Marker gene egark1 and its application in eucalyptus grandis mycorrhizal symbiosis

Abstract

The application discloses a marker gene in the ectomycorrhizal symbiotic stage of Eucalyptus grandis EgARK1 and application thereof, and belongs to the field of plant genetic engineering and biotechnology. EgARK1 The nucleotide sequence of the gene is shown in SEQ ID NO:1, and the amino acid sequence is shown in SEQ ID NO:2. Time course analysis shows that the gene EgARK1 can be used as a marker gene for indicating the development of ectomycorrhizae, and participates in the infection of ectomycorrhizal fungi and the development process of mycorrhizal symbionts. Through functional research on the Eucalyptus grandis gene EgARK1 , the results show that the silencing of the gene has a significant influence on the development of ectomycorrhizae in the ectomycorrhizal symbiosis of Eucalyptus grandis, and the gene can be used for regulating the mycorrhizal symbiosis process of plants through transgenic technology, improving the mycorrhizal symbiosis efficiency, promoting the development of ectomycorrhizae, improving the mycorrhizal infection rate, playing an important role in regulating the development of ectomycorrhizae, and having potential application value in the directional genetic improvement of mycorrhizal plants.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of plant genetic engineering and biotechnology, and particularly relates to a marker gene for Eucalyptus grandis mycorrhizal symbiosis period EgARK1 and application thereof. BACKGROUND

[0002] There are tens of thousands of bacterial, fungal and other microbial groups in the rhizosphere soil of agricultural and forestry plants, and the plant and rhizosphere microbial community co-evolve mutually beneficially (Trivedi et al., 2020). Arbuscular Mycorrhiza (AM) fungi are an important component group of plant rhizosphere microorganisms, which can form symbiotic bodies with more than 72% of terrestrial plants (Rich et al., 2021; Genre et al., 2020). Plants provide fatty acids and sugars for AM fungi to complete their life history (Jiang et al., 2017; An et al., 2019), on the contrary, AM fungi promote the absorption and utilization of plants for phosphorus, nitrogen and other nutrients and water (Zhang et al., 2023; Xie et al., 2022; Wang et al., 2020; Li et al., 2013). At the same time, AM fungi can also enhance the resistance of host plants to abiotic stress, such as soil heavy metal pollution, climate drought, soil salinization and plant pests and diseases (Wang et al., 2023; Li et al., 2023; Wang et al., 2021), thereby promoting the healthy growth of host plants. Therefore, mycorrhizal symbiosis has great application potential in maintaining soil fertility, plant productivity and soil health (Duan et al., 2024).

[0003] Eucalyptus as an important timber tree species, its cultivation and utilization have a profound impact on many fields. Eucalyptus root system can form endophyte with AM fungi, obtain mineral nutrients from the soil, especially inorganic phosphorus (Pi) and nitrogen (Shi et al., 2023). Eucalyptus and AM fungi symbiosis can improve its growth and productivity, and it is of practical significance for eucalyptus to better adapt to low-efficiency phosphorus stress in South China. How to determine the infection level of eucalyptus after mycorrhizal and the mycorrhizal symbiotic period, so as to determine the quality of mycorrhizal samples and the sample collection period. In the existing technology, the conventional microscopic examination method for statistical infection rate has the disadvantages of time-consuming and heavy workload. With the publication of Eucalyptus grandis genome (Myburg et al., 2014), more and more genes involved in mycorrhizal symbiosis have been discovered and located. As the main place for nutrient exchange between arbuscular mycorrhizal fungi and host plant cells, arbuscule is the core structure of the arbuscular mycorrhizal symbiotic interface. However, the function of genes related to arbuscule development is rarely reported. Therefore, it is helpful to reveal the molecular regulation mechanism of plant mycorrhizal symbiosis by excavating and identifying more new genes that can regulate arbuscule development from the molecular level, promoting the application of mycorrhizal fungi in forestry, and providing the feasibility of popularization and application for the large-scale production of mycorrhizal seedlings in forestry and the directional improvement in genetic breeding.

[0004] References:

[0005] Trivedi P, Leach JE, Tringe SG, Sa T, Singh BK. (2020) Plant-microbiome interactions: from community assembly to plant health [J]. Nature Reviews Microbiology. 18(11):607-621.

[0006] Rich MK, Vigneron N, Libourel C, Keller J, Xue L, Hajheidari M, Radhakrishnan GV, Le Ru A, Diop SI, Potente G, Conti E, Duijsings D, Batut A, Le Faouder P, Kodama K, Kyozuka J, Sallet E, Be card G, Rodriguez-Franco M, Ott T, Bertrand-Michel J, Oldroyd GED, Szovényi P, Bucher M, Delaux PM. (2021) Lipid exchanges drove the evolution of mutualism during plant terrestrialization [J]. Science. 372(6544):864-868.

[0007] Genre A, Lanfranco L, Perotto S, Bonfante P. (2020) Unique and common traits in mycorrhizal symbioses [J]. Nature Reviews Microbiology. 18(11):649-660.

[0008] Jiang Y, Wang W, Xie Q, Liu N, Liu L, Wang D, Zhang X, Yang C, Chen X, Tang D, Wang E. (2017) Plants transfer lipids to sustain colonization by mutualistic mycorrhizal and parasitic fungi [J]. Science. 356(6343):1172-1175.

[0009] An J, Zeng T, Ji C, de Graaf S, Zheng Z, Xiao TT, Deng X, Xiao S, Bisseling T, Limpens E, Pan Z. (2019) A Medicago truncatulaSWEET transporter implicated in arbuscule maintenance during arbuscular mycorrhizal symbiosis [J]. New Phytologist. 224(1):396-408.

[0010] Zhang S, Nie Y, Fan X, Wei W, Chen H, Xie X, Tang M. (2023) A transcriptional activator from Rhizophagus irregularis regulates phosphate uptake and homeostasis in AM symbiosis during phosphorous starvation [J]. Frontiers in Microbiology. 13:1114089.

[0011] Xie X, Lai W, Che X, Wang S, Ren Y, Hu W, Chen H, Tang M. (2022) ASPX domain-containing phosphate transporter from Rhizophagus irregularis handles phosphate homeostasis at symbiotic interface of arbuscular mycorrhizas [J]. New Phytologist. 234(2):650-671.

[0012] Wang S, Chen A, Xie K, Yang X, Luo Z, Chen J, Zeng D, Ren Y, Yang C, Wang L, Feng H, López-Arredondo DL, Herrera-Estrella LR, Xu G. (2020) Functional analysis of the OsNPF4.5 nitrate transporter reveals a conserved mycorrhizal pathway of nitrogen acquisition in plants [J]. Proceedings of the National Academy of Sciences of the United States of America. 117(28): 16649-16659.

[0013] Li T, Hu YJ, Hao ZP, Li H, Wang YS, Chen BD. (2013) First cloning and characterization of two functional aquaporin genes from an arbuscular mycorrhizal fungus Glomus intraradices [J]. New Phytologist. 197(2): 617-630.

[0014] Wang G, Jin Z, George TS, Feng G, Zhang L. (2023) Arbuscular mycorrhizal fungi enhance plant phosphorus uptake through stimulating hyphosphere soil microbiome functional profiles for phosphorus turnover [J]. New Phytologist. 238(6): 2578-2593.

[0015] Li X, Zhao R, Li D, Wang G, Bei S, Ju X, An R, Li L, Kuyper TW, Christie P, Bender FS, Veen C, van der Heijden MGA, van der Putten WH, Zhang F, Butterbach-Bahl K, Zhang J. (2023) Mycorrhiza-mediated recruitment of complete denitrifying Pseudomonas reduces N2O emissions from soil [J]. Microbiome. 11(1):45.

[0016] Wang X, Feng H, Wang Y, Wang M, Xie X, Chang H, Wang L, Qu J, Sun K, He W, Wang C, Dai C, Chu Z, Tian C, Yu N, Zhang X, Liu H, Wang E. (2021) Mycorrhizal symbiosis modulates the rhizosphere microbiota to promote rhizobia-legume symbiosis [J]. Molecular Plant. 14(3):503-516.

[0017] Duan S, Feng G, Limpens E, Bonfante P, Xie X, Zhang L. (2024) Cross-kingdom nutrient exchange in the plant-arbuscular mycorrhizal fungus-bacterium continuum [J]. Nature Reviews Microbiology. 18.

[0018] Shi J, Wang X, Wang E. (2023) Mycorrhizal Symbiosis in Plant Growth and Stress Adaptation: From Genes to Ecosystems [J]. Annual Review of Plant Biology. 74:569-607.

[0019] Myburg AA, Grattapaglia D, Tuskan GA, et al. (2014) The genomeof Eucalyptus grandis [J]. Nature.510(7505): 356-362. Summary of the Invention

[0020] To overcome the shortcomings and deficiencies of existing technologies, the present invention aims to provide a marker gene for the arbuscular mycorrhizal symbiosis period of Eucalyptus grandis. EgARK1 And its application in mycorrhizal symbiosis. This gene EgARK1 It can serve as a marker gene for regulating fascicular development and as a new gene resource with breeding value.

[0021] The objective of this invention is achieved through the following technical solution:

[0022] This invention is based on giant eucalyptus ( Eucalyptus grandis A 1776 bp genome was cloned from the genome of ). EgARK1 The gene encodes 591 amino acids with a molecular weight of 66.21 kDa. Its nucleotide sequence is shown in SEQ ID NO: 1, and its amino acid sequence is shown in SEQ ID NO: 2. Time-series analysis shows that... EgARK1 The gene expression level was highest during the mycorrhizal symbiosis stage (35 dpi), and it can be used as a marker gene for the symbiotic stage. Virus-induced gene silencing experiments showed that... EgARK1 Gene knockdown affects wisteria formation during the AM symbiotic period, and the infection rate and wisteria abundance of control plants are significantly better than those of silent plants.

[0023] The above EgARK1 Gene-related biological materials are any one or more combinations of the following biological materials:

[0024] (a) Contains the above EgARK1 Gene expression cassettes;

[0025] (b) Contains the above EgARK1 Recombinant gene expression vectors;

[0026] (c) A recombinant expression vector containing the expression cassette described in (a);

[0027] (d) Contains the above EgARK1 Recombinant microorganisms;

[0028] (e) Recombinant microorganisms containing the expression cassette described in (a);

[0029] (f) Recombinant microorganisms containing the recombinant expression vector described in (b) or (c).

[0030] The above EgARK1 The gene-related biological material is any one or a combination of the following biological materials:

[0031] (g) inhibiting or blocking the expression of the gene EgARK1 by a nucleic acid molecule;

[0032] (h) a vector for inhibiting or blocking the expression of the gene EgARK1 by the nucleic acid molecule in (g).

[0033] Further, the nucleic acid molecule in (g) is an antisense RNA, siRNA, shRNA, sgRNA or RNAi silencing region of the gene. EgARK1

[0034] Further, the RNAi silencing region is designed at the 5' end of the gene using a virus-induced gene silencing technology by designing an RNAi silencing region of +1 to +200 relative to the translation initiation codon (ATG). EgARK1

[0035] The gene EgARK1 is applied as a marker for the ectomycorrhizal symbiotic phase of Eucalyptus grandis and further as a marker gene for indicating the development of ectomycorrhizae in the AM symbiotic process of Eucalyptus grandis.

[0036] Further, the gene EgARK1 is applied in evaluating whether Eucalyptus grandis inoculated with Glomus heterosporum can be mycorrhizal.

[0037] The gene EgARK1 is applied in preparing reagents for evaluating whether Eucalyptus grandis inoculated with Glomus heterosporum can be mycorrhizal.

[0038] A pair of specific primers for detecting the expression level of the gene EgARK1 has the following sequences:

[0039] EgARK1-qRT-F 5'-GGATTCGTATAGAGATGCACAGG-3';

[0040] EgARK1-qRT-R 5'-TGCCCTTTCTGTATCATTGTCG-3'.

[0041] The above specific primers are applied in detecting the expression level of the gene EgARK1 .

[0042] Specifically comprising the following steps:

[0043] ​​Thirty-five days after inoculating *Eucalyptus macrocarpa* with *Rhizophora heterophylla*, mycorrhizal tissue was harvested. Surface impurities were cleaned, and the tissue was ground and pulverized in liquid nitrogen. Total RNA was extracted and reverse transcribed into cDNA. Based on the gene... EgARK1 We designed specific primers to perform PCR amplification and detect gene expression levels to evaluate whether conventional Eucalyptus seedlings have achieved or are potentially mycorrhizalized.

[0044] Gene EgARK1 Or the application of biological materials in promoting the colonization of Eucalyptus macrocarpa roots by arbuscular mycorrhizal fungi;

[0045] Furthermore, it includes at least one of the following applications:

[0046] 1) Application in promoting the infection rate of arbuscular mycorrhizal fungi in the roots of Eucalyptus macrocarpa; specifically, compared with gene-silenced plants, the infection rate in the roots of control plants was significantly increased.

[0047] 2) Application in promoting the abundance of arbuscular mycorrhizal fungi in the roots of Eucalyptus grandis; specifically, compared with gene-silenced plants, the abundance of arbuscular fungi in the roots of control plants was significantly increased.

[0048] Gene EgARK1 The application of biological materials in promoting the vegetative growth and increasing the biomass of Eucalyptus grandis, wherein the application environment is a symbiotic environment of arbuscular mycorrhizal fungi and Eucalyptus grandis; specifically, compared with gene-silenced plants, the plant height, root length and / or root fresh weight of control plants are significantly increased, and the fresh weight of the aboveground parts of control plants is also increased.

[0049] Therefore, the present invention provides the aforementioned EgARK1 Applications of genes in serving as marker genes for indicative of arbuscular development, promoting arbuscular development, increasing mycorrhizal plant infection rates, promoting plant vegetative growth, and increasing plant biomass.

[0050] Preferably, the arbuscular mycorrhizal fungi include *Rhizocarpium heterophyllum* (…). Rhizophagus irregularis Furthermore, including Rhizocystis heteromorpha ( R. irregularis )DAOM 197198.

[0051] Preferably, the gene-silencing plant is produced using virus-induced gene silencing (VIGS) technology, through... EgARK1 An RNAi silencing region was designed at the 5' end of the gene, relative to the translation start codon (ATG) +1 to +200, to target a specific region of the target gene and obtain gene-silenced plants.

[0052] This invention selects Eucalyptus grandis, a native tree species of South China ( E. grandis Using arbuscular mycorrhizal fungi (Heterorrhizal sarcodactylus) as the host plant, through inoculation with the fungus *Heterorrhizal sarcodactylus* (…R. irregularis DAOM 197198)35 days later, plant morphological indicators were recorded and eucalyptus physiological indicators were determined. Through the analysis of plant height, root length and biomass, the infection rate of eucalyptus roots inoculated with AM fungus Glomus heterosporum was determined, and the expression of related genes was analyzed.

[0053] The present application has the following advantages and effects relative to the prior art:

[0054] (1) The present application shows that the gene EgARK1 has the highest expression at the mycorrhizal symbiotic stage (35 dpi), indicating that the gene EgARK1 can be used as a marker gene for indicating the development of the cluster root, and is involved in the infection of the cluster mycorrhizal fungus and the development process of the mycorrhizal symbiont. Through gene transcription level analysis, it is shown that the gene EgARK1 is significantly induced to express by the infection of AM fungus Glomus heterosporum.

[0055] (2) The present application studies the function of the eucalyptus gene EgARK1 The results show that the silencing of the gene has a significant effect on the development of the cluster root in the cluster mycorrhizal symbiosis of eucalyptus, and can be used for transgenic technology to regulate the mycorrhizal symbiosis process, improve the mycorrhizal symbiosis efficiency, promote the development of the cluster root, and improve the mycorrhizal infection rate. It plays an important role in regulating the development of the cluster root and has potential application value in the directional genetic improvement of mycorrhizal plants. BRIEF DESCRIPTION OF DRAWINGS

[0056] Figure 1 For EgARK1 the gene expression analysis diagram of the gene at different stages of eucalyptus AM symbiosis, EgARK1 the expression level of the gene is normalized with the internal reference gene eucalyptus ubiquitin 3 (Ubiquitin 3, EgUBI3 ), according to Duncan's multiple comparison test, the data is the average value and standard error of 3 biological repeats, P <0.05.

[0057] Figure 2 the expression level of the marker gene of eucalyptus at the mycorrhizal symbiotic stage EgPT4 the gene expression analysis diagram of the gene at different stages of eucalyptus AM symbiosis, EgPT4 is normalized with the internal reference gene EgUBI3 , according to Duncan's multiple comparison test, the data is the average value and standard error of 3 biological repeats, P <0.05.

[0058] Figure 3 the expression level of the marker gene of eucalyptus at the mycorrhizal symbiotic stage EgFatM the gene expression analysis diagram of the gene at different stages of eucalyptus AM symbiosis, EgFatMThe expression level of the internal reference gene EgUBI3 After normalization, and based on Duncan's multiple comparison test, the data consisted of the mean and standard error of three biological replicates. P <0.05.

[0059] Figure 4 Heteromorpha rhizocarpium, a marker gene for mycorrhizal symbiosis. RiMST2 Gene expression analysis at different stages of *Eucalyptus macrocarpa* symbiosis (AM). Data are presented as the mean and standard error of three biological replicates, based on Duncan's multiple comparison test. P <0.05.

[0060] Figure 5 In the virus-induced gene silencing experiment EgARK1 Gene silencing efficiency detection graph. EgARK1 The expression level of the internal reference gene EgUBI3 Perform homogenization. Based on the independent samples t-test analysis, * indicates a significant difference in the t-test. The data are the mean and standard error of three biological replicates. P <0.05.

[0061] Figure 6 In the virus-induced gene silencing experiment EgARK1 Effects of gene silencing on the phenotype of *Eucalyptus macrocarpa* fungi (AM) morphology; Left: Fluorescence microscopic images of *Rhizomycetes heteromycorrhizal* arbuscular structures in *Eucalyptus macrocarpa* control and gene-silenced plants, scale bar: 100 μm; Right: Measurement of mycorrhizal fungal infection levels, F%: total AM fungal infection rate, M%: root mycorrhizal infection intensity, A%: root arbuscular abundance. Analysis was performed using an independent samples t-test; * indicates a significant difference in the t-test. Data represent the mean and standard error of three biological replicates. P <0.05;** P <0.01; ***, P <0.001.

[0062] Figure 7 In the virus-induced gene silencing experiment EgARK1 Gene silencing of eucalyptus AM symbiotic marker genes ( EgFatM , EgPT4, RiMST2 The influence of expression level, EgFatM , EgPT4 The expression level of the internal reference gene EgUBI3 To homogenize, RiMST2 The expression level of the internal reference gene RiEF1a Perform homogenization; analyze according to independent samples t-test, * indicates that the t-test shows a significant difference, the data are the mean and standard error of 3 biological replicates, *, P <0.05.

[0063] Figure 8 For virus-induced gene silencing experiment EgARK1 The biomass of Eucalyptus grandis seedlings inoculated with AM fungi was counted; according to the analysis of independent sample t test, the t test has significant difference, the data is the average value and standard error of 3 biological repeats, *, P <0.05.

[0064] Figure 9 For virus-induced gene silencing experiment EgARK1 The growth phenotype of Eucalyptus grandis seedlings inoculated with AM fungi was counted. DETAILED DESCRIPTION

[0065] The application will be described in further detail below with reference to the embodiments and drawings, but the embodiments of the application are not limited thereto.

[0066] The outstanding features and significant progress of the application will be further illustrated by the following examples, and the following examples are only for illustrating the application and do not limit the application. Based on the examples in the application, all other examples obtained by those skilled in the art without creative work are within the scope of protection of the application.

[0067] The test methods in the following examples without specific experimental conditions are usually carried out according to conventional experimental conditions or according to the experimental conditions suggested by the manufacturer. The materials, reagents and the like used are commercially available reagents and materials unless otherwise specified.

[0068] Example 1

[0069] (1) The AM fungus Glomus heterosporum (DAOM 197198) was inoculated on the roots of corn to propagate the inoculum, and when the mycorrhizal corn plants grew to 4 months, the mixture of mycorrhizal root segments and soil sand was fully mixed to prepare the mycorrhizal fungal inoculum for inoculation; Rhizophagus irregularis (2) The spores of G. heterosporum prepared in step (1) were separated and collected by wet sieving method and sucrose centrifugation method, and stored in a refrigerator at 4°C. The G. heterosporum spores were placed in 12-hole cell culture plates containing sterile water and placed in a dark incubator (25°C) to induce the germination of spores. After 7 days of culture, the germinated spores were collected in centrifuge tubes and used for Eucalyptus grandis root inoculation test.

[0070]

[0071] ​(3) The seeds of E. grandis were surface sterilized with 1% NaClO for 15 min, then washed with sterile water for 3 times, and then placed on 1 / 4 MS solid medium to germinate. The radicles (about 0.5 cm) were obtained after 3 days of germination in the dark (25°C). When the hypocotyls were fully expanded and two cotyledons appeared, the seedlings were transplanted into sterile quartz sand pots for acclimation test. After 14 days, the seedlings with the same growth state were transferred to separate pots. The seedlings were inoculated with P. irregularis, about 500 spores per plant, and 3 biological replicates were set for each treatment. The small climate conditions in the plant growth room were as follows: light cycle of 8 h at night, temperature of 19°C; 16 h at day, temperature of 24°C, light intensity of 100-200 Wm -2 The mycorrhizal samples were collected in batches at 7, 14, 21, 28, 35, 42 days after inoculation, and 3 plants were collected each time and stored at -80°C.

[0072] Example 2

[0073] The cDNA of the mycorrhizal samples collected at different times was prepared according to the example 2 of the literature "CN113528697A, early marker gene of P. irregularis mycorrhizal symbiosis and application thereof".

[0074] According to the base sequence, a specific primer (see Table 2) was designed in the transcriptome database of E. grandis, pC1300- EgARK1-F / pC1300-EgARK1-R The target fragment was amplified from the cDNA of E. grandis using high-fidelity enzyme, and the PCR product was purified and recovered by gel recovery kit (OMEGA, USA). The target fragment was connected and recombined into pCAMBIA1300 vector using homologous recombination ligase. The recombination product was transformed into E. coli DH5α, and the positive transformants were sequenced by Shanghai Sangon Biotech Co., Ltd. using sequencing primers pC1300- eGFP-seqR (see Table 2). Finally, a 1776 bp gene was amplified from the cDNA, named EgARK1 Gene, the nucleotide sequence of which is shown as SEQ ID NO: 1; the gene encodes 591 amino acids, and the amino acid sequence is shown as SEQ ID NO: 2, and the molecular weight is 66.21 kDa.

[0075] The specific primers of the target gene sequence were designed by real-time quantitative PCR primer design tool (https: / / sg.idtdna.com / scitools / Applications / RealTimePCR / ) (see Table 1), and the length of the amplification product was 70-150 bp. The cDNA was used as a template, and the qRT-PCR reagent ChamQ Univeral SYBR qPCR Master Mix (Vazyme, Nanjing, China) was used to detect the expression level of the target gene in the qRT-PCR instrument CFX Connect TM Real time PCR Detection System (Bio Rad, USA) according to the operation manual. The gene expression reaction was detected in three biological repeats, and the ubiquitin 3 (Ubiquitin 3, EgUBI3 ) was used as the internal reference gene of E. grandis; the RiEF1a gene was used as the internal reference gene of G. versiforme. The relative expression level of the related genes was calculated by the relative quantification 2 -ΔΔCt method. The PCR amplification program was as follows: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 10 s, 60℃ annealing for 30 s, plate reading, 39 cycles, detection of fluorescence signal after the end of each cycle, 95℃ denaturation for 5 s, and then melting curve analysis from 65-95℃ every 10 s increase by 0.5℃.

[0076] The results are shown in Figures 1-4 , and the results show that the E. grandis EgARK1 gene is highly expressed on the 35th day after inoculation of AM fungi (symbiotic period), and the E. grandis EgFatM gene, the E. grandis EgPT4 gene and the G. versiforme RiMST2 gene, which can be used as the marker gene of the symbiotic period of the E. grandis ectomycorrhizal symbiosis, also have the highest expression on the 35th day after inoculation, indicating that the E. grandis EgARK1 gene can be used as the marker gene of the symbiotic period of the E. grandis ectomycorrhizal symbiosis, and the detection of the expression level thereof can be used to judge whether the mycorrhizal plant inoculated with AM fungi has realized mycorrhizal or evaluate the potential mycorrhizal level.

[0077] Table 1 Primer sequences used in qRT-PCR of the application

[0078] Primer name Primer sequence (5'-3') GGATTCGTATAGAGATGCACAGG TGCCCTTTCTGTATCATTGTCG CAAACATCTGGCGTTGTCAC CTTGCTGTTTGTCTATGTGGC TGATCCTTTCCGCACTGTTC ATCCGCTTCTGGTTGTGTAG TCACCTACGTCTACCAGAAGG TCCTCGAAAGCTGTAAACATGG GGCAGGATATTTGTCTGATAG GCAATAACTCTTCCCGTATAC TGTTGCTTTCGTCCCAATATC GGTTTATCGGTAGGTCGAG

[0079] Table 2 Primers used for vector construction

[0080]

[0081] Note: The underlined part represents the sequence of the enzyme digestion site.

[0082] Example 3

[0083] Using virus-induced gene silencing (VIGS) technology, through... EgARK1 An RNAi silencing region (the sequence of which is shown as 1 to 200 bp in SEQ ID NO: 1) is designed at the 5' end of the gene relative to the translation start codon (ATG) +1 to +200 to target a specific region of the target gene, thereby avoiding off-target effects.

[0084] In the virus-induced gene silencing experiment, EgARK1 Specific cDNA fragments ( EgARK1 -RNAi, the primers used are VIGS-EgARK1-F / VIGS-EgARK1-F (Table 3) The expression vector pTRV2 was constructed into the VIGS expression vector, and the primers pTRV2-F / R (Table 3) were used to verify whether the expression was successful. EgARK1 A specific cDNA fragment was constructed into the vector pTRV2, and the constructed pTRV2- EgARK1 Vectors, pTRV1 empty vector, and pTRV2 empty vector were transformed into Agrobacterium tumefaciens GV3101, according to the order of pTRV1 and pTRV2, pTRV1 and pTRV2- EgARK1 Two treatment combinations were mixed at a 1:1 volume ratio to prepare Agrobacterium suspension. Infection experiments were then conducted on Eucalyptus macrocarpa seedlings. On days 1, 3, and 5, Agrobacterium suspension (1 mL / plant) was injected into the root-stem junction of the seedlings to enhance infection. Two weeks later, the seedlings were inoculated with the AM fungus *Rhizoctonia solani* (500 spores / plant) for culture. Whole plants were collected after 7 weeks for testing. EgARK1 Indicators such as gene silencing efficiency and mycorrhizal fungal infection rate; among them, VIGS-EV represents the pTRV2 empty vector treatment group, VIGS- EgARK1 -RNAi represents pTRV2- EgARK1 Vector treatment group. Results showed that, compared to gene-silenced plants, control plants had higher levels of [something] in their roots. EgARK1 The relative expression level of the gene was significantly increased. Figure 5 Compared with gene-silenced plants, the control plants had more intact arbuscular structure in their roots; compared with gene-silenced plants, the infection rate and arbuscular abundance in the roots of the control plants were significantly increased. Figure 6 Meanwhile, compared with gene-silenced plants, control plants showed a higher concentration of the eucalyptus AM symbiotic marker gene in their roots. EgFatM The relative expression level of the symbiotic marker gene of AM fungus *Heteromorpha heterocystis* was significantly increased in the roots of control plants. RiMST2 The relative expression level of the AM symbiotic marker gene in the roots of control plants was significantly increased. EgPT4 The relative expression level of [something] increased, but there was no significant difference.Figure 7 ). To further detect the biomass (plant height, aboveground fresh weight, root length and root fresh weight) and growth phenotype of the gene-silenced plants inoculated with AM fungus P. irregularis and the control plants. The results showed that the plant height, root length and root fresh weight of the control plants were significantly higher than those of the gene-silenced plants, and the aboveground fresh weight of the control plants was also increased, but there was no significant difference (P > 0.05) (Fig. 2). Figure 8 、 Figure 9 ).

[0085] Table 3 The present application EgARK1 Primer sequences for constructing virus-induced gene silencing vector

[0086]

[0087] Note: The underlined sequences represent enzyme digestion sites.

[0088] The above disclosed embodiments of the present application are only used to help explain the present application. The embodiments do not describe all the details, nor limit the present application to only the specific embodiments described. Obviously, more modifications and variations of the present application can be made in light of the contents of the specification. The present application selects and specifically describes these embodiments in order to better explain the principles and practical applications of the present application, so that those skilled in the art can better understand and utilize the present application. The present application is limited only by the claims and their full scope and equivalents.

[0089] The above embodiments are the preferred embodiments of the present application, but the embodiments of the present application are not limited by the above embodiments, and any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present application are equivalent replacement methods and are included in the protection scope of the present application.

Claims

1. EgARK1 Genes are characterized by: The EgARK1 The amino acid sequence encoded by the gene is shown in SEQ ID NO:

2.

2. As described in claim 1 EgARK1 Genes are characterized by: The EgARK1 The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

3. The claim 1 or 2 EgARK1 The application of genes as marker genes during the arbuscular mycorrhizal symbiosis of Eucalyptus grandis is characterized by: Eucalyptus has been inoculated with Rhizocystis heterophylla ( Rhizophagus irregularis ).

4. The application according to claim 3, characterized in that: The aforementioned EgARK1 Application of genes as marker genes in indicating arbuscular mycorrhizal symbiosis in Eucalyptus macrocarpa.

5. The claim 1 or 2 EgARK1 The application of genes in evaluating whether Eucalyptus macrocarpa inoculated with Rhizoctonia heterophylla can achieve mycorrhizalization is characterized by, EgARK1 High gene expression indicates that Eucalyptus macrocarpa, inoculated with Rhizophora heterophylla, has achieved mycorrhizalization.

6. The claim 1 or 2 EgARK1 The application of genes in the preparation of reagents for evaluating whether *Eucalyptus macrocarpa* inoculated with *Rhizoctonia solani* can achieve mycorrhizalization is characterized by, EgARK1 High gene expression indicates that Eucalyptus macrocarpa, inoculated with Rhizophora heterophylla, has achieved mycorrhizalization.

7. The application according to any one of claims 3 to 6, characterized in that: among them EgARK1 The sequences of the gene expression level-specific primers are as follows: EgARK1-qRT-F :5′-GGATTCGTATAGAGATGCACAGG-3′; EgARK1-qRT-R :5′-TGCCCTTTCTGTATCATTGTCG-3′。 8. The application according to any one of claims 3 to 6, characterized in that: Rhizocystis heteromorpha is Rhizocystis heteromorpha ( R. irregularis )DAOM 197198.

Images