Application of R2R3-MYB Transcription Factor CitMYB84 in Citrus in Enhancing Tolerance of Citrus to Huanglongbing

By overexpressing the R2R3-MYB transcription factor CitMYB84 in citrus, the problem of insufficient tolerance of citrus Huanglong disease was solved, and the CLas content was significantly reduced and the resistance of citrus to Huanglong disease was enhanced.

CN119351452BActive Publication Date: 2025-07-18GERMPLASM INNOVATION GRAND SCIENCE CENTER OF WESTERN CHINA (CHONGQING) SCIENCE CITY +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411606961.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-12
Publication Date
2025-07-18
Estimated Expiration
2044-11-12

AI Technical Summary

Technical Problem

There is a lack of effective methods in the prior art to enhance the tolerance of citrus to Huanglong disease. Citrus Huanglong disease is caused by Candidatus Liberibacter asiaticus (CLas), which leads to mottled yellowing of leaves, deformed fruits and decline in tree potential, seriously affecting economic benefits.

Method used

By overexpressing the R2R3-MYB transcription factor CitMYB84 in citrus, its nucleotide sequence is used as shown in SEQ ID NO.1 to improve the tolerance of the plant to Huanglong disease and reduce the CLas content.

Benefits of technology

CitMYB84 overexpression significantly reduces CLas content, enhances the tolerance of citrus to Huanglong disease, and lays the foundation for the study of stress resistance of citrus Huanglong disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119351452B_ABST
    Figure CN119351452B_ABST
Patent Text Reader

Abstract

The present invention provides the application of the R2R3-MYB transcription factor CitMYB84 in citrus in enhancing the tolerance of citrus to Huanglongbing, and the present invention belongs to the technical field of plant genetic engineering. The nucleotide sequence of CitMYB84 provided by the present invention is as shown in SEQ ID NO.1. The research results show that the R2R3-MYB transcription factor CitMYB84 is involved in the response of citrus to Huanglongbing stress, and overexpression of CitMYB84 can reduce the CLas content and enhance the disease tolerance of citrus to Huanglongbing.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and particularly to the application of the R2R3-MYB transcription factor CitMYB84 in citrus in enhancing the tolerance of citrus to Huanglongbing. Background Art

[0002] Huanglongbing (HLB) of citrus, also known as green fruit disease and yellow blight disease, is caused by a phloem-obligate Gram-negative bacterium, and the main pathogenic species is Candidatus Liberibacter asiaticus (CLas). After being infected by CLas, citrus shows mottled yellowing of leaves, raised leaf veins, deformed fruits, and tree vigor decline or even death, seriously affecting the economic benefits of citrus. Utilizing molecular breeding techniques to explore disease-resistant related genes and cultivate resistant germplasms is an important measure for the prevention and control of citrus Huanglongbing.

[0003] Regarding disease-resistant genes in the prior art, for example, the endolysin LasLYS1 / 2 of bacteriophage can enhance the disease tolerance of citrus to Huanglongbing; the antimicrobial peptide SAMPs can induce the innate immunity of plants and reduce the concentration of CLas; the salicylic acid binding protein 2 (SABP2) gene increases the disease tolerance of citrus to Huanglongbing; the salicylic acid methyltransferase (CsSAMT1) enhances the signal communication between salicylic acid and methyl salicylate, activates the plant defense response, and enhances the resistance of citrus to Huanglongbing; the NPR binds to the CsTGA2 transcription factor, upregulates the salicylic acid-mediated PR genes, activates the systemic acquired resistance of the host, and enhances the resistance of transgenic plants to Huanglongbing. In addition, it has also been found that the CsMYB transcription factor in citrus shows differential expression with the infection period of CLas; based on this, we speculate that the R2R3-MYB transcription factor may also be involved in the defense response process of citrus against Huanglongbing bacteria.

[0004] As the largest subfamily of MYB transcription factors, R2R3-MYB is the most abundant and functional MYB protein in plants. A large number of R2R3-MYB transcription factors have been identified and isolated in plants such as Arabidopsis thaliana (more than 126 genes), Oryza sativa (110 genes), and Zea mays (more than 157 genes); 101 R2R3-MYB genes have also been identified in the genome of Citrus sinensis. R2R3-MYB is involved in the response of plants to biotic stress and regulates plant resistance. AcMYB16 acts as an inhibitor to reduce the resistance of kiwifruit to Pseudomonas syringae pv. actinidiae; MdMYB73 in apples enhances the resistance to Botryosphaeria dothidea through the salicylic acid pathway; TaMYB391 and TaMYB29 positively regulate HR-related genes and enhance the resistance of wheat to stripe rust; CsMYB96 enhances the resistance of citrus to fungal pathogens through the salicylic acid regulation pathway and the accumulation of defense metabolites; CitMYB20 can weaken the symptoms of citrus canker to a certain extent, and a differentially expressed R2R3-MYB transcription factor CitMYB84 gene was found in the transcriptome of citrus infected with CLas. Therefore, the present study aims to analyze the function of the CitMYB84 gene under the stress of citrus Huanglongbing, evaluate the resistance of citrus to Huanglongbing by overexpressing the CitMYB84 gene in citrus, clarify the role of CitMYB84 in the resistance of citrus to Huanglongbing, and lay a foundation for the study of the stress resistance of R2R3-MYB transcription factors in citrus Huanglongbing. Summary of the Invention

[0005] The object of the present invention is to clarify the role of the R2R3-MYB transcription factor CitMYB84 in citrus in enhancing the tolerance of citrus to Huanglongbing, and lay a foundation for the study of the stress resistance of citrus Huanglongbing.

[0006] In order to achieve the above object of the invention, the present invention provides the following technical solutions:

[0007] Application of the R2R3-MYB transcription factor CitMYB84 in citrus in enhancing the tolerance of citrus to Huanglongbing, wherein the nucleotide sequence of CitMYB84 is as shown in SEQ ID NO.1.

[0008] Preferably, the CDS sequence of CitMYB84 is as shown in SEQ ID NO.2.

[0009] Preferably, the amino acid sequence encoded by the CDS sequence of CitMYB84 is as shown in SEQ ID NO.3.

[0010] Preferably, overexpression of the CitMYB84 gene or protein in citrus improves the tolerance of the plant to Huanglongbing.

[0011] The present invention also provides an application of an expression vector in enhancing the tolerance of citrus to Huanglongbing. The expression vector carries the gene CitMYB84, and the CDS sequence of CitMYB84 is shown in SEQ ID NO.2. Overexpression of the expression vector carrying CitMYB84 in citrus can improve the tolerance of the plant to Huanglongbing.

[0012] The present invention clarifies that the R2R3-MYB type transcription factor CitMYB84 is involved in the response of citrus to Huanglongbing stress. Overexpression of CitMYB84 can reduce the content of CLas and enhance the disease tolerance of citrus to Huanglongbing. Brief Description of the Drawings

[0013] Figure 1 It is the basic structure of the CitMYB84 transcription factor in Example 1;

[0014] Figure 2 It is the phylogenetic tree and Motif analysis of the amino acid sequence of the homologous protein with Arabidopsis thaliana in Example 1;

[0015] Figure 3 They are the conserved motifs of Motif1, Motif2, Motif3, Motif4 and Motif5 in Example 1;

[0016] Figure 4 It is the cis-acting element analysis of the promoter in Example 1. The abscissa is the element position, from -2000bp to 0bp (ATG), and the graphic label number is the number of elements in the interval;

[0017] Figure 5 It is the expression analysis of the CitMYB84 gene in Example 2. A: The relative expression levels of CitMYB84 in different tissues, Root root, Stem stem, Leaf leaf; B: The relative expression levels of CitMYB84 after 48h of treatment with 4 hormones, H2O as the control, ABA abscisic acid, ETH ethephon, MeJA methyl jasmonate, SA salicylic acid; C: Detection of the content of CLas in Ziyang Xiangcheng by Taqman probe method, Control healthy leaf, CLas diseased leaf; D: The relative expression level of CitMYB84 induced by CLas.

[0018] Figure 6 It is the subcellular localization analysis of CitMYB84 in Example 3. pCV-3HA-GFP is the empty vector control, and pCV-CitMYB84:GFP is the fusion expression vector; The fusion of histone H2B and red fluorescent protein RFP is the nuclear marker gene.

[0019] Figure 7 It is the schematic diagram of the overexpression vector in Example 4;

[0020] Figure 8 It is the relative expression level of CitMYB84 in the transgenic hairy roots of healthy Ziyang sweet orange in Example 4;

[0021] Figure 9 It is the PCR detection and phenotype of the transgenic hairy roots of the disease-susceptible Ziyang sweet orange in Example 4. A: Identification of pLGN positive roots; M: MarkerⅢ; CK-: Water control; P: pLGN plasmid, P#: pLGN hairy roots; B: Identification of pLGN-CitMYB84 hairy roots, M: MarkerⅢ; CK-: Water control; CK+: pLGN-CitMYB84 plasmid; OE#: Transgenic hairy roots; C-D: Phenotype of the hairy roots of the disease-susceptible Ziyang sweet orange, Leaf-CLas: Bacteria-carrying leaves of the disease-susceptible plants, GUS-: Negative roots with GUS staining results; GUS+: Positive roots with GUS staining results. 4 MAI: 4 months after infection;

[0022] Figure 10 It is the CLas content in the transgenic hairy roots in Example 4. Detailed implementation manners

[0023] The technical solutions provided by the present invention will be described in detail below in conjunction with the embodiments, but they cannot be construed as limiting the protection scope of the present invention.

[0024] Example 1

[0025] The experiment was completed at the Citrus Research Institute of Southwest University from May 2023 to June 2024. Citrus materials such as Jincheng orange and Ziyang sweet orange are stored in the greenhouse of the National Citrus Variety Improvement Center. The primers used in the experiment are shown in Table 1.

[0026] Table 1 Primers used in the experiment

[0027]

[0028] 1.1 Bioinformatics analysis

[0029] In this experiment, relevant information about CitMYB84 (Cs_ont_3g004630.1) was obtained from the citrus database CPBD of Huazhong Agricultural University: gene sequence, CDS, and promoter sequence; bioinformatics analysis of CitMYB84 was performed through online websites; PlantCARE was used to predict the cis-acting elements of the CitMYB84 promoter; conserved motif and gene structure analysis were carried out through MEME (MEME-Submission form (meme-suite.org)) and GSDS2.0 (Gene Structure Display Server 2.0 (gao-lab.org)); the conserved domain of the protein was predicted using CDD in the NCBI website (Search: CDD-NLM (nih.gov)); the physicochemical properties and hydrophilicity of the protein were predicted using the ProtParam and ProtScale tools on the ExPASy website (https: / / web.expasy.org / ); the secondary structure of the CitMYB84 protein was predicted through SOPMA (https: / / npsa-prabi.ibcp.fr / cgibin / npsa_automat.pl?page= / NPSA / npsa_sopma.html); subcellular localization prediction analysis of the sequence was performed using wolfpsort (https: / / wolfpsort.hgc.jp / ); the Arabidopsis thaliana homologous gene of CitMYB84 was obtained through Phytozome (Phytozome (doe.gov)). Visualization analysis was carried out using TBtools and the IBS2.0 website.

[0030] 1.2 Analysis Results

[0031] 1.2.1 Physicochemical Properties and Secondary Structure Analysis of CitMYB84

[0032] CitMYB84 is located between 2,888,320 bp and 2,890,235 bp on chromosome 3 of citrus. The full length of the gene is 1460 bp (SEQ ID NO.1), which contains two UTR regions and one exon, without an intron region. The length of the open reading frame is 765 bp (SEQ ID NO.2) ( Figure 1)。The protein encoded by CitMYB84 consists of 254 amino acids (SEQ ID NO.3), with a molecular weight of 28.05 kDa, a theoretical isoelectric point of 8.75, a lipophilicity index of 59.21, an instability coefficient of 64.24, and a hydrophilicity index (GRAVY) that is negative, indicating that the CitMYB84 protein is an unstable hydrophilic protein (Table 2). There are two R structures at the N-terminus of the CitMYB84 protein, which form the Myb-like DNA-binding domain and are R2R3-MYB class transcription factors; the first spacer sequence in the second R structure (R3) of the CitMYB84 protein is replaced by phenylalanine (F) Figure 1 )。The secondary structure of the CitMYB84 protein is mainly composed of α-helices (29.53%) and random coils (68.50%), as well as a small part of extended strands (1.97%) (Table 3). Each R structure consists of 3 α-helices, and there is a loop between the last two α-helices, forming an HLH motif for recognizing specific target genes and regulating their transcription.

[0033] Table 2 Physicochemical properties of the protein encoded by CitMYB84

[0034]

[0035]

[0036] Table 3 Prediction of the secondary structure of the CitMYB84 protein

[0037]

[0038] CitMYB84 (gene: 1460bp) SEQ ID NO.1

[0039]

[0040] CitMYB84-Cs_ont_3g004630.1 (CDS: 765bp) SEQ ID NO.2

[0041] ATGGAAGCGTGTTCTTATTCTTCAACTTCATCTTCTGAATCATCGTCTTCAGAGTCATCTTTATCTGGTAATAATAAAACTCGAAGAGCGACCCATAAACCCGAGAGGATTAAAGGTCCGTGGAGTGCTGAAGAAGACAGGATATTGACCAGGCTTGTCGAACGATATGGACCAAGAAACTGGTCTCTTATAAGCCGGTATATTAAGGGAAGGTCTGGGAAATCATGCAGGCTGAGGTGGTGTAACCAGTTGAGCCCGAGTGTCGCACACAGGCCATTTTCTCCAGCTGAGGACGACACCATCTTGGCCGCCCATGCTCGATTCGGGAACCGCTGGGCCACCATTGCCCGACTGCTACCTGGCCGGACCGATAATGCGGTAAAAAATCACTGGAACTCCACGTTGAAGCGAAGAACCAGAGAGCATCCAGTCCAAATGCAACCCCACCAACAACAACAATTAATGGATTCTGTTGATAATGGTGGCGATAACAATAATGATAATGAAAATATTGGACTCGGAGGTTTTGCTGTTTCGGGATCTCATCATCAGCAGCAGCAGTGCATGGGATTGGAAGATGACGCATTGACCGCTTTGACTCTGGGGCCGCCGGGAGGTAGTAGTAGTATCAATATTAATGATAGTAGTGCGGAGAGGACGGAGAGTTTACCGGCGGGGTTTTGGGATGCGATGAGGGGTGTGATAGCACGGGAAGTGAGGGACTATATGAGTTCAACATTGTCCGGAACTTCAGGGTTTCATTAG

[0042] CitMYB84 (aa: 254aa) SEQ ID NO.3

[0043] MEACSYSSTSSSESSSSESSLSGNNKTRRATHKPERIKGPWSAEEDRILTRLVERYGPRNWSLISRYIKGRSGKSCRLRWCNQLSPSVAHRPFSPAEDDTILAAHARFGNRWATIARLLPGRTDNAVKNHWNSTLKRRTREHPVQMQPHQQQQLMDSVDNGGDNNNDNENIGLGGFAVSGSHHQQQQCMGLEDDALTALTLGPPGGSSSININDSSAERTESLPAGFWDAMRGVIAREVRDYMSSTLSGTSGFH

[0044] 1.2.2 Phylogenetic tree of the amino acid sequences of homologous proteins of CitMYB84 from citrus and Arabidopsis

[0045] Citrus CitMYB84 is homologous to the Arabidopsis AtMYB70, AtMYB73, AtMYB77, and AtMYB44 genes, with a consistency of 63.66% - 77.88%, and has 4 identical conserved structures, but lacks Motif3; among them, the Motif2 and Motif 1 conserved motif sequences are located in the DNA-binding domain of the MYB gene, that is, the R structural region ( Figure 2 、 Figure 3 ).

[0046] 1.2.3 Analysis of cis-acting elements in the CitMYB84 promoter

[0047] Cis-acting element analysis was performed on the CitMYB84 promoter sequence (2000 bp upstream of the start codon ATG) ( Figure 4 ). In addition to the core elements of the CAAT-box and TATA-box promoter structures, and 11 light-responsive elements in the CitMYB84 promoter; it also has MYBHv1 binding sites (CCAAT-box), MYB binding sites, and MYC binding sites; in addition, it contains hormone-responsive elements: 3 salicylic acid-responsive elements (TCA-element), 3 abscisic acid-responsive elements (ABRE), and 2 methyl jasmonate-responsive elements (CGTCA-motif / TGACG-motif); as well as elements related to abiotic stress responses, MYC, ARE, and WUN-motif, which may respond to drought, freezing damage, anaerobic induction, and damage. Analysis of the potential pathogen-induced response elements in the CitMYB84 promoter found 48 dofbox, 11 Wbox, and 1 GT1 box, a total of 60 pathogen-induced response elements.

[0048] Example 2

[0049] 2.1 Expression of CitMYB84 in Different Tissues of Citrus

[0050] Roots (root), stems (stem), and leaves (leaf) of Jincheng oranges were used for tissue-specific analysis. The results showed that the relative expression level of CitMYB84 was the highest in roots, followed by leaves and stems; the relative expression level of CitMYB84 in roots was 2.7 times that in stems, and there were significant differences in relative expression levels ( Figure 5 A).

[0051] 2.2 Analysis of Induced Expression of CitMYB84 by Exogenous Hormones

[0052] Abscisic acid (ABA), methyl jasmonate (MeJA), ethylene (ETH), and salicylic acid (SA) are exogenous hormones related to plant defense responses. Using water treatment as a control, the gene expression was analyzed after treating Jincheng orange leaf discs with 4 kinds of hormones for 48 h.

[0053] The specific steps were as follows: Jincheng orange leaves were punched into leaf discs with a diameter of 0.5 cm, and the leaf discs were soaked in ethylene (10 μM), salicylic acid (10 μM), methyl jasmonate (100 μM), abscisic acid (100 μM), and sterile water respectively for 48 hours, with 3 biological replicates for each treatment; real-time fluorescence quantitative PCR was performed to detect the relative expression level of the gene under hormone treatment.

[0054] The results showed that the CitMYB84 gene was sensitive to all 4 hormones after 48 h of treatment, showing a significant down-regulation. Compared with water treatment, the relative expression level of CitMYB84 was down-regulated by 3.76 times under ABA treatment, 5.12 times under ETH treatment, 2.99 times under MeJA treatment, and 4.21 times under SA treatment ( Figure 5 B). It can be seen from this that the expression of the CitMYB84 gene is inhibited by exogenous hormones ABA, MeJA, ETH, and SA.

[0055] 2.3 Expression of CitMYB84 Induced by CLas

[0056] To detect the content of pathogens in leaf veins, healthy and CLas-infected Ziyang Xiangcheng orange samples were used. RNA was extracted from their mesophyll tissues respectively, and real-time fluorescence quantitative PCR was performed to analyze the expression of CitMYB84.

[0057] The results showed that taking the leaves without detected CLas as a healthy control (Control), the pathogen concentration in the infected leaves (CLas) was 10^4.61 CLas cells / μg of citrus DNA( Figure 5C); According to the relative expression analysis, it can be seen that CitMYB84 is significantly up-regulated by CLas induction. Compared with the healthy control, the expression level of CitMYB84 is up-regulated 7.85 times under CLas induction ( Figure 5 D). From the above results, it can be obtained that the CitMYB84 gene is involved in the stress response of citrus to Huanglongbing.

[0058] Example 3

[0059] Subcellular localization analysis

[0060] To explore the expression location of the CitMYB84 protein in cells, a pCV-CitMYB84:GFP fusion expression vector was constructed, transformed into tobacco leaf epidermal cells, and the expression of the fusion protein was observed under a confocal microscope at 40 times magnification.

[0061] The subcellular localization analysis of the CitMYB84 protein was carried out by transient injection into tobacco epidermal cells. The specific steps were as follows: Using the TaKaRa (Takara Bio—Home) primer design tool, homologous recombination primers pCV-MYB84-f / r for the fusion expression of CitMYB84 and pCV-3HA-GFP were designed (see Table 1), and the restriction enzyme site was SalⅠ; The pLGN-CitMYB84 Escherichia coli plasmid was used as a template for amplification, and the gel recovery product was subjected to homologous recombination with the linear subcellular localization vector pCV-3HA-GFP. The homologous recombination system was 10 μL: 4 μL of 2.5×GM-Uni-buffer and 1 μL of EM-Uni enhancer, 1-2 μL of the linear vector, 1 μL of the recovered product, and 2-3 μL of enzyme-free water; The condition was 50 °C for 30 min. The homologous product was immediately transferred into competent Escherichia coli DH5α, verified by sequencing, and the pCV-CitMYB84:GFP fusion expression vector was successfully constructed; It was transferred into Agrobacterium tumefaciens GV3101 and transiently transformed into tobacco epidermal cells. Three days after transformation, the protein expression was observed under a laser confocal microscope. The maximum excitation wavelength of GFP was 514 nm, and the maximum emission wavelength was 527 nm.

[0062] The results showed that the green fluorescence signal of the CitMYB84:GFP fusion protein completely overlapped with the red fluorescence signal of the nuclear marker H2B, indicating that the protein was localized in the nucleus and functioned therein ( Figure 6 ).

[0063] Example 4

[0064] Agrobacterium rhizogenes-mediated transformation of citrus stem segments

[0065] 4.1 Construction of the CitMYB84 overexpression vector

[0066] Using the cDNA of late Jincheng orange leaves as a template, the open reading frame of CitMYB84 was cloned with the high-fidelity enzyme 2×phantaMax Master Mix and the primers CitMYB84-f / r (see Table 1). The cloning product was obtained under the conditions of 94°C for 3 min, 94°C for 30 s, Tm = 56 - 58°C for 30 s, 72°C for 1 min, 32 cycles, and 72°C for 3 min. Poly(A) tails were added. The PCR products recovered by gel were ligated with the T vector, and then transformed into Escherichia coli competent cells DH5α. After picking single colonies for verification, the sequencing was performed by Tsingke Biotechnology Company. The T vector of CitMYB84 and the plant binary expression vector pLGN were double-digested with the restriction enzymes BamHI and SalⅠ. The digested products were recovered by gel and ligated at 16°C for 6 - 10 h. The ligation product pLGN-CitMYB84 was transformed into the competent Escherichia coli DH5α, and then verified by sequencing. The expression vector pLGN-CitMYB84 was successfully obtained ( Figure 7 ).

[0067] 4.2 Agrobacterium rhizogenes-mediated transformation of citrus

[0068] The constructed overexpression vector pLGN-CitMYB84 of CitMYB84 was transferred into the healthy and diseased stem segments of Ziyang Xiangcheng orange by Agrobacterium rhizogenes. GUS staining and PCR were performed to identify transgenic hairy roots after 4 months, and DNA and RNA were extracted for CLas concentration detection and relative gene expression analysis.

[0069] The specific steps were as follows: The pLGN empty control and the pLGN-CitMYB84 expression vector were transferred into Agrobacterium rhizogenes K599. Single colonies were taken and cultured in a culture medium (LK) containing kanamycin sulfate (Km) until the absorbance 600 A = 0.6 - 0.8. After centrifugation and resuspension, the MS nutrient solution (without sucrose) was used as the resuspension solution. The plant materials were the healthy and CLas-infected stem segments of Ziyang Xiangcheng orange. The lower ends of the stem segments were immersed in the resuspended bacterial solution and vacuum-infected for 30 min. The stem segments were inserted into vermiculite and cultured in an incubator at 25°C with a photoperiod of 16 h / d. The hairy roots were identified after 4 months.

[0070] Rooting rate = (number of rooted stem segments / total number of stem segments) × 100%

[0071] Positive rate = (number of GUS + positive roots / total number of hairy roots) × 100%

[0072] The results showed that positive roots were initially screened out by GUS staining; the rooting rate was between 90.48% and 100%; among the healthy Ziyang sweet orange materials, the GUS positive rate of the hairy roots in the pLGN group was 27.5%, and the GUS positive rate of the transgenic hairy roots in the pLGN-CitMYB84 group was 29.85%; among the diseased Ziyang sweet orange materials, the positive rate of the hairy roots in the pLGN group was 18.26%, and the positive rate of the transgenic hairy roots in the pLGN-CitMYB84 group was 22.77% (Table 4). The overexpression of CitMYB84 had no effect on the growth of hairy roots. The transgenic hairy roots germinated from the same stem segment were mixed and sampled, and the hairy roots of healthy Ziyang sweet orange were selected for the relative expression analysis of CitMYB84, and the hairy roots of diseased Ziyang sweet orange were selected for the detection of pathogen content.

[0073] Table 4 Statistics of transgenic hairy roots

[0074]

[0075] Among the hairy roots of healthy Ziyang sweet orange, the hairy roots with positive GUS detection were selected. 7 samples were selected for the pLGN empty vector, and 6 samples were selected for pLGN-CitMYB84 to detect the relative expression of CitMYB84. Take 50 - 100 mg of plant tissue and put it into a 1.5 mL RNase-free centrifuge tube, add 2 mm steel beads, and grind it into powder using the liquid nitrogen grinding method. Extract the plant DNA and RNA according to the instructions of the new plant genomic DNA rapid extraction kit and the EASYspin plant RNA rapid extraction kit. Both kits were purchased from Aidlab Biotechnologies Co., Ltd.

[0076] Using 1000 ng of RNA as a template, use the PrimeScritTM RT Master Mix (Perfect Real Time) reverse transcription reagent from TaKaRa Company to synthesize cDNA at 37°C for 30 min, and inactivate the reverse transcriptase at 85°C for 5 s.

[0077] The reaction system of real-time fluorescence quantitative PCR is 12 μL: 2×SP qPCR Mix 6 μL, 0.3 μL of each upstream and downstream primer, 3.4 μL of ddH2O, and 2 μL of cDNA (10 ng / μL) template; reaction conditions: 50°C for 60 s; 95°C for 120 s; 95°C for 5 s, 60°C for 15 s, 40 cycles. Using Actin as the internal reference gene, adopt 2 -ΔΔct Calculate the relative expression of the target gene.

[0078] The Taqman probe method was used to detect the content of pathogenic bacteria; reaction system: 2×Multiplex Fast Probe Mix (UNG) 10 μL, HLBasf / r (10 μM) 0.4 μL each, HLBp (5 μM) 0.2 μL, DNA (10 ng / μL) 2 μL, and finally filled with RNaseFree H2O to make the system up to 20 μL; reaction conditions: UNG enzyme treatment at 50 °C for 5 min, pre-denaturation at 95 °C for 3 min; denaturation at 95 °C for 15 s, annealing-extension at 60 °C for 30 s, 40 cycles. Using A = CLas cells / μg of citrus DNA = 10^y / m, y = 12.715 - 0.3264x, m = 0.02 μg, (x is the Cq value), the relative content of CLas is presented as Log10(A).

[0079] 4.3 Statistical analysis

[0080] Data were sorted out using Excel 2021; data plotting was performed using GraphPad Prism 8.0.2 software, and the t-test (P < 0.05) was used to statistically analyze the significance of differences, "*" for P < 0.05, "**" for P < 0.01, and "***" for P < 0.001.

[0081] 4.4 Result analysis

[0082] 4.4.1 Expression analysis of CitMYB84 in hairy roots

[0083] The results showed that compared with pLGN, the expression level of CitMYB84 in transgenic hairy roots was significantly up-regulated, with an up-regulation of 16.65 - 105.58 times. Therefore, in the transgenic hairy roots with positive GUS detection, the CitMYB84 gene was successfully up-regulated ( Figure 8 ).

[0084] 4.4.2 Overexpression of CitMYB84 inhibits the proliferation of pathogenic bacteria

[0085] Figure 9 As shown, in the infected Ziyang sweet orange group, 7 samples were screened as the control group with pLGN empty vector, namely P1, P2, P7, P8, P9, P11, and P14; 4 samples were screened from the transgenic hairy roots with overexpression of CitMYB84, namely OE4, OE14, OE17, and OE19, for PCR detection, phenotype observation, and detection of the content of pathogenic bacteria using the Taqman method.

[0086] Figure 10As shown in the figure, statistical analysis of 7 samples in the pLGN group found that there was no significant difference in the CLas content in GUS-positive hairy roots compared with that in the midrib of leaves and GUS-negative hairy roots. In the 5 samples of the pLGN-CitMYB84 group, the CLas content in GUS-positive hairy roots was not only significantly lower than that in the midrib of leaves, but also significantly lower than that in GUS-negative hairy roots. Moreover, due to the overexpression of CitMYB84 in GUS-positive hairy roots of the pLGN-CitMYB84 group, the pathogen content was significantly lower than that in GUS-positive hairy roots of the pLGN group, and the pathogen content was 69.82% of that in GUS-positive roots of the pLGN group.

[0087] In summary, the citrus R2R3-MYB transcription factor CitMYB84 is closely related to the defense against citrus huanglongbing. The overexpression of CitMYB84 significantly reduces the CLas content and improves the tolerance to citrus huanglongbing, laying a foundation for the application of R2R3-MYB transcription factors in the creation of citrus huanglongbing-resistant germplasms.

[0088] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. Application of R2R3-MYB transcription factor in citrus in enhancing tolerance of citrus to huanglongbing, characterized in that CitMYB84 The said CitMYB84 has a nucleotide sequence as shown in SEQ ID NO.

1. ​ 2. The application according to claim 1, characterized in that, The CitMYB84 gene or protein overexpressed in citrus can improve the tolerance of the plant to huanglongbing.

3. Use of an expression vector in enhancing the tolerance of citrus to Huanglongbing, characterized in that, The expression vector carries a gene CitMYB84, The CitMYB84 CDS sequence is shown in SEQ ID NO.2, and the expression vector carrying the gene CitMYB84 overexpressed in citrus can improve the tolerance of the plant to Huanglongbing.

Citation Information

Patent Citations

  • Method for improving citrus liberobacter asiaticum resistance by regulating and controlling citrus ubiquitination pathway through citrus RUB2

    CN116410988A

  • Real time detection and quantitation of plant innate immunity response using raman spectroscopy

    US20240344991A1