BnMYB615, a negative regulator of rapeseed flowering time transcription factor, and its application

Abstract

This invention belongs to the field of plant molecular biology technology, specifically relating to a negative regulatory transcription factor for rapeseed flowering. BnMYB615 Cloning methods BnMYB615 Gene overexpression vectors, BnMYB615 Applications of gene knockout vectors, host cells, transgenic plants with delayed flowering, and gene-edited plants with advanced flowering. The nucleotide sequence of the rapeseed transcription factor BnMYB615 is shown in SEQ ID NO.1, the amino acid sequence in SEQ ID NO.2, the overexpression vector sequence in SEQ ID NO.3, and the gene knockout vector sequence in SEQ ID NO.4. Overexpression... BnMYB615 It can significantly delay the flowering time of plants. When applied to crops that are harvested from vegetative organs, it can extend their growing season, prolong the photosynthetic time, and obtain higher yields. BnMYB615 Gene knockout advances the flowering time of plants. When applied to crops that are harvested from seeds or fruits, it can shorten their growth period, increase the multiple cropping index, avoid the effects of adverse weather, and improve product quality.

Description

Technical Field

[0001] This invention belongs to the field of plant molecular biology technology, specifically relating to a rapeseed transcription factor. BnMYB615 And its application in regulating the flowering time of plants. Background Technology

[0002] Rapeseed is an important oilseed crop in my country, and rapeseed oil accounts for 50% of domestically produced edible vegetable oil, making it a crucial source of cooking oil for residents. my country is one of the world's three major rapeseed producing regions. According to data released by the National Bureau of Statistics, China's rapeseed production in 2020 reached 14.02 million tons, accounting for approximately 19% of global production. my country is also a major consumer of rapeseed, with domestic production unable to meet demand, resulting in a significant shortfall that must be met through imports.

[0003] In the Yangtze River Basin, southern Shaanxi, southern Henan, and southern Anhui, rice-oilseed rotation is an important agricultural practice. In practice, the rapeseed stubble directly impacts the sowing or transplanting of the next crop. Currently, due to factors such as climate characteristics, planting efficiency, and variety updates, winter rapeseed planting areas in my country face problems such as inappropriate coordination between rapeseed and rice planting, resulting in large areas of farmland being left uncultivated during winter. Developing early-maturing rapeseed varieties with early flowering and maturity can provide ample space and time for seedling raising and transplanting of the next crop in areas with a two-crop-a-year system, and can offer a good solution to the conflict between double-cropping rice and winter rapeseed stubble in areas with a three-crop-a-year system. This is of great significance to agricultural production in rice-oilseed rotation areas.

[0004] The regulation of plant flowering time is governed by a complex gene network, including photoperiodic pathways, vernalization pathways, gibberellin pathways, autonomous flowering pathways, and age pathways. For crops that are harvested for seeds or fruits, earlier flowering can shorten their growth period, allowing them to complete a crop cycle in a shorter time and increasing the multiple cropping index. Furthermore, shortening the growth period can help some crops avoid the effects of adverse weather conditions; for example, early maturity of winter rapeseed can avoid rainy weather and improve product quality. For crops that are harvested for their vegetative organs, such as alfalfa and spinach, delayed flowering can extend their growing season and photosynthetic time, thereby achieving higher yields.

[0005] MYB family transcription factors are a large and diverse class of important genes in plants. In flowering regulation, MYB family transcription factors can influence the flowering process by modulating other flowering-related genes. In the photoperiod pathway, MYB transcription factors can sense day-night length and transmit changes in light signals to downstream flowering-regulating genes. In the vernalization pathway, low-temperature treatment can enable MYB transcription factors to work synergistically with other vernalization-related genes, relieving flowering inhibition and laying the foundation for subsequent flowering induction at suitable temperatures.

[0006] Genetic engineering is an important means of regulating the flowering and ripening time of crops. Gene editing is a molecular technology that causes specific changes to the genome by deleting, inserting, or replacing a segment or specific base. Currently, gene editing technology represented by CRISPR-Cas9 has made great strides. The gene editing technology used in this invention refers to the article "A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants" published in the journal Molecular Plant in 2015 by Academician Liu Yaoguang's team. Summary of the Invention

[0007] One objective of this invention is to provide a gene that negatively regulates plant flowering time transcription factors. BnMYB615 Characterized by overexpression BnMYB615 It can delay the flowering time of plants and knock out BnMYB615 It can advance the flowering time of plants. The nucleotide sequence of this gene is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2.

[0008] The second objective of this invention is to provide a cloning method. BnMYB615 The gene method is characterized by using rapeseed cDNA as a template and performing PCR amplification according to amplification primers BnMYB615-F and BnMYB615-R.

[0009] The nucleotide sequence of BnMYB615-F is shown in SEQ ID NO.3, which is 5'-TGGAGAGGACACGCTCGAATGGATACAAATACATCCGG-3'.

[0010] The nucleotide sequence of BnMYB615-R is shown in SEQ ID NO.4, which is 5'-TCAGATCTACCATCTCGATGTTGAAGCTTCTCCTTCCA-3'.

[0011] The third objective of this invention is to provide a gene containing the aforementioned negative regulation transcription factor for flowering period. BnMYB615 The overexpression vector pEarleyGate103-BnMYB615-mGFP has the nucleotide sequence shown in SEQ ID NO.5.

[0012] The fourth objective of this invention is to provide a vector containing the overexpression vector pEarleyGate103-BnMYB615-mGFP to preserve the host bacteria, wherein the host strain used is Escherichia coli DH5α.

[0013] The fifth objective of this invention is to provide a host bacterium for plant infection containing the overexpression vector pEarleyGate103-BnMYB615-mGFP, wherein the host strain used is Agrobacterium GV3101.

[0014] The sixth objective of this invention is to provide a method that can target rapeseed BnMYB615 The gene knockout vector pYLCRISPR-Cas9P35s-H-BnMYB615, which generates gene-edited mutant progeny at three sites on the gene, is characterized by the following: the nucleotide sequence of the overexpression vector is shown in SEQ ID NO.6; the gene knockout vector has three expression cassettes; the promoter of the first expression cassette is Atu3b, the promoter of the second expression cassette is Atu6-29, and the promoter of the third expression cassette is Atu3b; the nucleotide sequence of the sgRNA of the first expression cassette is 5'-CGTATACTATTACAAAGCAG-3' as shown in SEQ ID NO.7, the nucleotide sequence of the sgRNA of the second expression cassette is 5'-ATAGGTTTCTTGAAGCCTTG-3' as shown in SEQ ID NO.8, and the nucleotide sequence of the sgRNA of the third expression cassette is 5'-TCTTGAGAGACCATACCTGG-3' as shown in SEQ ID NO.9.

[0015] The seventh objective of this invention is to provide a vector containing the gene knockout vector pYLCRISPR-Cas9P35s-H-BnMYB615 to preserve the host bacteria, wherein the host strain used is Escherichia coli DH5α.

[0016] The eighth objective of this invention is to provide a host bacterium for plant infection containing the gene knockout vector pYLCRISPR-Cas9P35s-H-BnMYB615, wherein the host strain used is Agrobacterium GV3101.

[0017] The ninth objective of this invention is to provide a gene that overexpresses a negative regulatory transcription factor for flowering period. BnMYB615 Applications in delaying plant flowering time.

[0018] The tenth objective of this invention is to provide a gene for knocking out negative regulatory transcription factors during flowering. BnMYB615 This is applied to advance the flowering time of Brassica napus.

[0019] Compared with existing technologies, the transcription factor provided by this invention... BnMYB615 Overexpression and gene knockout vectors, host bacteria, and applications can achieve the following beneficial effects:

[0020] rapeseed transcription factors BnMYB615 It has a negative regulatory effect on flowering and can be expressed through overexpression in crops where vegetative organs are the harvested part. BnMYB615 By delaying flowering and extending the growing period, higher yields can be achieved; in crops where seeds or fruits are harvested, through... BnMYB615 Gene knockout can cause crops to flower earlier, shorten the growth period, adjust crop rotation, and increase the multiple cropping index, thereby achieving higher economic benefits. Attached Figure Description

[0021] Figure 1 This is the map of the constructed overexpression vector pEarleyGate103-BnMYB615-mGFP.

[0022] Figure 2 The overexpression was obtained by infecting wild-type Arabidopsis thaliana material with host strain GV3101 carrying the overexpression vector pEarleyGate103-BnMYB615-mGFP. BnMYB615 The Arabidopsis thaliana strains, WT being wild-type material, were used. BnMYB615 -OE1、 BnMYB615 -OE3 and BnMYB615 -OE4 consists of three transgenic lines.

[0023] Figure 3 This is a statistical analysis of rosette leaves at flowering time for different materials. WT represents wild-type materials. BnMYB615 -OE1、 BnMYB615 -OE3 and BnMYB615 -OE4 represents three transgenic lines. Compared to the wild type, the flowering time of the three overexpression lines was significantly delayed, with "**" indicating a highly significant difference.

[0024] Figure 4 This is the map of the constructed gene knockout vector pYLCRISPR-Cas9P35s-H-BnMYB615.

[0025] Figure 5 The mutant strain was obtained by infecting wild-type rapeseed material Westar with host strain GV3101 carrying the gene knockout vector pYLCRISPR-Cas9P35s-H-BnMYB615. WT is the wild-type material Westar. bnmyb615- 39 , bnmyb615-50 These are two mutant lines.

[0026] Figure 6This is a statistical analysis of the flowering time of different materials of Brassica napus. WT represents the wild-type material Westar. bnmyb615-39 , bnmyb615-50 These are two mutant lines. Compared to the wild type, both gene knockout lines flower earlier, among which... bnmyb615-39 The strains reached a significant level of difference; "*" indicates that the difference reached a significant level. Detailed Implementation

[0027] To better illustrate the content and implementation details of this invention, the invention will be further described below with reference to specific embodiments and accompanying drawings. In the following embodiments, the experimental material used for total RNA extraction is Brassica napus ZS11. BnMYB615 The Arabidopsis wild-type (WT) material used for gene overexpression was the col-0 ecotype, and the recipient material used for BnMYB615 gene knockout was Brassica napus Westar. The overexpression plasmid vector backbone used was pEarly-Gate103, and the gene knockout plasmid vector backbone used was pYLCRISPR-Cas9P35s-H. All of the above plant materials and plasmid vector backbones were available through commercial channels or shared by non-profit organizations, agricultural research institutes, and relevant research groups in universities.

[0028] Example 1: Transcription factors that negatively regulate flowering time in Brassica napus BnMYB615 Sequence cloning.

[0029] Total RNA was extracted from Brassica napus using a rapid total RNA extraction kit (RNAprep Pure Plant Kit, Prolife Biotechnology Co., Ltd.). The specific method is as follows:

[0030] Take 0.5 g of rapeseed seedling leaves and place them in a mortar pre-cooled to -40℃. Grind them with liquid nitrogen until pulverized. Transfer 0.1 g of the ground sample to an RNase-free centrifuge tube, add 1 ml of lysis buffer RL, mix by inverting for 20 s, and incubate at 25℃ for 5 min to allow for complete lysis. Add 200 μl of chloroform, tighten the cap, shake vigorously for 15 s, and incubate at 25℃ for 3 min. Centrifuge at 12000 rpm for 20 min at 4℃. Transfer 0.5 ml of the supernatant to an RNase-free centrifuge tube, add an equal volume of isopropanol, mix gently, and transfer the entire solution to an RNA adsorption column. Centrifuge at 12000 rpm for 45 s at 25℃ and discard the waste liquid. Add 500 μl of protein removal buffer RE to the RNA adsorption column, centrifuge at 12000 rpm for 45 s at 25℃, discard the waste liquid, and repeat this step once. Replace the RNA adsorption column in the collection tube and centrifuge at 12000 rpm for 25 s at 25℃. Centrifuge at rpm for 2 min to remove residual washing solution; remove the RNA adsorption column, place at room temperature for 2 min and then place it in a new 1.5 ml RNase-free centrifuge tube, add 100 μl RNase-free water, place at room temperature for 2 min, centrifuge at 12000 rpm for 1 min, and the solution collected in the centrifuge tube is the total RNA from Brassica napus; use a micro spectrophotometer to determine the total RNA concentration.

[0031] The cDNA of Brassica napus was prepared using a reverse transcription kit (SweScript All-in-One RT SuperMix, Sewell Biotechnology Co., Ltd.). The specific method is as follows:

[0032] Take an RNase-free PCR tube and add 4 μl of 5×TransScript All-in-One SuperMix for qPCR, 1 μl of gDNA Remover, and 1 μg of total RNA from Brassica napus in sequence. Add RNase-free water to a final volume of 20 μl. Perform the reaction in a PCR instrument according to the program of 25℃ for 5 min, 42℃ for 20 min, and 85℃ for 5 s to obtain Brassica napus cDNA.

[0033] Take a new PCR tube and add 20 μl of PCR mix containing high-fidelity enzyme (KOD One PCRMaster Mix, Toyobo Biotechnology Co., Ltd.), 2 μl of the above reverse transcription product, 2 μl of 1 M upstream primer BnMYB615-F, 2 μl of 1 M upstream primer BnMYB615-R, and 14 μl of distilled water. Perform the reaction in a PCR instrument according to the following program: 94℃ for 3 min, 94℃ for 30 s, 58℃ for 30 s, 72℃ for 40 s (repeat steps 2-4 36 times), and 72℃ for 5 min. After the reaction, the amplified nucleotide sequence is 1908 bp in length, with 18 bp at each end being the vector homologous region and the middle 1872 bp being... BnMYB615 The cDNA sequence is shown in SEQ ID NO.1.

[0034] Example 2 Overexpression BnMYB615 Obtaining the gene-modified Arabidopsis thaliana.

[0035] The final PCR product (1908 bp) of Example 1 was recovered by agarose gel electrophoresis, and the concentration of the recovered product was determined by micro-spectrophotometer.

[0036] The overexpression plasmid vector backbone pEarly-Gate103 was digested with restriction endonuclease XhoI (QuickCut Xho I, Baori Biotechnology Co., Ltd.), and the long fragment (12191 bp) was recovered by agarose gel electrophoresis. The concentration of the recovered product was determined by micro-spectrophotometer.

[0037] Constructed using a one-step cloning kit (Seamless Assembly cloning kit, Sino-American Taihe Biotechnology Co., Ltd.) BnMYB615 Gene overexpression vectors, the specific methods of which are:

[0038] Take a new PCR tube and, according to the concentration of the recovered product, add 10 μl of 2× Assembly MasterMix, 100 ng of the recovered product of the overexpression plasmid vector backbone, and 80 ng of the recovered PCR product in sequence, and bring the volume to 20 μl with distilled water. Cap the tube, vortex to mix the reagents, and incubate at 50°C for 15 min. Take 5 μl of the reaction product and add it to *E. coli* DH5α competent cells, mix gently, incubate on ice for 30 min, heat shock at 42°C for 45 s, and incubate on ice for 2 min. Add 500 μL of antibiotic-free LB broth and incubate at 37°C in a shaker at 200 rpm for 45 min. In a clean bench, aspirate the incubated cells and spread them on LB broth containing 50 μg / ml kanamycin. Incubate overnight at 37°C, inverted. Select single colonies for sequencing analysis. A single colony with correct sequencing indicates that the culture contains... BnMYB615 The host bacterium of the gene overexpression vector, Escherichia coli.

[0039] Creation containing BnMYB615 The specific method for using Agrobacterium host bacteria for gene overexpression vectors is as follows:

[0040] Plasmids were extracted from *E. coli* host bacteria containing the BnMYB615 gene overexpression vector. One tube of *Agrobacterium* GV3101 competent cells was thawed and placed on ice. 1 μl of plasmid DNA was added to the competent cells, gently mixed by pipetting, and incubated on ice for 5 min. Then, the cells were flash-frozen in liquid nitrogen for 2 min, heat-shocked at 37°C for 5 min, and incubated on ice for 5 min. 500 μl of antibiotic-free LB medium was added, and the cells were incubated at 28°C in a shaker for 3 h. The incubated cells were then aspirated in a clean bench and spread onto YEP solid medium containing 50 μg / ml Kana, 50 μg / ml Rif, and 20 μg / ml Gent. The cells were incubated upside down at 28°C for 48 h. PCR detection was performed to identify cells containing the target vector. BnMYB615 Agrobacterium host bacteria for gene overexpression vectors.

[0041] Save containing BnMYB615 Agrobacterium with the gene overexpression vector was inoculated onto YEP solid medium containing 50 μg / ml Kana, 50 μg / ml Rif, and 20 μg / ml Gent. Two days later, single colonies were picked and inoculated into 2 mL of YEP liquid medium containing 50 μg / mL Kana, 50 μg / mL Rif, and 20 μg / mL Gent, and cultured overnight at 28°C and 220 rpm. The cultured bacterial solution was then inoculated 1:50 into 100 mL of liquid medium with the same antibiotic resistance and cultured at 28°C and 220 rpm for approximately 8 h until OD500 was reached. 600 The value is 0.8-1.0.

[0042] Centrifuge the above bacterial suspension at 4500 rpm for 5 min at room temperature and discard the supernatant. Resuspend the bacterial pellet in 1 / 2 MS liquid medium containing 5% Sugar and 0.05% Silwet L-77, and adjust the OD of the resuspended solution. 600 The value is 0.8.

[0043] Select wild-type Arabidopsis thaliana in full bloom, cut off the pollinated pods, immerse the Arabidopsis thaliana inflorescence in resuspension for 45 seconds, culture in the dark for 24 hours, and then culture normally.

[0044] Following the above method, a second infection can be carried out one week later. There is no need to cut off the pollinated pods for the second infection.

[0045] Arabidopsis seeds were harvested 30 days later. Using the red fluorescent protein gene marker inherent in the seeds, seeds exhibiting red fluorescence were selected under a stereofluorescence microscope; these were the T1 generation seeds.

[0046] After sowing T1 generation seeds, manage them normally and harvest T2 generation seeds from individual plants. Different individual plants of the T1 generation are different transgenic lines.

[0047] After sowing T2 generation seeds, manage them normally. Before harvest, check the red fluorescence segregation ratio of the seeds by stereofluorescence. Seeds without segregation can be considered homozygous.

[0048] Example 3 Overexpression BnMYB615 Investigation on the culture and flowering time of gene-modified Arabidopsis thaliana.

[0049] Wild-type and three overexpressing groups were selected. BnMYB615 The seeds of Arabidopsis thaliana strains were disinfected with 0.1% mercuric chloride solution for 5 min, rinsed with sterile water 8-10 times, and then sown on 1 / 2 MS solid medium. They were cultured for 10 days under the photoperiod of 14 h light and 10 h dark at 25℃. The Arabidopsis thaliana seedlings with good growth were then transferred to nutrient soil and cultured under the photoperiod of 14 h light and 10 h dark at 25℃ until the inflorescence grew to the point where the first flower opened. The number of rosette leaves was then counted.

[0050] Figure 2 and Figure 3 This invention is an overexpression BnMYB615 Phenotypic differences in flowering time and statistical differences in the number of rosette leaves at flowering among three Arabidopsis thaliana lines and wild-type materials. The results in the figures show that overexpression... BnMYB615 The flowering time of the genetically modified Arabidopsis thaliana is significantly later than that of the wild-type. The wild-type has approximately 15 rosette leaves when its first flower blooms. BnMYB615 The overexpression line had approximately 45 rosette leaves at the time of its first flower opening, significantly higher than the wild type. The results indicate that overexpression... BnMYB615 It can significantly delay the flowering time of plants.

[0051] Example 4 BnMYB615 Obtaining gene knockout Brassica napus.

[0052] Using the Atu3d vector as a template, the first expression cassette terminator region was obtained by amplification with primers MYB615-sg1-F and gR-R. The first expression cassette promoter region was obtained by amplification with primers MYB615-sg1-U3R and UF. A 1 μl mixture of the two amplification products was used as a template, and the complete first expression cassette was obtained by amplification with primers Pps-GGL and Pgs-GG2. Using the Atu6-29 vector as a template, the second expression cassette terminator region was obtained by amplification with primers MYB615-sg2-F and gR-R. The second expression cassette promoter region was obtained by amplification with primers MYB615-sg2-U6R and UF. The promoter region of the second expression cassette was obtained by amplification using primers. Using a 1 μl mixture of the two amplification products as a template, the complete second expression cassette was obtained by amplification using primers Pps-GG2 and Pgs-GG3. Using the Atu3d vector as a template, the terminator region of the third expression cassette was obtained by amplification using primers MYB615-sg3-F and gR-R. The promoter region of the third expression cassette was obtained by amplification using primers MYB615-sg3-U3R and UF. Using a 1 μl mixture of the two amplification products as a template, the complete third expression cassette was obtained by amplification using primers Pps-GG3 and Pgs-GGR.

[0053] The Atu3d and Atu6-29 vectors mentioned above were shared by Academician Liu Yaoguang's team. The primer sequences UF, gR-R, Pps-GGL, Pgs-GG2, Pps-GG2, Pgs-GG3, Pps-GG3, and Pgs-GGR are based on an article published by Academician Liu Yaoguang's team in the journal Molecular Plant in 2015.

[0054] The nucleotide sequence of the above MYB615-sg1-F is shown in SEQ ID NO.10 as: CGTATACTATTACAAAGCAGGTTTTAGAGCTAGAAAT.

[0055] The nucleotide sequence of the above MYB615-sg1-U3R is shown in SEQ ID NO.11 as: CTGCTTTGTAATAGTATACGTGACCAATGTTGCTCC.

[0056] The nucleotide sequence of the above MYB615-sg2-F is shown in SEQ ID NO.12 as follows: ATAGGTTTCTTGAAGCCTTGGTTTTAGAGCTAGAAAT.

[0057] The nucleotide sequence of the above MYB615-sg2-U6R is shown in SEQ ID NO.13 as: CAAGGCTTCAAGAAACCTATCAATCTCTTAGTCGACT.

[0058] The nucleotide sequence of the above MYB615-sg3-F is shown in SEQ ID NO.14 as: TCTTTGAGAGACCATACCTGGGTTTTAGAGCTAGAAAT.

[0059] The nucleotide sequence of the above MYB615-sg3-U3R is shown in SEQ ID NO.15 as: CCAGGTATGGTCTCTCAAGATGACCAATGTTGCTCC.

[0060] The PCR products of the three expression cassettes were recovered and their concentrations were determined using a micro spectrophotometer.

[0061] Take a PCR tube and add 1.5 μl of 10×CutSmart Buffer (NEB), 1.5 μl of 10 mM ATP, 60 ng of pYLCRISPR-Cas9P35s-H plasmid, 15 ng of PCR products recovered from each of the three expression cassettes, 10 U of Bsa I-HF exonuclease (NEB), 40 U of T4 DNA ligase (NEB), and bring the volume to 15 μl with distilled water. Complete the reaction according to the following induction schedule: 37℃ for 10 min, 10℃ for 5 min, 20℃ for 5 min (repeat steps 1-3 three times), 37℃ for 3 min, 10℃ for 5 min, 20℃ for 5 min (repeat steps 4-6 three times), and 37℃ for 5 min.

[0062] Take 5 μl of the reaction product and add it to *E. coli* DH5α competent cells. Mix gently, incubate on ice for 30 min, heat shock at 42°C for 45 s, and incubate on ice for 2 min. Add 500 μL of antibiotic-free LB liquid medium and incubate at 37°C with a shaker at 200 rpm for 45 min. In a clean bench, aspirate the incubated cells and spread them onto LB solid medium containing 50 μg / ml kanamycin. Incubate overnight at 37°C, inverted. Select single colonies for sequencing analysis. A single colony with correct sequencing indicates the presence of kanamycin. BnMYB615 The host bacterium of the gene knockout vector, E. coli.

[0063] Use containing BnMYB615Plasmids were extracted from the host bacteria of *E. coli* containing the gene knockout vector. One tube of *Agrobacterium* GV3101 competent cells was thawed and placed on ice. 1 μl of plasmid DNA was added to the competent cells, gently mixed by pipetting, and incubated on ice for 5 min. Then, the cells were flash-frozen in liquid nitrogen for 2 min, heat-shocked at 37°C for 5 min, and incubated on ice for 5 min. 500 μl of antibiotic-free LB broth was added, and the cells were incubated at 28°C in a shaker for 3 h. The incubated cells were then aspirated in a clean bench and spread onto YEP solid medium containing 50 μg / ml Kana, 50 μg / ml Rif, and 20 μg / ml Gent. The cells were incubated upside down at 28°C for 48 h. PCR detection was performed to identify cells containing the target vector. BnMYB615 Agrobacterium host bacteria of gene knockout vector.

[0064] T0 generation materials were obtained using Agrobacterium-mediated hypocotyl genetic transformation of Brassica napus.

[0065] Genomic DNA was extracted from T0 generation transgenic lines and wild-type lines using the CTAB method. Primers BnMYB615-sg12-F and BnMYB615-sg12-R were used to amplify the first and second target sites of the target gene in both wild-type and transgenic lines. Primers BnMYB615-sg3-F and BnMYB615-sg3-R were used to amplify the third target site of the target gene in both wild-type and transgenic lines. By comparing the sequences of different transgenic lines with the wild-type sequences, it was determined whether gene editing had occurred at the target sites and the type of editing.

[0066] The nucleotide sequences of the primers BnMYB615-sg12-F, as shown in SEQ ID NO.16, are: GGAGTGAGTACGGTGTGCATGGATACAAATACATCC; the nucleotide sequences of the primers BnMYB615-sg12-R, as shown in SEQ ID NO.17, are: GAGTTGGATGCTGGATGGTCTATACGTTGCCAGGCC; the nucleotide sequences of the primers BnMYB615-sg3-F, as shown in SEQ ID NO.18, are: GGAGTGAGTACGGTGTGCAGTGCCGATAATGGAACA; and the nucleotide sequences of the primers BnMYB615-sg3-R, as shown in SEQ ID NO.19, are: GAGTTGGATGCTGGATGGGCTGCGGCATGAGCTGCA.

[0067] Example 5 BnMYB615 Investigation on the cultivation and flowering time of gene knockout Brassica napus.

[0068] Select wild type and two BnMYB615Seeds of gene-knockout Brassica napus Wester strains were sown in a culture medium and cultured under photoperiods of 25°C, 14 h light and 10 h dark. The flowering time was from sowing to the opening of the first flower. The flowering time of 6 plants in each strain was used to calculate the average flowering time of each strain.

[0069] Figure 5 and Figure 6 This is the present invention. BnMYB615 Phenotypic diagrams and statistical difference analysis diagrams of flowering time differences between the two gene knockout rapeseed lines and the wild-type material. The results in the figures show that... BnMYB615 The gene knockout rapeseed flowered significantly earlier than the wild type. The wild type had an average flowering time of 58 days. BnMYB615 The flowering times of the gene knockout lines were 53 days and 55 days, respectively. bnmyb615-39 The flowering time of the strain differed significantly from that of the wild type.

Claims

1. Use of a Brassica napus transcription factor BnMYB615 overexpression vector or a host bacterium containing the vector in delaying flowering of Arabidopsis thaliana or Brassica napus, wherein the nucleotide sequence of the Brassica napus transcription factor BnMYB615 is shown as SEQ ID NO.

1.

2. Use of the overexpression vector of claim 1 or a host containing the vector in delaying flowering of Arabidopsis thaliana or Brassica napus, characterized in that, The host bacterium is Agrobacterium.

3. Use of the overexpression vector of claim 1 or a host containing the vector in delaying flowering time in Arabidopsis thaliana or Brassica napus, characterized in that, The overexpression vector is pEarleyGate103-BnMYB615-mGFP, and the nucleotide sequence thereof is shown as SEQ ID NO.

5.

4. Use of a Brassica napus transcription factor BnMYB615 gene knockout vector or a host bacterium containing the vector in advancing flowering of Brassica napus, wherein the nucleic acid sequence of the Brassica napus transcription factor BnMYB615 gene is shown as SEQ ID NO.

1.

5. The use of the knockout vector according to claim 4 or a host containing the vector for advancing the flowering stage of Brassica napus, characterized in that, The host bacterium is Agrobacterium.

6. Use of the knockout vector of claim 4 or a host containing the vector in advancing the flowering time of Brassica napus, characterized in that, The gene knockout vector is pYLCRISPR-Cas9P35s-H-BnMYB615, and the nucleotide sequence thereof is shown as SEQ ID NO.

6.

7. Use of the knockout vector of claim 4 or a host containing the vector in advancing the flowering time of Brassica napus, characterized in that, The gene knockout target used is located in the coding region of the Brassica napus transcription factor BnMYB615, and the target nucleic acid sequence is shown as SEQ ID NO. 7-9.

8. Use of knocking out transcription factor BnMYB615 in advancing the flowering stage of Brassica napus, characterized in that, The nucleotide sequence of the transcription factor BnMYB615 is shown as SEQ ID NO. 1.

Images