Gene CpSge1 related to pathogenicity of cryphonectria parasitica and dsRNA and application thereof

Abstract

The invention discloses a gene CpSge1 related to pathogenicity of cryphonectria parasitica and dsRNA and application thereof, and belongs to the technical field of molecular biology. The nucleotide sequence of the gene CpSge1 is as shown in SEQ ID No. 1, and the nucleotide sequence of the dsRNA is as shown in SEQ ID No. 3, SEQ ID No. 4 or SEQ ID No. 5. The invention also provides an application of the dsRNA or the gene CpSge1 in prevention and treatment of cryphonectria parasitica. The dsRNA can interfere the expression of a cryphonectria parasitica pathogenic key gene CpSge1 and influence the processes of cryphonectria parasitica growth, sporulation, stress tolerance and Chinese chestnut branch infection, so that the control of cryphonectria parasitica is facilitated, and the dsRNA is applicable to other plant fungal diseases including poplar anthracnose.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and in particular to a gene related to the pathogenicity of chestnut blight pathogen CpD And its dsRNA and application. Background Art

[0002] Parasitic Cryptocaryon C. parasitica ), in biological classification, it belongs to the kingdom Fungi, the phylum Ascomycota, the subphylum Pezizomycotina, the class Sordariomycetes, the order Diaporthales, the family Cryphonectriaceae, and the genus Cryphonectriaceae. Cryphonectria ). As an important woody food crop, chestnut has a large cultivation area. However, the frequent occurrence of chestnut tree diseases not only causes great economic losses, but also seriously threatens my country's chestnut food security. Among them, chestnut blight is a serious threat to chestnut. Chestnut blight caused by the parasitic Cryptocaryon erythrocarpon is native to East Asia and is a typical global forest disease. Chestnut blight can cause rot and ulceration of chestnut branches and trunks, and in severe cases, it can cause the death of the entire plant. The disease was once prevalent in Europe and the United States, causing local chestnuts to be on the verge of extinction.

[0003] There is a phenomenon of low virulence in chestnut blight pathogens. The application of weak virulence strains is only effective in Europe, but in other regions, the effect is not ideal due to the incompatibility of vegetative bodies. Most chestnut orchards in my country are distributed in mountainous and hilly areas. In most cases, they are allowed to grow, with extensive management, and diseases are easy to breed. In recent years, chestnut blight has been prevalent in various places, and the harm is becoming increasingly serious. Therefore, it is urgent to prevent and control chestnut blight. At present, the means of fungal disease prevention and control mainly include chemical control, biological control, disease-resistant breeding and cultivation management. Chemical control is the most important prevention and control measure, but the long-term and large-scale application of chemical pesticides has caused soil compaction, increased resistance of pathogens, and environmental pollution. In the context of promoting the green development of agriculture, biological control has become one of the main measures for green prevention and control of crop fungal diseases because of its advantages such as environmental friendliness, green and safety. However, living microbial pesticides are greatly affected by the environment, and the varieties are limited, which cannot meet market demand. Although disease-resistant breeding is the most effective prevention and control means, it cannot meet the needs of agricultural production due to the rapid mutation of pathogens and the long breeding cycle, and the effect of cultivation management is limited. Therefore, it is imperative to explore new strategies to prevent and control chestnut blight. Summary of the invention

[0004] In order to solve the above-mentioned deficiencies in the prior art, the present invention aims to provide a gene related to the pathogenicity of chestnut blight pathogen CpSge1 and its dsRNA and application to solve the problems that cannot be well solved by existing chestnut blight.

[0005] The technical solution of the present invention to solve the above technical problems is as follows: Provide a gene related to the pathogenicity of chestnut blight pathogen CpSge1 , whose nucleotide sequence is shown in SEQ ID No.1.

[0006] The above genes related to the pathogenicity of chestnut blight pathogen CpSge1 The amino acid sequence of the encoded protein is shown in SEQ ID No.2.

[0007] The beneficial effects of the present invention are as follows: the present invention provides a key gene for the pathogenicity of chestnut blight pathogen CpSge1 The nucleotide sequence of the gene is SEQ ID No.1, and the amino acid sequence of the protein encoded by it is SEQ ID No.2. CpSge1 The gene has a typical conserved domain Gti1 / Pac2 family domain, which contains a potential PKA phosphorylation site and a predicted nuclear localization signal, and belongs to the Gti1 / Pac2 family transcription factor. The present invention uses the Split-Marker method to construct a gene knockout vector and obtains the key gene of chestnut blight pathogenicity through a PEG-mediated genetic transformation system. CpSge1 The knockout mutants of CpSge1 Function of the gene. This gene plays an important role in the growth, spore production, stress and pathogenicity of chestnut blight pathogen.

[0008] The above genes related to the pathogenicity of chestnut blight pathogen CpD The dsRNA, whose nucleotide sequence includes SEQ ID No.3, SEQ ID No.4 or SEQ ID No.5.

[0009] The beneficial effects of the present invention are as follows: the present invention provides genes related to the pathogenicity of chestnut blight pathogen CpSge1 The dsRNA is synthesized using a dsRNA synthesis kit with the nucleotide sequence shown in SEQ ID No. 1 as a template. In the present invention, the nucleotide sequence of the dsRNA is preferably SEQ ID No. 3, SEQ ID No. 4 or SEQ ID No. 5.

[0010] The above genes related to the pathogenicity of chestnut blight pathogen CpSge1 A method for synthesizing dsRNA comprises the following steps: According to gene CpSge1 Design upstream and downstream primers for synthesizing dsRNA, based on gene CpD The PCR amplification is performed as a template, and then transcription is performed to synthesize dsRNA.

[0011] Furthermore, the upstream and downstream primer sequences for synthesizing dsRNA are as follows: dsRNA1 forward primer: 5'-ACCTGGCGGGGCATGGTC-3' (SEQ ID No.8); reverse primer: 5'-AGAGGGGAAGCTCTTGTCGA-3' (SEQ ID No.9); used to amplify the sequence shown in SEQ ID No.3; or dsRNA2 forward primer: 5'-GTGCCCTCCTTACAGCTACA-3' (SEQ ID No. 10); reverse primer: 5'-CGGGCCCCCCATTGGGGT-3' (SEQ ID No. 11); used to amplify the sequence shown in SEQ ID No. 4; or dsRNA3 forward primer: 5'-GGTGATAAGAAGAGGGCTATCAAG-3' (SEQ ID No.12); reverse primer: 5'-ACTGGGGAAGGGGAGCCTAT-3' (SEQ ID No.13); used to amplify the sequence shown in SEQ ID No.5.

[0012] The above genes related to the pathogenicity of chestnut blight pathogen CpD Or the application of dsRNA in the prevention and control of chestnut blight and poplar anthracnose.

[0013] Furthermore, the pathogen causing chestnut blight is a parasitic Cryphonectria parasitica .

[0014] Furthermore, the pathogen causing poplar anthracnose is Colletotrichum gloeosporioides Colletotrichum gloeosporioides .

[0015] The beneficial effect of the present invention is that RNAi can be induced by introducing exogenous dsRNA into pathogenic bacteria. The present invention uses RNAi technology to silence chestnut blight bacteria CpSge1 Gene expression was verified by silencing Sg1 The feasibility of gene reducing the pathogenicity of chestnut blight pathogen; at the same time, because the gene regulates the spore production ability and stress tolerance of chestnut blight pathogen, the present invention has great application potential in reducing the reproduction and spread ability of chestnut blight pathogen and reducing the use of pesticides, which is of great significance for scientific and green disease prevention and control.

[0016] In addition, the present invention verifies that the dsRNA shown in SEQ ID NO.3, SEQ ID No.4 and SEQ ID No.5 can be applied to plant fungal diseases including chestnut blight fungus and gloeosporioides, and the dsRNA shown in SEQ ID No.5 has the best effect. This study can provide new reference and reference for the prevention and control of other fungal diseases.

[0017] A fungal disease control preparation comprising the above-mentioned dsRNA.

[0018] Furthermore, the fungal disease is caused by the parasitic Cryphonectria parasitica Colletotrichum gloeosporioides Colletotrichum gloeosporioides Caused by poplar anthracnose.

[0019] A method for preventing and controlling chestnut blight and poplar anthracnose, comprising: knocking out genes CpD Or introduce dsRNA into pathogens to prevent and control chestnut blight and poplar anthracnose.

[0020] Furthermore, the introduction method is to co-cultivate the dsRNA with the pathogen, or to spray the dsRNA on chestnut or poplar.

[0021] The present invention has the following beneficial effects: The present invention provides a transcription factor gene related to the pathogenicity of chestnut blight pathogen, the nucleotide sequence of which is shown in SEQ ID No.1; the present invention also provides a dsRNA of the gene, the dsRNA is synthesized using the nucleotide sequence shown in SEQ ID No.1 as a template using a dsRNA synthesis kit. In the present invention, the nucleotide sequence of the dsRNA is preferably SEQ ID No.3, SEQ ID No.4 or SEQ ID No.5. In addition, the present invention also provides the dsRNA or gene CpSge1 Application in the prevention and treatment of chestnut blight. This dsRNA can interfere with the key genes of chestnut blight pathogens CpSge1 The expression of the gene affects the growth, spore production, stress tolerance and infection of chestnut branches of chestnut blight pathogen, which helps to prevent and control chestnut blight and can be applied to other plant fungal diseases including poplar anthracnose. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 For the chestnut blight pathogen in Example 1 CpSge1 The results of gene identification; Figure A is CpSge1 Gene domain prediction diagram; Figure B is CpD Phylogenetic relationship of the gene to its homologs in other fungi.

[0023] Figure 2 For Example 1 CpD The test results of gene knockout and complementation; Figure A is CpD Deletion mutants and complementation strains CpSge1 / SGE1 PCR verification results; Figure B is CpD Southern blot validation results of two gene deletion mutants.

[0024] Figure 3 Example 1 chestnut blight pathogen CpSge1 Phenotypic study results of gene knockout mutants; Figure A shows the wild-type chestnut blight pathogen WT, CpD Knockout mutant Δ CpSge1-41 and Δ CpSge1-117 and complementary strains CpSge1 / SGE1 Figure 3 Phenotypes of the strains grown on PDA plates for 24 h, 48 h, and 72 h; Figure B is the statistical result of colony diameter data; Figure C is the phenotypic diagram of the spore production after 30 days of cultivation; Figure D is the result of the mycelial hydrophobicity observation after 10 days of cultivation of the strains using neutral red as a stain; Figure E is the statistical result of the spore number.

[0025] Figure 4 Example 1 chestnut blight pathogen CpSge1 Stress tolerance study of genes; Figure A shows the phenotype of chestnut blight pathogen wild type and mutants inoculated into PDA medium containing 2 M sorbitol (Sorbitol), 0.5 M sodium chloride (NaCl), 10 mM hydrogen peroxide, 200 μg / mL Congo red (CR) and 0.01% sodium dodecyl sulfate (SDS) and no exogenous addition for continuous culture for 7 days; Figure B shows the statistical results of colony diameters of the test strains grown on PDA medium for 7 days; Figure C shows the statistical results of the inhibition rate of different oxidative stress, osmotic stress and cell wall stability stress agents on the test strains; Figure D shows the statistical results of the test strains in PDA medium supplemented with 0.08 μg / mL Carbendazim, 0.06 μg / mL Fludioxonil, 0.15 μg / mL Tebuconazole and 0.08 μg / mL Difenoconazole for continuous culture for 7 days. Figure d is the phenotypic diagram; Figure E is the statistical results of the inhibition rate of different pesticides on the experimental strains.

[0026] Figure 5 Example 1 chestnut blight pathogen CpSge1 The results of the pathogenicity study of the gene; Figure A shows the chestnut blight pathogen wild type, CpSge1 The deletion mutant and the complementary strain were inoculated into the scald spot and cultured for 20 days to show the lesion expansion; Figure B shows the lesion expansion data results.

[0027] Figure 6 For the chestnut blight pathogen in Example 2 CpSge1 Analysis of gene expression patterns during infection and electrophoresis of full-length gene cloning; Figure A shows chestnut blight pathogen CpSge1 The results of gene expression pattern analysis during the 0-3 d infection of chestnut branches; Figure B shows CpD Electrophoresis of full-length gene clone.

[0028] Figure 7 Example 3 chestnut blight pathogen CpD Electrophoresis diagram of three dsRNA genes.

[0029] Figure 8 For the mass production of chestnut blight pathogen using Escherichia coli HT115 in Example 4 CpD dsRNA electropherogram of the gene.

[0030] Fig. 9 The chestnut blight pathogen co-cultured with the three dsRNAs for 1 day in Example 5 CpSge1 Gene expression level graph.

[0031] Fig.10 These are the results of chestnut blight pathogenicity co-cultured with three kinds of dsRNA in Example 6; wherein, Figure A is the pathogenicity result of chestnut blight pathogenicity co-cultured with three kinds of dsRNA infecting chestnut branches; and Figure B is the statistical result of the lesion size.

[0032] Fig.11 These are graphs showing the pathogenicity of Colletotrichum gloeosporioides sprayed with three types of dsRNA in Example 6; wherein, FIG. A is a schematic diagram showing spraying of exogenous dsRNA on leaves; FIG. B is the pathogenicity and statistical results of Colletotrichum gloeosporioides under the condition of 15 ng / μL dsRNA; and FIG. C is the pathogenicity and statistical results of Colletotrichum gloeosporioides under the condition of applying 30 ng / μL dsRNA. DETAILED DESCRIPTION

[0033] The following examples are only used to explain the present invention and are not intended to limit the scope of the present invention. If no specific conditions are specified in the examples, the conditions are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0034] Example 1: Key genes causing chestnut blight pathogens CpSge1 Identification and functional studies of The present invention screened genes that may play a role in the pathogenic process by using the transcriptome data of chestnut blight pathogens infecting chestnut branches, and used bioinformatics analysis using websites such as JGI, NCBI, Phi-base and Interpro to screen genes that may play an important role in the process of chestnut blight pathogens infecting chestnuts. CpD .like Figure 1 As shown in Figures A and B, chestnut blight pathogen CpSge1The gene open reading frame (ORF) is 1623 bp long (sequence as shown in SEQ ID No.1), encoding 541 amino acids (sequence as shown in SEQ ID No.2). The protein molecular weight is 60.28 kDa, the isoelectric point is 6.751, and it has a typical conserved domain Gti1 / Pac2 family domain (IPR018608). The conserved domain contains a potential PKA phosphorylation site and a predicted nuclear localization signal. It is a homolog of Gti1 protein in the Gti1 / Pac2 family transcription factor.

[0035] To determine CpD The present invention uses Split-Marker recombination technology to construct a gene knockout vector, and obtains chestnut blight pathogens through a PEG-mediated genetic transformation system. CpD The knockout mutants were verified by internal and external primers and southern blot experiments to be single copy. CpD The full-length gene fragment was transformed into CpD The knockout mutants were selected and screened by PCR to obtain the complementary strain of CpSge1 deletion mutant. CpSge1 / SGE1 , PCR verification results and Southern blot results of mutants and complemented strains are shown in Figure 2 As shown. Figure 2 As shown in Figures A and B, the wild-type strain EP155 (WT) and the complemented strain CpSge1 / SGE1 The gDNA contains CpD Gene, and two strains CpD Gene deletion mutant Δ CpSge1-41 and Δ CpSge1-117 No CpD Gene, two strains CpD All gene deletion mutants were single-copy.

[0036] The wild-type strain WT and the gene deletion mutant Δ CpSge1-41 and Δ CpSge1-117 , complementary strains CpSge1 / SGE1 Fresh bacterial cakes were inoculated on PDA plates, and photos were taken at 24 h, 48 h, and 72 h, and the colony diameter was measured by the cross method. After the wild type, mutant, and complementary strain were cultured on PDA plates for 10 days, 50 μg / mL neutral red solution was used as a stain, 3 μL of the solution was added to the surface of the mycelium, and the mixture was allowed to stand for 5 min, and the spores were observed and recorded under a stereomicroscope; after 30 days of culture, spores were washed with 5 mL of double distilled water, and the spores were counted under an optical microscope using a hemocytometer. The results are shown in Table 1. Figure 3 .Depend on Figure 3 From the AE diagram, we can see that CpSge1The gene had no significant effect on the growth of chestnut blight pathogen within 3 days, but caused obvious defects in the hydrophobicity of mycelium and a significant decrease in conidia production capacity by about 98.5% (p<0.05).

[0037] Stress sensitivity was determined on PDA plates supplemented with different reagents: 2 M Sorbitol, 0.5 M NaCl, 10 mM hydrogen peroxide, 200 μg / mL CR, and 0.01% SDS for oxidative stress, osmotic stress, and cell wall stability stress, and 0.08 μg / mL Carbendazim, 0.06 μg / mL Fludioxonil, 0.15 μg / mL Tebuconazole, and 0.08 μg / mL Difenoconazole for pesticide stress. The culture was continued for 7 days, and then the morphology and size analysis were performed. The results are shown in Figure 2. Figure 4 .Depend on Figure 4 From the AE diagram, we can see that CpD The gene deletion mutant was more sensitive on PDA plates supplemented with Sorbitol, NaCl, hydrogen peroxide and Fludioxonil (p<0.05), and its sensitivity decreased on PDA plates supplemented with Carbendazim and Tebuconazole (p<0.05). There was no significant difference in sensitivity on PDA plates supplemented with CR, SDS and Difenoconazole. CpD The gene has a significant effect on the tolerance of chestnut blight pathogen to oxidative stress, osmotic stress and pesticide stress.

[0038] The wild-type strain of chestnut blight pathogen and the gene deletion mutant Δ CpSge1-41 and Δ CpSge1-117 , complementary strains CpSge1 / SGE1 Fresh fungus cakes were inoculated on scalded chestnut branches and cultured for 20 days, and the size of the lesions was observed, indicating that CpD The gene has a significant effect on the pathogenicity of chestnut blight pathogen. Figure 5 .Depend on Figure 5 From Figure A and Figure B, we can see that CpD The area of ​​lesions produced by the gene deletion mutant infecting chestnut branches was significantly smaller (p<0.05), about 20% of the wild type and complemented strains. CpSge1 The deletion of the gene significantly affects the pathogenicity of chestnut blight pathogen.

[0039] Example 2: Key genes causing chestnut blight pathogens CpSge1 Expression pattern analysis and full-length cloning Total RNA was extracted from chestnut branches infected with chestnut blight pathogen EP155 at 0 h, 3 h, 6 h, 9 h, 12 h, 24 h, 48 h and 72 h, and the first-chain cDNA was synthesized using the reverse transcription kit ABScript III RT Master Mix for qPCR with gDNA Remover. After reverse transcription, the cDNA was synthesized using Hieff UNICON ® Universal Blue qPCR SYBR Green MasterMix for qRT-PCR to explore CpD The expression of genes during infection of chestnut branches, CpD Gene expression pattern results Figure 6 As shown in Figure A.

[0040] Using the first strand of cDNA of chestnut blight pathogen EP155 as template, CpD Primers are designed on both sides of the coding region sequence of the gene, and then PCR amplification is performed. The specific primer sequences are as follows: Forward primer: 5′-ATGGACGAGCTTGTGTCGCA-3′ (SEQ ID No. 6); Reverse primer: 5'-AAGGACGCGAAGAACTGATCG-3' (SEQ ID No. 7).

[0041] The PCR reaction system was Gloria Nova HS 2X Master Mix: 25 μL, upstream primer: 1 μL, downstream primer: 1 μL, cDNA: 2 μL, and double distilled water: 21 μL.

[0042] The PCR amplification program was 98°C for 45 s; 98°C for 10 s, 55°C for 30 s, 72°C for 1 min, 35 cycles; 72°C for 1 min; and storage at 4°C.

[0043] The PCR product was detected by 1% agarose gel electrophoresis, and the 1623 bp band was recovered using the TIANgel Midi Purification Kit. The electrophoresis result is shown in Figure 6 Figure B in .

[0044] The recovered band was connected to the T-vector overnight, and the ligation product was transformed into DH5α competent cells. Positive clones were detected by colony PCR, and LB ( A+ ) liquid culture medium was shaken for 12 h, and the plasmid was extracted using Tiangen Rapid Plasmid Extraction Kit and sent to Beijing Ruiboxingke Biotechnology Co., Ltd. for sequencing.

[0045] Depend on Figure 6 As shown in Figure A, CpD The expression of the gene was upregulated in the early stage of chestnut blight infection of chestnut branches, reaching a peak at 12 h of infection; Figure 6 As shown in Figure B, the cDNA amplified from chestnut blight pathogen CpD The full-length electrophoresis diagram of the gene is 1623 bp in length. Its specific nucleotide sequence is shown in SEQ ID No.1, and its encoded amino acid sequence is shown in SEQ ID No.2.

[0046] Gene CpD The nucleotide sequence is as follows:

[0047] Gene CpD The amino acid sequence of the encoded protein is as follows: (SEQ ID No.2).

[0048] Example 3: Key to the pathogenicity of chestnut blight pathogen CpD Synthesis of dsRNA The chestnut blight pathogen amplified according to Example 2 CpD Gene sequence, design and synthesis CpD The primers for gene dsRNA were designed in combination with the prediction of CpSge1 protein domain and multiple sequence alignment. dsRNA1 selected 255 bp from 109 to 363 as the target amplification fragment to design primers, which contained part of the conserved domain and phosphorylation site of CpSge1 protein; dsRNA2 selected 288 bp from 1084 to 1371 as the target amplification fragment to design primers, which was designed in the non-conserved region at the C-terminus of CpSge1 protein; dsRNA3 selected 288 bp from 364 to 651 as the target amplification fragment to design primers, which contained part of the conserved domain and nuclear localization signal of CpSge1 protein.

[0049] The nucleotide sequences of dsRNA1, dsRNA2, and dsRNA3 and the amplification primers are as follows: dsRNA1: ACCTGGCGGGGCATGGTCATGTCCACCATCGACGCGCTCAAGGTTGTCGAGGCCTGTCTCACAGGCACTCTCATGCACACCGCCCGTCGGCCACACGACAGAGAACGAGAACATCTCATCCGCAGCGGCAACGTGTTCGTCTATGAGGAGTCCTCCTCCGGCATCAAGCGCTGGACTGACGGACAGAATTGGAGCCCCAGCAGGATCCTGGGCAACTATCTGATCTACCGAGAGCTCGACAAGAGCTTCCCCTCT (SEQ ID No.3); dsRNA2: GTGCCCTCCTTACAGCTACATACCTTTGGACACAACATGTCTCATATGATAGACAGCGCCGGCCCCAGCAGCACCAGCAGCAGCAGCAAGAGAAGACGCTCAGATGCCTACGAGACAGCGACACCCGACGGACACGATTATTACTCTCCCATGACCGACCCAGCGCGGGCAGGACACCACTACTTTGTAGGCGCGACGACACCCTCCTCCTATGCGATGGCTCCCCTCCACGCCACAGCGGAAACCGCCGAGTACAAACCTGCAGGGGCCACCCCAATGGGGGGCCCG (SEQ ID No.4); dsRNA3: GGTGATAAGAAGAGGGCTATCAAGCGGAAGAGAGAGGGCAAGCCCGATCTCCAGCAGAGCGGCCACCCACCACCACCACTACCAACAGCACCACGCCTGATGCGCCGACTTCTCTTAACGACGAGCGGGAGAGGGCGCTCCTTGGG CTCCCTCGTCGACTCGTACCCTTTTAAGGAGGGTGGGCTAATCAAGAAGACCATCAGCATCAAGTGGAACAACGTTATGCACCACCTTGTCAGCTACTACTCCCTCGAGGACCGAGGAACCATAGGCTCCCCTTCCCCAGT (SEQ IDNo.5); dsRNA1 forward primer: 5'-ACCTGGCGGGGCATGGTC-3' (SEQ ID No.8); reverse primer: 5'-AGAGGGGAAGCTCTTGTCGA-3' (SEQ ID No.9). Amplified sequence with a fragment length of 255 bp.

[0050] dsRNA2 forward primer: 5'-GTGCCCTCCTTACAGCTACA-3' (SEQ ID No. 10); reverse primer: 5'-CGGGCCCCCCATTGGGGT-3' (SEQ ID No. 11). The amplified sequence was 288 bp in length.

[0051] dsRNA3 forward primer: 5'-GGTGATAAGAAGAGGGCTATCAAG-3' (SEQ ID No. 12); reverse primer: 5'-ACTGGGGAAGGGGAGCCTAT-3' (SEQ ID No. 13). The amplified sequence was 288 bp in length.

[0052] Each of the above primers was preceded by a 20 bp T7 promoter sequence TAATACGACTCACTATAGGG (SEQ ID No. 14) and cloned using Promega T7 RiboMAX TM Express RNAi system kit synthesis CpSge1 The dsRNA of the gene was extracted and the dsRNA concentration was detected by micro-spectrophotometer and stored at -80°C for future use. Figure 7 .

[0053] Depend on Figure 7It can be seen that all three dsRNAs can be synthesized through the kit to obtain pure dsRNA, which can be used for silencing efficiency and function verification.

[0054] Example 4: Mass production of chestnut blight pathogen using Escherichia coli HT115 CpD dsRNA The F-terminal primers of the three dsRNAs in Example 3 were added with a SmaⅠ restriction site and a protective base TCCCCCGGG, and the R-terminal primers were added with a KpnⅠ restriction site and a protective base GGGGTACC. After PCR, the overlap fragments were recovered using the Tiangen ordinary agarose gel DNA recovery kit. The recovered fragments and the L4440 plasmid were double-digested with SmaⅠ enzyme and KpnⅠ enzyme (Takara). The three dsRNA fragments were respectively ligated to the L4440 vector using T4 ligase. The recombinant vectors were transformed into Escherichia coli HT115 (DE3), and the expression of dsRNA was induced using IPTG. The total RNA of Escherichia coli HT115 was extracted using the Trizol method. The obtained dsRNA was as shown in Figure 8 shown.

[0055] Depend on Figure 8 It was found that all three dsRNAs could be produced in large quantities using E. coli HT115 by induction with IPTG.

[0056] Example 5: Key to chestnut blight pathogenicity CpD Detection of gene silencing effects The synthesized CpD The three dsRNAs of the genes were added to 100 μL of 1×10 6 The cells were incubated in a suspension of chestnut blight pathogens with 100 μg / mL spores for 1 day. The group with double distilled water was used as the control group. The spores after incubation were added to YEPD liquid medium and cultured for 2 days. The total RNA of chestnut blight pathogens was extracted and reverse transcribed into the first chain of cDNA. RT-qPCR was used to detect the expression of spores in the cells. CpD The expression of genes.

[0057] Reference genes used in RT-qPCR CpActin Forward primer: 5'-GGCAACATTGTCATGTCTGG-3' (SEQ ID No. 15); Reverse primer: 5'-ACAGGGAGGCCAGGATAGAT-3' (SEQ ID No. 16). Target gene CpSge1 Forward primer: 5'-TCAACACCATCAGGCAATGT-3' (SEQ ID No. 17); reverse primer: 5'-ATCACCAGAGGGGAAGCTCT-3' (SEQ ID No. 18).

[0058] RT-qPCR detection showed that the treatment groups with dsRNA1, dsRNA2, and dsRNA3 had a significant effect on chestnut blight pathogens after incubation with dsRNA. CpD The relative expression levels of the genes were significantly downregulated compared with the control group (p<0.05), which were 77.5%, 48.5% and 47.1%, respectively, indicating that the application of exogenous dsRNA effectively interfered with the CpD The results of gene expression are shown in Fig. 9 .

[0059] Depend on Fig. 9 It can be seen that the chestnut blight pathogen added with dsRNA is different from the control group with double distilled water. CpD The relative expression of genes was significantly different in the treatment groups with dsRNA1, dsRNA2, and dsRNA3 after co-culture. CpSge1 The relative expression of genes was significantly down-regulated compared with the control group (p<0.05), especially in the chestnut blight pathogen with dsRNA1 added. CpD The expression of the gene was significantly downregulated by 77.5%, dsRNA2 was significantly downregulated by 48.5%, and dsRNA3 was significantly downregulated by 47.1%. Therefore, incubating the spores of the wild-type strain EP155 of chestnut blight fungus with dsRNA at a final concentration of 100 ng / μL for 24 h significantly reduced the expression of chestnut blight fungus. CpD mRNA transcript levels of genes, chestnut blight pathogen CpD The gene was effectively silenced.

[0060] Example 6: Addition CpD Effects of dsRNA on the pathogenicity of plant pathogenic fungi The present invention has been verified by gene knockout in Example 1. CpD Gene deletion leads to a significant decrease in the pathogenicity of chestnut blight pathogen CpD The dsRNA has great application potential in the green prevention and control of chestnut blight.

[0061] In this embodiment, the spore suspension of chestnut blight pathogen incubated with dsRNA for 1 day in Example 5 was evenly spread on a TB3 plate, and the group with double distilled water was used as the control group. After 2 days of cultivation, the chestnut blight pathogen incubated with dsRNA and the wild-type strain without dsRNA were inoculated into the scald spots of chestnut branches that had been treated in advance. The one-year-old fresh chestnut branches used for inoculation were treated in advance, burned with an electric soldering iron, and left to stand for 0.5 hours. 20 μL of 100 ng / μL of three kinds of dsRNA were dripped on the scald spots and then left to stand for 24 hours. The pathogenicity results were observed after 20 days, as shown in FIG. Fig.10 shown.

[0062] Depend on Fig.10 As shown in Figures A and B, the lesion area of ​​chestnut branches treated with the three dsRNAs decreased by 5.8%, 27.6% and 43.9%, respectively. The lesion area of ​​samples treated with dsRNA2 and dsRNA3 was significantly reduced (p<0.05), indicating that dsRNA silencing CpSge1 The gene has a significant effect in reducing the pathogenicity of chestnut blight pathogen and can be used for the prevention and treatment of chestnut blight.

[0063] In addition, in order to explore whether the three dsRNAs have broad-spectrum application potential, a broad-spectrum experiment was conducted using Colletotrichum gloeosporioides, a pathogen of poplar leaf diseases, as an indicator. Specifically, 20 μL of the three dsRNAs extracted in Example 3 with a final concentration of 15 ng / μL and 30 ng / μL were dripped onto the scalded poplar leaves, and the control group was sprayed with an equal amount of sterile water. After standing for 24 h, the bacterial cake with the wild-type Colletotrichum gloeosporioides strain was inoculated on the scalded poplar leaves and cultured for 6 days. The size of the lesions was observed, and the results were as follows: Fig.11 shown.

[0064] Depend on Fig.11 The AC graph shows that there is no significant difference in pathogenicity on the poplar leaves with 15 ng / μL dsRNA, while the lesion area of ​​the poplar leaves with 30 ng / μL dsRNA is significantly reduced, indicating that silencing with dsRNA Sg1 The genes had significant effects on the pathogenicity of Colletotrichum gloeosporioides infecting poplars (p<0.05), which were 6.3%, 26.3% and 25.2%, respectively, proving that the three dsRNAs of the present invention can reduce the pathogenicity of Colletotrichum gloeosporioides.

[0065] In summary, external application CpD Three types of dsRNA can silence genes Sg1 The expression of the gene significantly reduced the pathogenicity of chestnut blight pathogen and gloeosporioides. Therefore, the above three dsRNAs can be used to prevent and control diseases caused by plant pathogenic fungi including chestnut blight pathogen and gloeosporioides. Among them, dsRNA3 has the best effect, with a broad spectrum and high application potential.

[0066] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A gene associated with the pathogenicity of chestnut blight pathogen CpD , characterized in that, The gene CpD The nucleotide sequence is shown in SEQ ID No.

1.

2. The gene related to the pathogenicity of chestnut blight pathogen according to claim 1 CpSge1 The encoded protein is characterized in that The amino acid sequence of the protein is shown in SEQ ID No.

2.

3. The gene related to the pathogenicity of chestnut blight pathogen according to claim 1 CpD The dsRNA is characterized in that The nucleotide sequence of the dsRNA is SEQ ID No.3, SEQ ID No.4 or SEQ ID No.

5.

4. The gene related to the pathogenicity of chestnut blight pathogen according to claim 3 CpSge1 A method for synthesizing dsRNA, characterized in that The following steps are involved: According to gene CpSge1 Design upstream and downstream primers for synthesizing dsRNA, based on gene CpSge1 The PCR amplification is performed as a template, and then transcription is performed to synthesize dsRNA.

5. The synthesis method according to claim 4, characterized in that The upstream and downstream primer sequences for synthesizing dsRNA are as follows: dsRNA1 forward primer: 5'-ACCTGGCGGGGCATGGTC-3'; reverse primer: 5'-AGAGGGGAAGCTCTTGTCGA-3'; used to amplify the sequence shown in SEQ ID No.

3.

6. The synthesis method according to claim 4, characterized in that The upstream and downstream primer sequences for synthesizing dsRNA are as follows: dsRNA2 forward primer: 5'-GTGCCCTCCTTACAGCTACA-3'; reverse primer: 5'-CGGGCCCCCCATTGGGGT-3'; used to amplify the sequence shown in SEQ ID No.

4.

7. The synthesis method according to claim 4, characterized in that The upstream and downstream primer sequences for synthesizing dsRNA are as follows: dsRNA3 forward primer: 5'-GGTGATAAGAAGAGGGCTATCAAG-3'; reverse primer: 5'-ACTGGGGAAGGGGAGCCTAT-3'; used to amplify the sequence shown in SEQ ID No.

5.

8. The gene related to the pathogenicity of chestnut blight pathogen according to claim 1 CpD Or use of the dsRNA according to claim 3 in preventing and treating chestnut blight and poplar anthracnose.

9. A fungal disease control preparation, characterized in that: Comprising the dsRNA of claim 3.

10. A method for preventing and treating chestnut blight and poplar anthracnose, characterized in that: The following steps are involved: By knocking out the gene described in claim 1 CpSge1 Or the dsRNA described in claim 3 is introduced into pathogenic bacteria to prevent and treat chestnut blight and poplar anthracnose.

Images