Thrombin-specific RNA aptamers screened based on SELEX technology and their applications

Abstract

The present invention provides a ribonucleic acid aptamer that binds to thrombin protein by improving screening conditions. The aptamer has a small molecular weight, stable chemical properties, and is easy to store and label. It can bind to the thrombin protein through spatial conformation matching, stacking of bases in the sequence, electrostatic interaction or hydrogen bonding between charged groups, etc., and has high binding affinity and good specificity. Therefore, the application of the aptamer in thrombin detection, imaging, regulation, etc. is also provided.

Description

Technical Field

[0001] The invention belongs to the field of analytical chemistry and biological detection, and in particular relates to a thrombin protein-specific RNA aptamer screened based on the SELEX technology and a binding affinity analysis thereof. Background Art

[0002] Thrombin is a trypsin-like serine protease generated by prothrombin (coagulation factor II) through proteolysis. It converts soluble fibrinogen into insoluble fibrin to form blood clots. Therefore, the procoagulant effect of thrombin plays a key role in coronary heart disease and other thrombotic diseases. Timely detection and targeted regulation of thrombin content in patients with thrombotic diseases are of great significance for the control of their condition.

[0003] The basic principles of the binding of aptamers screened by SELEX technology to target molecules of different sizes are similar. They are all due to the interaction between single-stranded oligonucleotide bases, which often form many spatial conformations, such as hairpins, pseudoknots, G-tetramers, etc. The specific binding between the aptamer and the target molecule is achieved through spatial conformation matching, stacking of bases in the sequence, electrostatic interaction or hydrogen bonding between charged groups, etc.

[0004] Existing drugs for detecting or regulating thrombin have problems such as complex synthesis, difficulty in modification, low affinity or poor specificity. Existing thrombin aptamer sequences are mostly G-rich sequences, which are easily interfered by various life activities in the body, and have unsatisfactory affinity and specificity.

[0005] Therefore, for the detection and regulation of thrombin, there is an urgent need to develop safe, efficient, high-affinity, good specificity and low-cost substances. Summary of the invention

[0006] The present invention provides an RNA aptamer thromb-rapt01 binding to thrombin protein based on SELEX technology, and based on the high affinity and high specificity of thromb-rapt01 to thrombin protein, provides applications of thromb-rapt01 in detection, diagnosis, imaging and treatment.

[0007] In a first aspect of the present invention, a thrombin protein-binding RNA aptamer is provided, wherein the RNA aptamer comprises a core sequence as shown in SEQ ID NO:5.

[0008] In another preferred embodiment, there are flanking sequences at the 5' end and / or 3' end of the core sequence.

[0009] In another preferred embodiment, the length of the flanking sequence is 1-80 bases, preferably extended by 5-50 bases, and most preferably extended by 10-30 bases.

[0010] In another preferred example, the thrombin protein is human thrombin protein.

[0011] In another preferred embodiment, the affinity index of the RNA aptamer to the thrombin protein is K D The value is 1-100 nM, preferably 1-50 nM, and most preferably 1-10 nM.

[0012] In another preferred example, the RNA aptamer comprises the RNA sequence shown in SEQ ID NO:1.

[0013] In another preferred embodiment, the RNA aptamer further comprises an RNA sequence having a sequence identity of ≥85%, preferably ≥90%, and optimally ≥95% with SEQ ID NO:1.

[0014] In another preferred embodiment, the RNA aptamer sequence is shown in SEQ ID NO:1.

[0015] In another preferred embodiment, one or more positions in the RNA aptamer sequence are modified by a modification selected from the group consisting of phosphorylation, methylation, amination, sulfhydrylation, replacement of oxygen with sulfur, replacement of oxygen with selenium, or a combination thereof.

[0016] In another preferred embodiment, the one or more are 1-10, preferably 1-5, and most preferably 1-3.

[0017] In another preferred embodiment, the modification enhances the stability of the RNA aptamer sequence.

[0018] In the second aspect of the present invention, a conjugate is provided, wherein the conjugate comprises the RNA aptamer described in the first aspect of the present invention and a detectable marker connected to the RNA aptamer.

[0019] In another preferred embodiment, the detectable marker includes biotin, a chemiluminescent group, a chemifluorescent group, a fluorescent protein, an enzyme, colloidal gold, a radioactive isotope, latex particles, an antibody, a ligand, an antigen, a receptor, or a combination thereof.

[0020] In the third aspect of the present invention, a biochip is provided, wherein the biochip comprises the RNA aptamer described in the first aspect of the present invention or the conjugate described in the second aspect of the present invention.

[0021] In the fourth aspect of the present invention, there is provided the use of the RNA aptamer according to the first aspect of the present invention, the conjugate according to the second aspect of the present invention, or the biochip according to the third aspect of the present invention for the following purposes:

[0022] (Z1) for preparing a kit for detecting thrombin protein;

[0023] (Z2) for preparing a reagent for imaging thrombin protein;

[0024] (Z3) preparing a pharmaceutical composition targeting thrombin protein; and / or

[0025] (Z4) is used to purify thrombin protein.

[0026] In the fifth aspect of the present invention, a detection kit is provided, the detection kit comprising: the RNA aptamer described in the first aspect of the present invention, or the conjugate described in the second aspect of the present invention.

[0027] In the sixth aspect of the present invention, there is provided a use of the detection kit described in the fifth aspect of the present invention for preparing a kit for diagnosing thrombotic diseases caused by thrombin.

[0028] In another preferred embodiment, the thrombotic diseases include: congenital hereditary thrombosis and thrombosis caused by external stimulation.

[0029] In another preferred embodiment, the external stimulus includes: surgical operation, pregnancy, taking contraceptives, taking antiphospholipid antibodies or a combination thereof.

[0030] In another preferred embodiment, the thrombotic diseases include: venous thrombotic diseases and arterial thrombotic diseases.

[0031] In another preferred embodiment, the thrombotic diseases include (but are not limited to): cerebral embolism, stroke, and cardiac thrombosis.

[0032] In a seventh aspect of the present invention, a composition is provided, comprising:

[0033] (a) the RNA aptamer according to the first aspect of the present invention; and

[0034] (b) optionally, a pharmaceutically acceptable excipient.

[0035] In the eighth aspect of the present invention, a nucleic acid sequence is provided, which is the antisense sequence of the sequence shown in SEQ ID NO:1.

[0036] In the ninth aspect of the present invention, a nucleic acid sequence is provided, wherein the nucleic acid sequence is a DNA sequence encoding SEQ ID NO: 1.

[0037] In a tenth aspect of the present invention, a method for detecting thrombin protein is provided, comprising the following steps:

[0038] (S1) providing a sample to be tested;

[0039] (S2) mixing the sample to be detected with the RNA aptamer described in the first aspect of the present invention or the conjugate described in the second aspect of the present invention to form a mixture;

[0040] (S3) detecting the presence or absence of the "thrombin protein-RNA aptamer complex" in the mixture, wherein if the complex exists, it indicates that the thrombin protein exists in the sample; if the complex does not exist, it indicates that the thrombin protein does not exist in the sample.

[0041] In another preferred embodiment, the detection includes qualitative detection and quantitative detection.

[0042] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 The data of affinity test between RNA library and thrombin protein are shown. The binding ability of the enriched library obtained in the 1st, 7th and 8th rounds of screening with thrombin protein was tested by surface plasmon resonance experiment.

[0044] Figure 2 The affinity test data of SEQ ID NO: 1 and thrombin protein are shown. The binding affinity of RNA aptamer thromb-rapt01 and thrombin protein was tested by surface plasmon resonance (SPR) experiment.

[0045] Figure 3 The NUPACK predicted secondary structure of the RNA aptamer thromb-rapt01 is shown.

[0046] Figure 4 The SPR experimental data of a certain RNA sequence in the library and its binding to thrombin protein are displayed, indicating that the binding performance of the sequence to human thrombin protein is poor.

[0047] Figure 5 The secondary structure of a certain RNA sequence in the library is shown.

[0048] Figure 6 The RNA aptamer thromb-rapt01 was shown in different K + Circular dichroism spectra under . DETAILED DESCRIPTION

[0049] The inventors have designed and synthesized a random single-stranded RNA library and corresponding primers through extensive and in-depth research, and obtained an RNA aptamer (thromb-rapt01) with small molecular weight, stable chemical properties, easy storage and labeling, and capable of binding to thrombin protein with high affinity and high specificity through a large number of screening and verification; and provided the application of the RNA aptamer. On this basis, the present invention was completed.

[0050] As used herein, the "core sequence" refers to a key sequence for binding to human thrombin protein, which is a determining factor in the affinity of RNA aptamers for binding to human thrombin protein. In certain embodiments, replacing the core sequence with any RNA sequence will result in the disappearance or significant reduction of the affinity of RNA aptamers for human thrombin protein. The significant reduction is a statistically significant reduction.

[0051] As used herein, the "flanking sequence" refers to an RNA sequence present at the 5' and / or 3' end of the core sequence of the RNA aptamer. In certain embodiments, the flanking sequence participates in the binding of the RNA aptamer to the human thrombin protein. In certain embodiments, the flanking sequence does not participate in the binding of the RNA aptamer to the human thrombin protein. In certain embodiments, the presence or absence of the flanking sequence does not significantly differ in the affinity of the RNA aptamer to the human thrombin protein. In certain embodiments, the flanking sequence can be replaced by any RNA sequence.

[0052] As used herein, thrombin protein and thrombin are used interchangeably.

[0053] Thrombin

[0054] Thrombin is a trypsin-like serine protease generated by prothrombin (coagulation factor II) through proteolysis, and plays a key role in the coagulation process of the human body. The main function of thrombin is to convert soluble fibrinogen into insoluble fibrin, thereby forming a blood clot and achieving the purpose of rapid hemostasis.

[0055] Thrombin also participates in other coagulation-related reactions, such as promoting platelet aggregation and activating other coagulation factors. In clinical practice, thrombin is often used as a hemostatic drug, especially for hemostasis of small blood vessels and capillaries that are difficult to ligate and hemostasis, as well as hemostasis of solid organ bleeding.

[0056] In addition to its procoagulant function, thrombin also has anticoagulant and antifibrinolytic activity in the presence of thrombomodulin. Studies have shown that the procoagulant effect of thrombin plays a key role in coronary heart disease and other thrombotic diseases.

[0057] Currently, the drugs used clinically to regulate thrombin activity mainly include small molecule compounds, peptides and nucleic acid aptamers.

[0058] Aptamers

[0059] Nucleic acid aptamers refer to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) molecules screened and separated by systematic evolution of ligands by exponential enrichment (SELEX). They can bind to a variety of targets such as proteins, metal ions, small molecules, cells, bacteria, tissues and viruses with high affinity and specificity, and have attracted widespread attention in many fields such as biological analysis, environmental monitoring, biomedicine, and drug synthesis. Compared with antibodies, nucleic acid aptamers have the advantages of small molecular weight, simple and rapid synthesis, high thermal stability, easy chemical modification, and low immunogenicity. Screening highly specific nucleic acid aptamers targeting thrombin protein is helpful to achieve high-sensitivity detection of thrombin protein, as well as biomedical applications such as drug development targeting thrombin protein.

[0060] Although several nucleic acid aptamers targeting thrombin protein have been screened, most of them are composed of guanine (G)-rich DNA sequences and form G-quadruplex (G4) structures. G4 is a special nucleic acid secondary structure that is widely present in the genome and plays an important biological role, such as telomere maintenance, gene transcription regulation and DNA replication. However, there are a large number of G4 nucleic acid binding proteins in cells at the same time, and DNA G4 aptamers targeting thrombin protein may produce non-specific binding. RNA aptamers can form more complex and diverse tertiary structures due to their additional 2'-hydroxyl groups, which enables them to specifically bind to a wider variety of target molecules. Therefore, screening RNA aptamers targeting thrombin with non-G4 structures has important prospects.

[0061] RNA aptamers of the present invention

[0062] The RNA aptamer of the present invention refers to an RNA aptamer named thromb-rapt01, which is obtained by screening a random single-stranded RNA library and corresponding primers based on the SELEX technology. The RNA aptamer has a small molecular weight, stable chemical properties, is easy to store and label, and can bind to the thrombin protein with high affinity. The dissociation constant (K) of the RNA aptamer is determined by surface plasmon resonance experiment (SPR). D ) to accurately determine its binding affinity, indicating that the RNA aptamer of the present invention has high affinity and good specificity for thrombin protein.

[0063] The RNA aptamer of the present invention comprises a core sequence as shown in SEQ ID NO:5.

[0064] In another preferred embodiment, there are flanking sequences at the 5' end and / or 3' end of the core sequence.

[0065] In another preferred embodiment, the length of the flanking sequence is 1-80 bases, preferably extended by 5-50 bases, and most preferably extended by 10-30 bases.

[0066] In another preferred example, the thrombin protein is human thrombin protein.

[0067] In another preferred embodiment, the affinity index of the RNA aptamer to the thrombin protein is K D The value is 1-100 nM, preferably 1-50 nM, and most preferably 1-10 nM.

[0068] In another preferred example, the RNA aptamer comprises the RNA sequence shown in SEQ ID NO:1.

[0069] In another preferred embodiment, the RNA aptamer further comprises an RNA sequence having a sequence identity of ≥85%, preferably ≥90%, and optimally ≥95% with SEQ ID NO:1.

[0070] In another preferred example, the ≥95% sequence identity includes 95%, 96%, 97%, 98%, and 99% sequence identity.

[0071] In another preferred embodiment, the RNA aptamer comprises an RNA sequence obtained by extending SEQ ID NO:1.

[0072] In another preferred embodiment, the extension refers to an extension of 1-20 bases, preferably an extension of 1-10 bases, and most preferably an extension of 1-5 bases.

[0073] In another preferred embodiment, the RNA aptamer sequence is shown in SEQ ID NO:1.

[0074] In another preferred embodiment, one or more positions in the RNA aptamer sequence are modified by a modification selected from the group consisting of phosphorylation, methylation, amination, sulfhydrylation, replacement of oxygen with sulfur, replacement of oxygen with selenium, or a combination thereof.

[0075] In another preferred embodiment, the one or more are 1-10, preferably 1-5, and most preferably 1-3.

[0076] In another preferred embodiment, the modification enhances the stability of the RNA aptamer sequence.

[0077] In another preferred embodiment, the RNA aptamer blocks the activity of human thrombin protein.

[0078] In another preferred embodiment, the RNA aptamer inhibits the activity of human thrombin protein.

[0079] application

[0080] The RNA aptamer of the present invention has been strictly screened and has stable chemical properties and good environmental adaptability. It can achieve qualitative and quantitative analysis of thrombin through fluorescent labeling, electrochemical signals or other chemical detection methods, and is widely used in medical diagnosis, drug development, blood monitoring and other fields.

[0081] The RNA aptamer of the present invention can be used as a substitute for traditional antibodies in immunoassays, and its high specificity binding to thrombin protein enables it to show extremely high detection sensitivity and stability in immunoassays. By introducing RNA aptamers into immunoassay technology, the detection process can achieve faster and more accurate capture of target molecules. At the same time, the chemical modification characteristics of RNA aptamers make it compatible with existing immunoassay platforms, thereby expanding the application range of traditional immunoassays.

[0082] The main advantages of the present invention include:

[0083] (a) The present invention provides a thrombin protein nucleic acid aptamer thromb-rapt01 by improving the screening conditions. The aptamer has good specificity and high affinity for binding to the thrombin protein. D The value was only 6.67 nM.

[0084] (b) The nucleic acid aptamer thromb-rapt01 provided by the present invention has a small molecular weight, is easy to synthesize with low cost, has a simple and stable structure, and is easy to modify and label.

[0085] (c) It can be used for detection, diagnosis, imaging and treatment, such as purification or high-sensitivity and high-specificity detection of thrombin protein; preparation of drugs targeting thrombin protein; reagents or drugs for diagnosis and treatment of abnormal thrombin expression, etc., and has broad application prospects.

[0086] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are usually performed under conventional conditions, such as the conditions described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are weight percentages and weight parts.

[0087] Example 1: Screening of RNA aptamers binding to thrombin protein

[0088] The method for screening RNA aptamers binding to thrombin protein in this embodiment comprises the following steps:

[0089] (1) Provide a random single-stranded DNA library and primers.

[0090] The random single-stranded DNA library Lib2: 5'-TCGGGCGAGTCGTCTG-N36-CCGCATCGTCCTCCC-3' (SEQ ID NO: 2); wherein "N36" represents a sequence formed by connecting 36 random nucleotide bases.

[0091] The primer information is shown in Table 1, wherein S in the primer name represents a forward primer (SEQ ID NO: 3), and A represents a reverse primer (SEQ ID NO: 4). The primers were prepared into 100 μM storage solutions with ddH2O and stored at -20°C for future use.

[0092] The random single-stranded DNA library and primer sequences were obtained from Sangon Biotechnology (Shanghai) Co., Ltd.

[0093] Table 1. Primers and their sequences

[0094]

[0095] (2) Magnetic bead screening

[0096] The magnetic bead method was used for screening, with a total of 8 rounds of screening. The screening process of each round is shown in Table 2.

[0097] Table 2. Screening process of thrombin protein aptamers

[0098]

[0099] (2.1) Carboxyl magnetic beads to immobilize thrombin protein

[0100] Take 10 μL of thrombin protein (purchased from Abcam, Uniport ID: P00734, concentration 7.8 mg / mL), add 850 μL of 10 mM sodium acetate at pH 4.0, mix well, and place on ice for later use.

[0101] Take 300 μL of carboxyl magnetic beads (Jiangsu Zecheng Biotechnology Co., Ltd., catalog number: FM2221), wash once with 300 μL of 20 mM NaOH, then wash twice with 300 μL of ultrapure water, fish the magnetic beads with a magnet, and remove the supernatant. Take 300 μL of the prepared NHS (N-hydroxysuccinimide solution; concentration is 0.1M; solvent is ddH2O) and EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride solution; concentration is 0.4M; solvent is ddH2O), mix them, add them to the magnetic beads, and incubate at 25°C for 20 minutes to activate the carboxyl groups on the surface of the magnetic beads. After the incubation, remove the supernatant and immediately wash once with 300 μL of ultrapure water to reduce protein self-coupling.

[0102] The protein diluted with sodium acetate was then mixed with the magnetic beads and incubated on a vertical mixer at room temperature for 60 minutes. The thrombin protein was coupled to the surface of the magnetic beads through the amino groups on the surface of the protein.

[0103] After the coupling is completed, place the coupling tube on the magnetic stand, discard the supernatant, take 300 μL of 1M ethanolamine (pH=8.5) and add it to the magnetic beads. Incubate on a 25℃ vertical mixer for 10 minutes to block the unreacted activated sites on the surface of the magnetic beads. Place the coupling tube on the magnetic stand again, discard the blocking solution, and use 300 μL of 5 mM Mg 2+ The magnetic beads were washed 4 times with DPBS buffer (sodium chloride 8 g / L, sodium hydrogen phosphate dodecahydrate 2.8975 g / L, water, pH = 7.4) containing 0.02% Tween 20 and resuspended in DPBS buffer, labeled as MB-thrombin, and stored at 4°C.

[0104] (2.2) Back screening and screening

[0105] Preparation of counter-screening magnetic beads: Activate the carboxyl magnetic beads, take 1000 μL of carboxyl magnetic beads, do not couple with protein, and follow the same steps. The activated magnetic beads are labeled MB-COOH.

[0106] Library dissolution and RNA preparation:

[0107] The DNA library (SEQ ID NO: 2) was dissolved in 10 μL ddH2O, 60 μL HEPES buffer (HEPES 30 mM, potassium acetate 100 mM) and 20 μL S1-2 (SEQ ID NO: 3) were added to the library, the resulting mixed solution was mixed evenly, and then evenly divided into PCR tubes, 18 μL per tube, and each PCR tube was placed in a PCR instrument for annealing reaction: 95°C for 4 min; slowly cooled to 25°C (-1°C / min); 25°C for 15 min; stored at 4°C.

[0108] Take 250 μL of dNTP mixture and dilute it with 160 μL of DEPC water, then add 82 μL to each PCR tube after annealing, and then place the resulting mixture in a PCR instrument for extension reaction: 72℃ 30min; 25℃ 10min; store at 4℃.

[0109] After completion, DNA was purified using a DNA purification kit (DP205) purchased from Tiangen Biochemical Technology. After purification, the concentration was determined using Nanodrop, and a 3% agarose gel was used to verify the purity of the recovered product.

[0110] After verification, the Thermo Fisher transcription kit (K0441) was used for transcription, which contained 5× transcription auxiliary reaction buffer: 24 μL; each NTP 2 μL; transcription auxiliary enzyme mixture 12 μL; template DNA: 1 μM. The volume was supplemented to 120 μL with DEPC-H2O, mixed and dispensed into PCR8 tubes, 20 μL per tube, and the transcription reaction was carried out using a PCR instrument: 37°C 6h.

[0111] After the completion, the RNA was purified and recovered using the ZYMO Research ssDNA / RNA Clean&Concentrator Kit (D7011), strictly following the instructions. After purification, the concentration was measured using Nanodrop, and the purity of the recovered RNA product was verified using 8% denatured Page gel.

[0112] The treated library was mixed with BSA and yeast tRNA to reduce nonspecific binding and increase competitiveness, and then added to 50 μL MB-COOH magnetic beads, mixed and incubated at room temperature for 60 minutes on a vertical mixer. Then placed on a magnetic stand, collected the supernatant, marked as Pool, and took the supernatant as a single-stranded nucleic acid library for positive screening with MB-thrombin magnetic beads. Before each round of positive screening, MB-COOH magnetic beads were used for reverse screening. The supernatant library after reverse screening was added to 50 μL MB-thrombin magnetic beads and incubated at room temperature for 60 minutes on a vertical mixer. Place on a magnetic stand, discard the supernatant, retain the magnetic beads, and use 200 μL DEPC-DPBS (containing 5mM Mg 2+ ) Wash the magnetic beads 4 times. Finally, add 30 μL DEPC water to resuspend, boil in 95°C water bath for 10 minutes, collect the supernatant and mark it as elution-thrombin.

[0113] Using the nucleic acid molecules in elution-thrombin as templates, reverse transcribe RNA using a high-efficiency cDNA first-strand synthesis kit (R312) and 1 μM A2-2 (SEQ ID NO: 4): 5 μL 10×RT Mix, 29.5 μL elution-thrombin, 0.5 μL 100 μM A2-2, 10 μL DEPC water, mix well and use a PCR instrument: 65℃ 5 min; 25℃ 5min, add 5 μL HiScript III Enzyme Mix after the end, mix well: 50℃ 60 min; 85℃ 1 min; keep at 4℃. Obtain the reverse transcription product.

[0114] After completion, the reverse transcription product was amplified by PCR using the premixed Taq enzyme Premix Taq™ (R004A). The reaction solution was prepared on ice. 250 μL of Premix Taq, 40 μL of reverse transcription product, 5 μL of 100 μM S1-2 (SEQ ID NO: 3), 5 μL of 100 μM A2-2 (SEQ ID NO: 4), and 200 μL of DEPC-H2O were mixed and evenly distributed into 10 PCR tubes, 50 μL in each tube, and placed in a PCR instrument: 98°C 15 s; (98°C 10 s; 60°C 30 s; 72°C 1 min) 20 cycles; 72°C 5 min; maintain at 4°C.

[0115] The remaining 10 μL of reverse transcription product was monitored in real time by qPCR.

[0116] The amplified product was transcribed using a transcription kit (K0441, Thermo Fisher) to prepare the next round of RNA library.

[0117] The magnetic bead method was repeated for 8 rounds of screening. In each round of screening, the secondary library obtained in the previous round of screening was used as the starting nucleic acid library. After the library was renatured, it was incubated with MB-thrombin magnetic beads. After the screening, SPR was used to detect the binding ability of the RNA single-stranded library with thrombin protein, and the libraries obtained in the 1st, 7th and 8th rounds of screening were selected for verification.

[0118] Pool 1, Pool 7, and Pool 8 represent the first, seventh, and eighth rounds of screening libraries, respectively. The recognition ability of the libraries in each round with the thrombin protein is shown in Figure 1 shown.

[0119] The results showed that as the number of screening rounds increased, the library's recognition ability for thrombin protein became stronger, that is, the affinity was higher. Compared with Pool 1, Pool 7 and Pool 8 had significantly enhanced binding to thrombin protein, meeting the sequencing requirements, so the resulting library was used for subsequent high-throughput sequencing analysis.

[0120] (2.3) Analysis and identification of the selected nucleic acid aptamers: After high-throughput sequencing analysis of the obtained enriched library products, several sequences with higher rankings are selected, and after artificial synthesis, their affinity with the thrombin protein is tested.

[0121] Finally, one RNA aptamer sequence with the strongest binding ability to thrombin protein was identified from the sequences obtained in the eighth round:

[0122] GGGAGGACGAUGCGG CUUGGCUCGCAAUAAAGCUGUAGUACUUAGCGGCCC CAGACGACUCGCCCGA (SEQ ID NO: 1), which was named thromb-rapt01. The underlined sequences are flanking sequences.

[0123] Example 2: Surface Plasmon Resonance (SPR) Detection of Affinity between RNA Aptamer and Thrombin Protein

[0124] The RNA aptamer thromb-rapt01 (SEQ ID NO: 1) was synthesized and lysed using DEPC-DPBS buffer (containing 5 mM Mg 2+ ) were diluted serially into 500 nM, 250 nM, 125 nM, 62.5 nM, and 31.25 nM.

[0125] Thrombin protein was coupled to the second channel of the CM5 chip surface as follows: first, the chip was cleaned with 50 mM NaOH, the injection was 20 μL, the flow rate was 10 μL / min, then an equal volume of EDC and NHS was mixed and 105 μL was injected to activate the chip, the flow rate was 10 μL / min. Thrombin protein was diluted with 10 mM sodium acetate at pH = 4.0 to a final concentration of 50 μg / mL and then injected, the injection volume was 190 μL, the flow rate was 10 μL / min, and the thrombin protein coupling amount was about 10380 Ru. After the injection was completed, ethanolamine was injected to block the chip, the flow rate was 10 μL / min, and the injection was 129 μL. Channel 1 was treated as above, but no protein was coupled, and the activation and blocking steps were exactly the same, as a control channel.

[0126] The affinity of RNA aptamers to thrombin protein was detected using a surface plasmon resonance instrument (GE Healthcare, model: Biacore 8K). The diluted RNA aptamer samples flowed through channels 1 and 2 in sequence, and the procedure was as follows: injection flow rate of 30 μL / min, time of 3 minutes; dissociation rate of 30 μL / min, time of 3 minutes; regeneration of 2 M NaCl, flow rate of 30 μL / min, time of 45 seconds; then the diluted RNA aptamers were injected in sequence.

[0127] The affinity test data of RNA aptamer thromb-rapt01 and thrombin protein are shown in Figure 2 The results showed that thromb-rapt01 has a strong affinity with thrombin protein, and its K D The value is 6.67 nM.

[0128] Example 3: Structural Characterization of Thromb-Rapt01

[0129] According to the NUPACK prediction results, the secondary structure of thromb-rapt01 is as follows Figure 3 The shaded sequence is the core sequence of thromb-rapt01 that binds to the thrombin protein, and the sequence is: CUUGGCUCGCAAUAAAGCUGUAGUACUUAGCGGCCC (SEQ ID NO: 5).

[0130] according to Figure 3 The secondary structure of thromb-rapt01 can be used to infer the main binding site region of thrombin protein.

[0131] The 36 base sequences are different from other sequences in the random library.

[0132] Depend on Figure 4 and Figure 5 It can be seen that SEQ ID NO:6 has the same flanking sequence as SEQ ID NO:1, but SEQ ID NO:6 has no affinity or low affinity with the thrombin protein, while the aptamer sequence of the present invention has a strong affinity with the thrombin protein, confirming that the core sequence binding to the human thrombin protein is shown in SEQ ID NO:5.

[0133] Wherein, the sequence of SEQ ID NO:6 is as follows:

[0134] GGGAGGACGAUGCGGAUUCCAAGAAAGCUGUAGUACUUAGGACCGUCACGCCAGACGACUCGCCCGA (SEQ ID NO: 6).

[0135] The structure of thromb-rapt01 was further characterized by circular dichroism. Figure 6 shown.

[0136] The results showed that the conformation of thromb-rapt01 was independent of potassium ion concentration. On the one hand, this confirmed that the sequence was not a G-quadruplex structure and was not easily affected by various reactions related to G-rich sequences. On the other hand, it showed that the sequence could still maintain conformational stability in the intracellular high potassium environment. This feature provided theoretical conditions for the in vivo application of the thromb-rapt01 sequence.

[0137] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. An RNA aptamer that binds to thrombin protein, characterized in that: The core sequence of the RNA aptamer that binds to the thrombin protein is the sequence shown in SEQ ID NO: 5: CUUGGCUCGCAAUAAAGCUGUAGUACUUAGCGGCCC (SEQ ID NO: 5).

2. The RNA aptamer according to claim 1, characterized in that The RNA aptamer is an RNA sequence as shown in SEQ ID NO: 1: GGGAGGACGAUGCGGCUUGGCUCGCAAUAAAGCUGUAGUACUUAGCGGCCCCAGACGACUCGCCCGA (SEQ ID NO: 1).

3. A conjugate, characterized in that: The conjugate comprises the RNA aptamer according to claim 1 and a detectable marker connected to the RNA aptamer.

4. A biochip, characterized in that: The biochip comprises the RNA aptamer according to claim 1 or the conjugate according to claim 3.

5. Use of the RNA aptamer according to claim 1 or the conjugate according to claim 3, characterized in that: For the following purposes: (Z1) for preparing a kit for detecting thrombin protein; (Z2) for preparing a reagent for imaging thrombin protein; (Z3) preparing a pharmaceutical composition targeting thrombin protein; and / or (Z4) is used to purify thrombin protein.

6. A detection kit, characterized in that: The detection kit comprises: the RNA aptamer according to claim 1 or the conjugate according to claim 3.

7. The use of the detection kit according to claim 6, characterized in that: Used for preparing a kit for diagnosing thrombotic diseases caused by thrombin.

8. A composition, characterized in that The composition comprises: (a) the RNA aptamer according to claim 1 or 2; and (b) a pharmaceutically acceptable excipient.

9. A method for detecting thrombin protein for non-disease diagnosis and / or treatment, characterized in that: The following steps are involved: (S1) providing a sample to be tested; (S2) mixing the sample to be detected with the RNA aptamer according to claim 1 or 2 or the conjugate according to claim 3 to form a mixture; (S3) detecting the presence or absence of the "thrombin protein-RNA aptamer complex" in the mixture, wherein if the complex exists, it indicates that the thrombin protein exists in the sample; if the complex does not exist, it indicates that the thrombin protein does not exist in the sample.

Images