC066260.1; and the nucleotide sequence of the BAFF gene is the gene sequence at positions 180-1037 in BC020674.1.

[0030] In the present invention, the fibroblasts are preferably NIH3T3 cells. NIH3T3 cells are immortalized mouse embryonic fibroblasts that can serve as feeder cells to support the long-term survival and self-renewal of B cells.

[0031] The present invention provides a method for preparing the above-mentioned genetically engineered fibroblasts, comprising the following steps:

[0032] (1) CD40L recombinant plasmid, IL-4-T2A-BAFF recombinant plasmid and IL-2-T2A-IL-21 recombinant plasmid were co-transfected with lentiviral packaging plasmid into mammalian cells to obtain lentiviral CD40L, lentiviral IL-4-T2A-BAFF and lentiviral IL-2-T2A-IL-21;

[0033] (2) infecting fibroblasts with lentiviral CD40L, culturing and screening to obtain cells containing CD40L;

[0034] (3) Infecting cells containing CD40L with lentivirus IL-4-T2A-BAFF, culturing and screening to obtain cells containing CD40L, IL-4 and BAFF;

[0035] (4) Infecting cells containing CD40L, IL-4 and BAFF with lentivirus IL-2-T2A-IL-21, culturing and screening to obtain cells containing CD40L, IL-4, IL-2, IL-21 and BAFF, i.e., genetically engineered fibroblasts.

[0036] In step (1) of the above preparation method, the CD40L recombinant plasmid contains the CD40L gene as shown in the gene sequence at positions 92-877 in NM_000074.3; the IL-4-T2A-BAFF recombinant plasmid contains the IL-4-T2A-BAFF gene as shown in the nucleotide sequence of SEQID NO.2; the IL-2-T2A-IL-21 recombinant plasmid contains the IL-2-T2A-IL-21 gene as shown in the nucleotide sequence of SEQID NO.4. As an embodiment, the preparation method of the CD40L recombinant plasmid includes: cutting the backbone plasmid A with EcoRI and BamHI to obtain a linearized plasmid A, and connecting the CD40L as shown in the gene sequence at positions 92-877 in NM_000074.3 with the linearized plasmid A. Further, the backbone plasmid A is pLVX-EF1α-IRES-Puro. The preparation method of the IL-4-T2A-BAFF recombinant plasmid includes: digesting the backbone plasmid B with EcoRI and BamHI enzymes to obtain a linearized plasmid B, and connecting the IL-4-T2A-BAFF with a nucleotide sequence such as SEQ ID NO.2 to the linearized plasmid B. Further, the backbone plasmid B is pLVX-EF1α-IRES-Neo, and the preparation of the backbone plasmid B includes digesting the pLVX-EF1α-IRES-Puro plasmid with BamHI and MluI enzymes to obtain a linearized plasmid pLVX-EF1α-IRES-Puro; replacing the puromycin resistance gene (Puro) in the linearized plasmid pLVX-EF1α-IRES-Puro with a neomycin resistance gene (Neo) with a sequence such as SEQ ID NO.1, to obtain. The preparation method of the IL-2-T2A-IL-21 recombinant plasmid includes: digesting the backbone plasmid C with EcoRI and BamHI enzymes to obtain a linearized plasmid C, and connecting the IL-2-T2A-IL-21 with the nucleotide sequence shown in SEQ ID NO.4 to the linearized plasmid C. Further, the backbone plasmid C is a pLVX-EF1α-IRES-Blast plasmid, and the preparation of the pLVX-EF1α-IRES-Blast plasmid includes digesting the pLVX-EF1α-IRES-Puro plasmid with BamHI and MluI enzymes to obtain a linearized plasmid pLVX-EF1α-IRES-Puro; replacing the puromycin resistance gene (Puro) in the linearized plasmid pLVX-EF1α-IRES-Puro with a blasticidin resistance gene with a sequence shown in SEQ ID NO.3. The lentiviral packaging plasmid includes psPAX2 and pMD2.G.The mass ratio of the CD40L recombinant plasmid, psPAX2 and pMD2.G is 4:3:1; the mass ratio of the IL-4-T2A-BAFF recombinant plasmid, psPAX2 and pMD2.G is 4:3:1; the mass ratio of the IL-2-T2A-IL-21 recombinant plasmid, psPAX2 and pMD2.G is 4:3:1. The mammalian cells include HEK-293T cells.

[0037] In step (2) of the above preparation method, the MOI of the lentivirus CD40L is 1-2. The fibroblasts are inoculated with 2×10 5 fibroblasts, fibroblasts after the cell density is 45-55%. The infection time is 48-96h, further 72h.

[0038] In step (3) of the above preparation method, the MOI of the lentivirus IL-4-T2A-BAFF is 1 to 2. The cells containing CD40L are inoculated with 2×10 5 The cells containing CD40L are confluent to a density of 45-55%. The infection time is 48-96 hours, and further 72 hours.

[0039] In step (4) of the above preparation method, the MOI of the lentivirus IL-2-T2A-IL-21 is 1 to 2. The cells containing CD40L, IL-4 and BAFF are inoculated with 2×10 5 The cells containing CD40L, IL-4 and BAFF are confluent to a density of 45-55%. The infection time is 48-96 hours, and further 72 hours.

[0040] The present invention also provides a use of the above genetically engineered fibroblasts or the fibroblasts obtained by the preparation method in the preparation of a B cell proliferation agent and / or a B cell differentiation agent.

[0041] The present invention also provides a culture medium for proliferation and / or differentiation of B cells, wherein the culture medium comprises cytokines, and the cytokines comprise the above-mentioned genetically engineered fibroblasts or the fibroblasts obtained by the preparation method.

[0042] In the present invention, the culture medium further comprises mitomycin C; the cytokine is the above-mentioned genetically engineered fibroblast or the fibroblast obtained by the preparation method, that is, the cytokine in the culture medium only contains the above-mentioned genetically engineered fibroblast or the fibroblast obtained by the preparation method. The culture medium of the present invention does not need to add additional cytokines that promote B cell proliferation and / or differentiation, thereby reducing the cost of the culture medium and simplifying the preparation process of the culture medium.

[0043] In the present invention, the method for preparing the culture medium for proliferation and / or differentiation of B cells comprises: 7 Inoculate into a culture bottle, wait until the cells are confluent to 70-90%, add mitomycin C with a final concentration of 9-11 μg / mL, treat for 1.5-2.5 hours and then discard mitomycin C, and obtain the treated fibroblasts (also called feeder cells), that is, the culture medium for proliferation and / or differentiation of B cells. Furthermore, the culture medium for proliferation and / or differentiation of B cells also includes RPMI 1640 culture medium containing 10% fetal bovine serum.

[0044] The present invention also provides a method for preparing B cells, comprising the step of culturing B cells with the above-mentioned culture medium to allow the B cells to proliferate.

[0045] The present invention also provides a method for preparing plasma cells, comprising the step of culturing B cells with the above-mentioned culture medium to differentiate the B cells into plasma cells.

[0046] The present invention also provides a method for preparing an antibody, characterized in that it comprises the steps of culturing B cells with the above-mentioned culture medium to differentiate the B cells into plasma cells, and the plasma cells synthesizing and secreting antibodies.

[0047] The present invention co-cultured the above-mentioned genetically engineered fibroblasts with B cells in vitro for 16 days. The results showed that the genetically engineered fibroblasts can stably express CD40L and BAFF, secrete high levels of IL-2, IL-4, and IL-21, support the efficient expansion of low-density B cells, and induce B cells to differentiate into plasma cells, and their antibody secretion amount is as high as 517 ng / mL.

[0048] In the present invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art.

[0049] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0050] In the following examples, experimental materials: mouse embryonic fibroblasts NIH3T3 cells were purchased from the cell bank of the Chinese Academy of Sciences and cultured in DMEM containing 10% fetal bovine serum; HEK-293T (human renal epithelial cells) cells were cultured in DMEM containing 10% fetal bovine serum; human lymphoid B cells were isolated from the peripheral blood of healthy volunteers and cultured in RPMI 1640 culture medium containing 10% fetal bovine serum.

[0051] The pLVX-EF1α-IRES-Puro was purchased from TAKARA, catalog number 631988.

[0052] Example 1

[0053] The inventors successfully constructed pLVX-EF1α-CD40L-Puro, pLVX-EF1α-IL-4-T2A-BAFF-Neo, and pLVX-EF1α-IL-2-T2A-IL-21-Blast packaging plasmids by molecular cloning technology, and prepared NIH3T3-CD40L-IL-2-IL-4-IL-21-BAFF. The specific experimental results are as follows.

[0054] The nucleotide sequence of the CD40L gene is shown in the gene sequence at positions 92-877 in NM_000074.3;

[0055] The nucleotide sequence of the IL-2 gene is shown in the gene sequence at positions 286-747 in NM_000586.4;

[0056] The nucleotide sequence of the IL-4 gene is shown in the gene sequence at positions 63-524 in BC070123.1;

[0057] The nucleotide sequence of the IL-21 gene is shown in the gene sequence at positions 46-534 in BC066260.1;

[0058] The nucleotide sequence of the BAFF gene is shown in the gene sequence at positions 180-1037 in BC020674.1.

[0059] 1. Experimental Methods

[0060] 1.1 Construction of recombinant plasmid

[0061] 1.1.1 Construction of lentiviral expression vector

[0062] Construction of pLVX-EF1α-CD40L-Puro: pLVX-EF1α-IRES-Puro was used as the backbone plasmid, which was digested with EcoRI and BamHI to obtain a linearized plasmid. The CD40L gene shown in the gene sequence at positions 92-877 in NM_000074.3 was then ligated to the linearized plasmid to obtain pLVX-EF1α-CD40L-Puro.

[0063] Construction of pLVX-EF1α-IL-4-T2A-BAFF-Neo: The pLVX-EF1α-IRES-Puro plasmid was digested with BamHI and MluI enzymes to obtain the linearized plasmid pLVX-EF1α-IRES-Puro; the puromycin resistance gene (Puro) in the linearized plasmid pLVX-EF1α-IRES-Puro was replaced with BamHI-IRES-Neo-MluI containing the neomycin resistance gene (Neo) to obtain the pLVX-EF1α-IRES-Neo plasmid.

[0064] The pLVX-EF1α-IRES-Neo plasmid was digested with EcoRI and BamHI enzymes to obtain a linearized plasmid pLVX-EF1α-IRES-Neo, and the 5' end and 3' end of the IL-4-T2A-BAFF gene shown in SEQ ID NO.2 were modified with EcoRI and BamHI enzymes, respectively, and the IL-4-T2A-BAFF gene modified with EcoRI and BamHI enzymes was ligated with the linearized plasmid pLVX-EF1α-IRES-Neo to obtain a pLVX-EF1α-IL-4-T2A-BAFF-Neo plasmid.

[0065]

[0066]

[0067] Construction of pLVX-EF1α-IL-2-T2A-IL-21-Blast: The pLVX-EF1α-IRES-Puro plasmid was digested with BamHI and MluI enzymes to obtain the linearized plasmid pLVX-EF1α-IRES-Puro; the puromycin resistance gene (Puro) in the linearized plasmid pLVX-EF1α-IRES-Puro was replaced with the blasticidin resistance gene BamHI-IRES-Blast-MluI to obtain the pLVX-EF1α-IRES-Blast plasmid.

[0068] The pLVX-EF1α-IRES-Blast plasmid was digested with EcoRI and BamHI enzymes to obtain a linearized plasmid pLVX-EF1α-IRES-Blast, and the 5' end and 3' end of the IL-2-T2A-IL-21 gene as shown in SEQ ID NO.4 were modified with EcoRI and BamHI enzymes, respectively, and the IL-2-T2A-IL-21 gene modified with EcoRI and BamHI enzymes was ligated with the linearized plasmid pLVX-EF1α-IRES-Blast to obtain a pLVX-EF1α-IL-2-T2A-IL-21-Blast plasmid.

[0069] The nucleic acid sequence of the blasticidin resistance gene BamHI-IRES-Blast-MluI is as follows: 5'-ggatcccgcccctctccctcccccccccctaacgttactggccgaagccgcttggaataaggccggtgtgcgtttgtctatatgttattttccaccatattgccgtcttttggcaatgtgagggcccggaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttcttgaagacaaacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgacaggtgcctctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccccagtgccacgttgtgagttggatagttgtggaaagagtcaaatggctctcctcaagcgtattcaacaaggggctgaaggatgcccagaaggtaccccattgtatgggatctgatctggggcctcggtgcacatgctttacatgtgtttagtcgaggttaaaaaaacgtctaggccccccgaaccacggggacgtggttttcctttgaaaaacacgatgataagcttgccacaacccacaaggagacgaccttccatggccaagcctttgtctcaagaagaatccaccctcattgaaagagcaacggctacaatcaacagcatccccatctctgaagactacagcgtcgccagcgcagctctctctagcgacggccgcatcttcactggtgtcaatgtatatcattttactgggggaccttgtgcagaactcgtggtgctgggcactgctgctgctgcggcagctggcaacctgacttgtatcgtcgcgatcggaaatgagaacaggggcatcttgagcccctgcggacggtgccgacaggtgcttctcgatctgcatcctgggatcaaagccatagtgaaggacagtgatggacagccgacggcagttgggattcgtgaattgctgccctctggttatgtgtgggagggctaaacgcgt-3’(SEQ ID NO.3).

[0070] The nucleotide sequence of the IL-2-T2A-IL-21 gene is as follows:

[0071] atgtacaggatgcaactcctgtcttgcattgcactaagtcttgcacttgtcacaaacagtgcacctacttcaagttctacaaagaaaacacagctacaactggagcattta

[0072] ctgctggatttacagatgattttgaatggaattaataattacaagaatcccaaactcaccaggatgctcacatttaagttttacatgcccaagaaggccacagaactgaaa

[0073] catcttcagtgtctagaagaagaactcaaacctctggaggaagtgctaaatttagctcaaagcaaaaactttcacttaagacccagggacttaatcagcaatatcaacgt

[0074] aatagttctggaactaaagggatctgaaacaacattcatgtgtgaatatgctgatgagacagcaaccattgtagaatttctgaacagatggattaccttttgtcaaagcatc

[0075] atctcaacactgactgcggccgcagagggcagaggaagtcttctaacatgcggtgacgtggaggagaatcccggccctatgagatccagtcctggcaacatggag

[0076] aggattgtcatctgtctgatggtcatcttcttggggacactggtccacaaatcaagctcccaaggtcaagatcgccacatgattagaatgcgtcaacttatagatattgttg

[0077] atcagctgaaaaattatgtgaatgacttggtccctgaatttctgccagctccagaagatgtagagacaaactgtgagtggtcagctttttcctgttttcagaaggcccaact

[0078] aaagtcagcaaatacaggaaacaatgaaaggataatcaatgtatcaattaaaaagctgaagaggaaaccaccttccacaaatgcagggagaagacagaaacacag

[0079] actaacatgcccttcatgtgattctttatgagaaaaaaccacccaaagagttcctagaaagattcaaatcacttctccaaaagatgattcatcagcatctgtcctctagaaca

[0080] cacggaagtgaagattcctga (SEQ ID NO. 4).

[0081] 1.1.2 Plasmid extraction

[0082] A three-plasmid lentiviral packaging system was used, and the plasmids used included lentiviral expression vector and lentiviral packaging plasmids psPAX2 and pMD2.G. An endotoxin-free extraction kit was used to extract a large amount of pLVX-EF1α-CD40L-Puro (CD40L recombinant plasmid), pLVX-EF1α-IL-4-T2A-BAFF-Neo (IL-4-T2A-BAFF recombinant plasmid), and pLVX-EF1α-IL-2-T2A-IL-21-Blast (IL-2-T2A-IL-21 recombinant plasmid) for later use.

[0083] 1.1.3 Lentiviral packaging

[0084] (1) Cell preparation: HEK-293T cells in the best culture state were inoculated into a 10 cm culture dish and shaken evenly until the density reached 80% for lentiviral packaging.

[0085] (2) Prepare transfection solution: Add 1.25 mL Opti-MEM culture medium to a 5 mL EP tube, then add 60 μL Lipofectamine 2000, mix well, and let stand for 5 min. Add an equal volume of culture medium to another 5 mL EP tube, then add 10 μg of target plasmid (pLVX-EF1α-CD40L-Puro, pLVX-EF1α-IL-4-T2A-BAFF-Neo or pLVX-EF1α-IL-2-T2A-IL-21-Blast plasmid), 7.5 μg psPAX2 and 2.5 μg pMD2.G helper plasmid to obtain a mixed solution. Gently mix the above mixed solution and let stand for 20 min.

[0086] (3) Discard the HEK-293T cell culture supernatant and slowly add 5 mL of serum-free DMEM culture medium. After the mixed solution in step (2) has completely settled, discard the culture medium and slowly add the mixed solution to the HEK-293T cell culture dish. Then add 2.5 mL of Opti-MEM culture medium and gently shake the bottom of the dish to make the liquid uniform. Place the cells in an incubator and culture them at 37°C and 5% CO2 for 6 hours.

[0087] (4) Lipofectamine TM After incubating the cells with 2000 (purchased from Invitrogen) for 6 h, the liquid was discarded and 10 mL of DMEM complete culture medium was slowly added to culture the cells. The viruses were collected at 48 h and 72 h after transfection, mixed evenly, centrifuged at 3000 rpm for 5 min to remove cell debris in the virus, and filtered with a 0.22 μm filter to obtain purified virus liquid, that is, lentivirus CD40L, lentivirus IL-4-T2A-BAFF or lentivirus IL-2-T2A-IL-21.

[0088] 1.2 Preparation and screening of NIH3T3-CD40L-IL-2-IL-4-IL-21-BAFF cells

[0089] 1.2.1 Preparation and screening of NIH3T3-CD40L cells

[0090] (1) 2×10 5 NIH3T3 cells were plated in 6-well plates one day in advance and infected when the cell density reached about 50%.

[0091] (2) NIH3T3 cells were infected with lentivirus CD40L at an MOI of 1-2 and cultured in a cell culture incubator at 37° C. and 5% CO 2 .

[0092] (3) 72 hours after the cells were infected with the virus, the virus solution was removed and replaced with DMEM complete culture medium containing 2.5 μg / mL puro (selective culture medium 1) for screening.

[0093] (4) The same selective culture medium 1 was replaced every 2 days. After incubation for 14 days, NIH3T3-CD40L cells were obtained. A certain number of cells were taken to incubate with antibodies and flow cytometry was used to detect the infection effect.

[0094] 1.2.2 Preparation and screening of NIH3T3-CD40L-IL-4-BAFF cells

[0095] (1) 2×10 5 NIH3T3-CD40L cells were plated in 6-well plates one day in advance and infected when the cell density reached about 50%.

[0096] (2) NIH3T3-CD40L cells were infected with lentivirus IL-4-T2A-BAFF at an MOI of 1-2 and cultured in a cell culture incubator at 37° C. and 5% CO 2 .

[0097] (3) 72 hours after the cells were infected with the virus, the virus solution was removed and replaced with DMEM complete culture medium containing 800 μg / mL G418 (selective culture medium 2) for screening.

[0098] (4) The same selective culture medium 2 was replaced every 2 days. After incubation for 14 days, NIH3T3-CD40L-IL-4-BAFF cells were obtained. A certain number of cells were taken to incubate with antibodies and flow cytometry was used to detect the infection effect.

[0099] 1.2.3 Preparation and screening of NIH3T3-CD40L-IL-2-IL-4-IL-21-BAFF cells

[0100] (1) 2×10 5 NIH3T3-CD40L-IL-4-BAFF cells were plated in 6-well plates one day in advance and infected when the cell density reached about 50%.

[0101] (2) NIH3T3-CD40L-IL-4-BAFF cells were infected with lentivirus IL-2-T2A-IL-21 at an MOI of 1 to 2 and cultured in a cell culture incubator at 37° C. and 5% CO 2 .

[0102] (3) 72 hours after the cells were infected with the virus, the virus solution was removed and replaced with DMEM complete culture medium containing 5 μg / mL blasticidin (selective culture medium 3) for screening.

[0103] (4) The same selective culture medium 3 was replaced every 2 days. After incubation for 14 days, NIH3T3-CD40L-IL-2-IL-4-IL-21-BAFF cells were obtained, and the cell culture supernatant was taken for ELISA detection.

[0104] 1.2.4 Statistical analysis

[0105] SPSS23.0 and GraphPad Prism 8 statistical software were used to perform statistical analysis and prepare graphs for the experimental data.

[0106] The data were expressed as x±s. The differences between the two groups were analyzed by t-test, and the differences among multiple groups were analyzed by one-way analysis of variance. P<0.05 was considered statistically significant.

[0107] 3 Results

[0108] 3.1 Identification of NIH3T3 cell surface molecule expression by flow cytometry

[0109] The results of flow cytometry showed that after NIH3T3 cells were infected with lentiviral CD40L for 3 days and screened by puro for 14 days, the proportion of NIH3T3 cells expressing CD40L molecules was 92.5% ( Figure 1 In addition, after NIH3T3-CD40L cells were infected with lentiviral IL-4-T2A-BAFF for 3 days and selected with G418 for 14 days, NIH3T3-CD40L cells expressing BAFF molecules accounted for 72.1% ( Figure 1 B).

[0110] 3.2 Expression and identification of cytokines IL-2, IL-4, and IL-21

[0111] The culture supernatants of wild-type NIH3T3 cells and NIH3T3-CD40L-IL2-IL-4-IL21-BAFF cells were collected and cytokine detection was performed according to the instructions of the ELISA kit. The results showed that ( Figure 2 ), a small amount of IL-2, IL-4, and IL21 could be detected in the supernatant of wild-type NIH3T3 cells, while the content of IL-2, IL-4, and IL21 in the culture supernatant of NIH3T3-CD40L-IL2-IL-4-IL21-BAFF cells was as high as 300 ng / mL (P<0.0001), which was significantly higher than that of wild-type cells, indicating that the NIH3T3-CD40L-IL-2-IL-4-IL-21-BAFF cell line was successfully constructed.

[0112] Example 2

[0113] This example uses flow cytometry to identify the sorting results of B cells and successfully sorts B cells in the peripheral blood of healthy people. The specific experimental results are as follows.

[0114] 2. Experimental Methods

[0115] 2.1 Isolation of B cells

[0116] 2.1.1 Isolation of peripheral blood mononuclear cells

[0117] (1) Take fresh anticoagulated whole blood and dilute it with an equal volume of normal saline.

[0118] (2) Add a certain volume of separation solution to the centrifuge tube in advance, and slowly spread the diluted blood sample on the surface of the separation solution, keeping the interface between the two liquid surfaces clear. The volume of anticoagulated whole blood, physiological saline, and separation solution is 1:1:1.

[0119] (3) Room temperature, 800 g, centrifugation for 30 min. The centrifuge's ascending damping is 4 and descending damping is 0.

[0120] (4) After centrifugation, carefully pipette the thin and dense white membrane between the plasma layer and the separation liquid layer into another centrifuge tube.

[0121] (5) Dilute to a certain volume with physiological saline, invert to mix, centrifuge horizontally at 250g for 10 min, discard the supernatant, and repeat the washing process twice.

[0122] (6) Resuspend the cells in physiological saline for later use.

[0123] 2.1.2 Isolation of B cells

[0124] A certain number of PBMCs were collected, resuspended in 80 μL MACS buffer and transferred to a new tube. According to the instructions of the Human CD19 MicroBeads sorting kit (Miltenyi Biotec catalog: 5201105906), 1×10 7 Add 20μL CD19 MicroBeads to each cell, mix well and incubate on ice for 30 minutes. Pre-add 1mL MACS buffer to the MS column to wash the column, add the labeled cell suspension to the pre-washed MS column, place it on the magnetic rack, and let the cells pass through the column. Repeat three times, remove the MS column, use the plunger to push the cells out of the column, and collect them in a new centrifuge tube. These cells are CD19 + B cells. Add 1 mL MACS buffer, centrifuge at 800 g for 5 min, discard the supernatant, and repeat the washing step once. Resuspend the washed cells in 1640 culture medium containing 10% fetal bovine serum for culture. Results Flow cytometry detection showed that after sorting, CD3 + The proportion of T cells reached 92.0%, meeting the requirements of subsequent experiments.

[0125] 3. Results

[0126] 3.1 Flow cytometry detection of B cell sorting

[0127] Human CD19 magnetic beads were used to separate B cells from healthy human peripheral blood. After staining with anti-human CD19-FITC, the positive rate of B cells was 92.0% (see Figure 3 ), indicating that B cells have been successfully sorted.

[0128] Example 3

[0129] NIH3T3-CD40L-IL2-IL-4-IL21-BAFF cells were successfully prepared using Example 1 and B cells were sorted out using Example 2. The two cells were co-cultured for 16 days. The specific experimental results are as follows.

[0130] 3 Experimental methods

[0131] Mitomycin C has the ability to depolymerize cell DNA, inhibit DNA replication, and thus inhibit cell division. NIH3T3 cells are mouse fibroblasts that do not proliferate after being treated with mitomycin C and can be used as feeder cells for co-culture with B cells.

[0132] 3.1 Co-culture of feeder cells and B cells

[0133] (1) NIH3T3-CD40L cells and NIH3T3-CD40L-IL-2-IL-4-IL-21-BAFF cells prepared in Example 1 were respectively cultured at 1×10 6 Inoculate 5 mL of the culture medium into a T25 cell flask at a density of cells / mL.

[0134] (2) When the cells are about 80% confluent, add mitomycin C at a final concentration of 10 μg / mL and incubate at 37°C in the dark for 2 h.

[0135] (3) After 2 h, the mitomycin C was discarded and the cells were washed 5 times with PBS. The cells were digested into single cells and the number of cells was 2 × 10 5 The cells were plated in 24-well plates to obtain treated NIH3T3-CD40L cells or treated NIH3T3-CD40L-IL-2-IL-4-IL-21-BAFF cells.

[0136] (4) The healthy human B cells sorted in Example 2 were inoculated at 100 cells / well into NIH3T3-CD40L cells containing or not treated and NIH3T3-CD40L-IL-2-IL-4-IL-21-BAFF cells treated to obtain single B cells, B cells + NIH3T3-CD40L cells co-culture, and B cells + NIH3T3-CD40L-IL-2-IL-4-IL-21-BAFF cells co-culture, respectively.

[0137] (5) B cells were cultured in RPMI 1640 medium containing 10% fetal bovine serum (hereinafter referred to as complete medium, which does not contain IL-2, IL-4, IL-21 and BAFF) (ie, B cell only group).

[0138] B cells + NIH3T3-CD40L cells were co-cultured in complete medium containing 50 ng / mL IL-2, 10 ng / mL IL-4, 10 ng / mL IL-21, and 10 ng / mL BAFF (i.e., NIH3T3-CD40L + IL-2, IL-4, IL-21, BAFF or Bcell + NIH3T3-CD40L + IL-2, IL-4, IL-21, BAFF groups).

[0139] B cell + NIH3T3-CD40L-IL-2-IL-4-IL-21-BAFF cell co-cultures were cultured only in complete medium, (i.e., NIH3T3-CD40L-IL-2-IL-4-IL-21-BAFF or B cell + NIH3T3-CD40L-IL-2-IL-4-IL-21-BAFF groups).

[0140] 3.2 Statistical analysis

[0141] SPSS23.0 and GraphPad Prism 8 statistical software were used to perform statistical analysis and prepare graphs for the experimental data.

[0142] The difference between the two groups was analyzed by t test, and the difference between multiple groups was analyzed by one-way analysis of variance. P < 0.05 was considered statistically significant. 3.3 Microscopic observation of B cell proliferation

[0143] During the co-culture of B cells and NIH3T3-CD40L-IL-2-IL-4-IL-21-BAFF cells, the growth of B cells was observed under a microscope. On the 2nd, 4th, 6th, 8th, 10th, 12th, 14th, and 16th days of the experiment, three fields of view were randomly selected from each well and photographed to evaluate the proliferation of B cells.

[0144] Figure 4 The results showed that B cell clustering could be observed on the 6th day of co-culture, agglomeration appeared on the 10th day, and the B cell aggregation phenomenon became more obvious on the 16th day, indicating that the NIH3T3-CD40L-IL-2-IL-4-IL-21-BAFF cell line of the present invention can support B cell culture in vitro for up to 16 days and effectively maintain the survival of B cells in vitro (see Figure 4 A).

[0145] 3.4 Flow cytometry detection of B cell phenotype changes

[0146] During the co-culture of B cells and NIH3T3-CD40L-IL-2-IL-4-IL-21-BAFF cells, B cells were obtained for CD19-FITC, CD27-PE, CD38-PE, CD138-APC, and HLA-DR-PE-Cy5 staining on days 0, 4, 8, 12, and 16, and flow cytometry histograms were used to observe the changing trends of B cell phenotypes.

[0147] Figure 4 The results showed that during the 16-day co-culture process, the expression of CD19 and HLA-DR on the surface of B cells was downregulated, while the expression of CD27, CD38, and CD138 was upregulated ( Figure 4 B), indicating that the NIH3T3-CD40L-IL-2-IL-4-IL-21-BAFF cell line of the present invention can also significantly promote the differentiation of B cells into plasma cells.

[0148] 3.5 Cell counter records the number of B cells

[0149] B cells co-cultured with NIH3T3-CD40L cells and NIH3T3-CD40L-IL-2-IL-4-IL-21-BAFF cells were collected every 2 days, and the number of B cells was recorded using a cell counter.

[0150] The B cells co-cultured with NIH3T3-CD40L and NIH3T3-CD40L-IL-2-IL-4-IL-21-BAFF were counted regularly, and it was found that the number of B cells after co-culture increased from 10 2 Grow to 10 8 ( Figure 4 This indicates that the use of NIH3T3-CD40L-IL-2-IL-4-IL-21-BAFF as feeder cells to co-culture with B cells can ensure the proliferation of B cells without the addition of expensive cytokines.

[0151] 3.6 IgG secretion level detection

[0152] During the culture process of the B cell only group, B cell + NIH3T3-CD40L + IL-2, IL-4, IL-21, BAFF group and B cell + NIH3T3-CD40L-IL-2-IL-4-IL-21-BAFF group, the culture supernatant was regularly collected every four days and immediately replaced with the corresponding culture medium (i.e., the B cell only group and B cell + NIH3T3-CD40L-IL-2-IL-4-IL-21-BAFF group culture were replaced with complete culture medium, and the B cell + NIH3T3-CD40L + IL-2, IL-4, IL-21, BAFF group was replaced with complete culture medium containing 50ng / mLIL-2, 10ng / mLIL-4, 10ng / mLIL-21 and 10ng / mLBAFF) to maintain the stability of cell growth and function. During the entire 16-day culture period, all collected supernatants will be retained and used to detect the IgG content therein.

[0153] Figure 4 The results showed that the IgG content in the supernatant of B cells co-cultured with NIH3T3-CD40L-IL-2-IL-4-IL-21-BAFF cells was as high as 517 ng / mL, which was not significantly different from that in the NIH3T3-CD40L group, but was significantly higher than that in the supernatant of B cells cultured alone ( Figure 4 D)

[0154] The above results indicate that the NIH3T3-CD40L-IL-2-IL-4-IL-21-BAFF cell line can effectively support the proliferation of B cells and promote the differentiation of B cells into plasma cells, thereby secreting higher levels of antibodies.

[0155] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A genetically engineered fibroblast, characterized in that: The fibroblasts contain CD40L gene, IL-2 gene, IL-4 gene, IL-21 gene and BAFF gene.

2. The fibroblast according to claim 1, characterized in that The nucleotide sequence of the CD40L gene is the gene sequence at positions 92-877 in NM_000074.3; the nucleotide sequence of the IL-2 gene is the gene sequence at positions 286-747 in NM_000586.4; the nucleotide sequence of the IL-4 gene is the gene sequence at positions 63-524 in BC070123.1; the nucleotide sequence of the IL-21 gene is the gene sequence at positions 46-534 in BC066260.1; the nucleotide sequence of the BAFF gene is the gene sequence at positions 180-1037 in BC020674.1; and the fibroblasts are NIH3T3 cells.

3. A method for preparing the genetically engineered fibroblasts according to claim 1 or 2, characterized in that: The following steps are involved: (1) CD40L recombinant plasmid, IL-4-T2A-BAFF recombinant plasmid and IL-2-T2A-IL-21 recombinant plasmid were co-transfected with lentiviral packaging plasmid into mammalian cells to obtain lentiviral CD40L, lentiviral IL-4-T2A-BAFF and lentiviral IL-2-T2A-IL-21; (2) infecting fibroblasts with lentiviral CD40L, culturing and screening to obtain cells containing CD40L; (3) Infecting cells containing CD40L with lentivirus IL-4-T2A-BAFF, culturing and screening to obtain cells containing CD40L, IL-4 and BAFF; (4) Infecting cells containing CD40L, IL-4 and BAFF with lentivirus IL-2-T2A-IL-21, culturing and screening to obtain cells containing CD40L, IL-4, IL-2, IL-21 and BAFF, i.e., genetically engineered fibroblasts.

4. The preparation method according to claim 3, characterized in that: The CD40L recombinant plasmid contains the CD40L gene as shown in the gene sequence at positions 92-877 in NM_000074.3; the IL-4-T2A-BAFF recombinant plasmid contains the IL-4-T2A-BAFF gene as shown in the nucleotide sequence of SEQ ID NO.2; the IL-2-T2A-IL-21 recombinant plasmid contains the IL-2-T2A-IL-21 gene as shown in the nucleotide sequence of SEQ ID NO.

4.

5. Use of the genetically engineered fibroblasts according to claim 1 or 2 or the fibroblasts obtained by the preparation method according to claim 3 or 4 in the preparation of a B cell proliferation agent and / or a B cell differentiation agent.

6. A culture medium for proliferation and / or differentiation of B cells, characterized in that The culture medium comprises cytokines, and the cytokines comprise the genetically engineered fibroblasts according to claim 1 or 2 or the fibroblasts obtained by the preparation method according to claim 3 or 4.

7. The culture medium according to claim 6, characterized in that The culture medium further comprises mitomycin C; the cytokine is the genetically engineered fibroblasts according to claim 1 or 2 or the fibroblasts obtained by the preparation method according to claim 3 or 4; The method for preparing the culture medium for proliferation and / or differentiation of B cells comprises the following steps: 7 The cells are inoculated into a culture bottle, and when the cells are confluent to 70-90%, mitomycin C with a final concentration of 9-11 μg / mL is added. After treatment for 1.5-2.5 hours, the mitomycin C is discarded to obtain the treated fibroblasts, that is, the culture medium for proliferation and / or differentiation of B cells.

8. A method for preparing B cells, characterized in that: The method comprises the step of culturing B cells with the culture medium according to claim 6 or 7 to allow the B cells to proliferate.

9. A method for preparing plasma cells, characterized in that: The method comprises the step of culturing B cells with the culture medium according to claim 6 or 7 to differentiate the B cells into plasma cells.

10. A method for preparing an antibody, characterized in that: The method comprises the steps of culturing B cells with the culture medium of claim 6 or 7, so that the B cells differentiate into plasma cells, and the plasma cells synthesize and secrete antibodies.

Images