PEI40000-based method for promoting transient overexpression of fish in-vitro gene and application of PEI40000-based method for promoting transient overexpression of fish in-vitro gene in enhancing protection rate of fish hemorrhagic disease virus DNA vaccine

Abstract

The invention belongs to the field of biological medicine, and provides a method for promoting transient overexpression of a fish in-vitro gene based on PEI40000 and application of the PEI40000 in enhancing the protection rate of a fish hemorrhagic disease virus DNA vaccine. The PEI40000 reagent provided by the invention is convenient to store and stable in property; the preparation and application operations are simple and convenient, and the polypeptide can be directly added into a serum-containing culture medium; the kit is high in cost performance and suitable for large-scale transfection experiments; the invention verifies that the method obviously promotes the expression of exogenous plasmids in fish bodies, and the expression time of the exogenous plasmids is enabled to have a relatively high overexpression level within 1-10 days; the application also defines that the protection effect of the fish hemorrhagic disease virus DNA vaccine is obviously enhanced, the survival rate of diseased fish is obviously improved, the effect is more obvious than that of a common adjuvant in the prior art, or the adjuvant can become an effective adjuvant of various DNA vaccines, and the application prospect is wide.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine, relates to a method for promoting transient overexpression of exogenous genes outside fish based on PEI40000, and also relates to the application of PEI40000 in enhancing the protection rate of fish hemorrhagic disease virus DNA vaccine. Background Art

[0002] Due to the rapid development of fish farming, the corresponding viral and bacterial diseases are becoming increasingly serious. It is well known that vaccines are the best means of bacterial and viral prevention and control. However, the development of fish vaccines is far less rapid than that of mammalian vaccines. In production and application, efficient, safe and economical fish vaccines are relatively rare. DNA vaccines are a new type of vaccine that directly injects genes encoding pathogen antigen proteins into the host and uses the host cell expression system to produce antigen proteins, thereby stimulating immune responses. Compared with traditional vaccines, DNA vaccines have the advantages of low production cost, good stability, easy storage and transportation, and long-lasting immune effects. The main challenge of DNA vaccines is to improve their immunogenicity, because the expression level of naked DNA in the body may be low. In practical applications, the immune response can be enhanced by improving the transfection efficiency of DNA or combining it with molecular adjuvants (such as CpG ODNs). Research on DNA vaccines is constantly progressing, including optimizing the expression of antigen genes, using different delivery systems (such as nanoparticles, microspheres), and developing new molecular adjuvants.

[0003] SVCV (Spring Carp Viremia Virus) is a virus that poses a serious threat to carp fish. It can cause an acute, highly lethal infectious disease, causing huge economic losses to the aquaculture industry. The virus is widely spread in Europe, America, and Asia, and has been listed as a notifiable disease by the World Organization for Animal Health (OIE). Fish infected with SVCV can show bleeding, organ damage, and high mortality. The virus is transmitted through water, bait, and direct contact with fish. The viral genome is about 11,000 bp long and contains 5 major open reading frames (ORFs), which encode 5 structural proteins: nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G), and RNA polymerase (L). Grass carp hemorrhagic disease is a viral infectious disease that seriously harms freshwater fish such as grass carp (Ctenopharyngodonidellus) and black carp (Mylopharyngodonpiceus). Clinically, it is characterized by one or more symptoms, including red fins, red gills, red intestines, and / or red muscles. Grass carp reovirus (GCRV) has been identified as the causative strain of grass carp hemorrhagic disease, which has caused great damage to the aquaculture industry in southern my country. At present, at least 26 GCRV strains have been isolated from different regions of China and divided into three groups based on genomic and biological characteristics.

[0004] As we all know, vaccines are a common and efficient means of controlling viral diseases. In recent years, in order to cope with the severe situation of huge economic losses caused by viruses to aquaculture, scholars at home and abroad have developed many vaccines for the prevention and control of fish viral diseases. Among them, some progress has also been made in the research and development of fish hemorrhagic virus vaccines. For example, the G protein of SVCV was successfully expressed using a prokaryotic expression system, and specific monoclonal antibodies were prepared. These monoclonal antibodies have the characteristics of strong specificity and high sensitivity, and can be used to develop various diagnostic reagents, providing tools for the establishment of new SVCV immunological diagnostic methods. GCRV inactivated vaccines have also been put into use. However, although these vaccines against fish hemorrhagic viruses have been developed, these vaccines have not been widely accepted and used due to their protection rate and safety issues.

[0005] Polyethyleneimine (PEI) can be used as a non-viral synthetic polymer carrier for the in vivo delivery of therapeutic nucleic acids. It has been verified that linear PEI transfection reagents are widely applicable to a variety of cell lines including HEK-293, HEK293T, CHO-K1, COS-1, COS-7, NIH / 3T3, Sf9, HepG2 and Hela cells, with a transfection efficiency of up to 80%-90%. Linear polyethyleneimine 40000 (PEI40000) is a highly charged cationic polymer with a molecular weight of 40,000, which easily binds to negatively charged nucleic acid molecules to form a complex and allows the complex to enter the cell. Compared with the common PEI25000, PEI40000 has many advantages, including: PEI40000 is easier to dissolve and can be dissolved directly in water, while PEI 25000 needs to be diluted in water to a weak acid to help it dissolve, and then the pH is adjusted to neutral with NaOH; PEI40000 is easy to operate, easier to use, and has better transfection effect than PEI25000; PEI25000 contains 4-11% propionyl residues, which can prevent the polymer main chain from binding to DNA; compared with PEI25000, PEI40000 is a completely detached structure, so its performance is always efficient and consistent. However, there is currently little research on its application in vaccine development, especially it has not been used in DNA vaccine research for fish viruses.

[0006] Improving the immune efficiency of DNA vaccines is the key to the development of DNA vaccines. On the one hand, the immunogenicity of DNA sequences can be improved as much as possible by continuously screening them; on the other hand, the vaccine delivery capacity can be improved; and vaccine adjuvants can be used to improve the protection rate of vaccines. Among them, cytokines such as interleukins (IL-2, IL-4, IL-5, IL-7, IL-12), interferons (IFN), and granulocyte-macrophage colony stimulating factor (GM-CSF) have immune adjuvant effects. Selecting suitable cytokines as adjuvants for nucleic acid vaccines can effectively improve the immune effect. Liposome adjuvants and nanoadjuvants have also been shown to significantly enhance the immunity of DNA vaccines. Here we discovered for the first time that PEI40000 can be used as an additive to significantly improve the protection efficiency of viral vaccines. Summary of the invention

[0007] The first object of the present invention is to provide a method for promoting transient overexpression of exogenous genes in fish based on PEI40000.

[0008] In order to achieve the above object, the present invention adopts the following technical scheme: using PEI40000 reagent to encapsulate the exogenous plasmid and injecting it into the fish body to achieve transient overexpression; the specific steps are:

[0009] 1) Prepare PEI40000 stock solution

[0010] Dissolve PEI40000 in ultrapure water at room temperature, adjust the pH of the obtained PEI40000 aqueous solution to 6.5-7.0 with sodium hydroxide solution, filter and dilute to a PEI40000 mother solution with a PEI40000 concentration of 0.5-1.2 mg / mL, and store at 2-6°C after aliquoting;

[0011] 2) Preparation of PEI40000 reagent

[0012] 1-6 μL of the PEI40000 mother solution obtained in step 1) is diluted to 50 μL with a PBS solution having a pH of 7.2-7.4 to obtain a PEI40000 reagent having a PEI40000 concentration of 0.006-0.042 μg / μL;

[0013] 3) Preparation of exogenous plasmid reagents

[0014] Mix one or more exogenous target genes with a PBS solution having a pH of 7.2-7.4 to obtain an exogenous plasmid reagent;

[0015] 4) Promote expression

[0016] The PEI40000 reagent from step 2) is mixed with the exogenous plasmid reagent prepared from step 3), and injected into the fish body through the peritoneal cavity or muscle. Feeding begins 12 hours after injection, and a significant effect of promoting overexpression is produced 1-10 days after injection.

[0017] As a preferred embodiment of the present invention, the exogenous target gene includes TBK1 (TANK binding kinase 1) and / or IRF5 (interferon regulatory factor 5).

[0018] Preferably, the injection method includes intraperitoneal injection and intramuscular injection.

[0019] Preferably, the pH of the PEI40000 aqueous solution is adjusted to 6.8 using a sodium hydroxide (0.5-2 mol / L) solution.

[0020] Preferably, the PEI40000 aqueous solution is filtered using a 0.1-0.45 μm syringe filter.

[0021] Preferably, the PEI40000 aqueous solution is stored at 2-6°C when the concentration is 0.5-1.2 mg / mL.

[0022] Preferably, the ratio of fish body to exogenous plasmid reagent is 1 g: 0.5 μg to 1 μg.

[0023] Preferably, the ratio of the exogenous plasmid reagent to PEI40000 is 1 μg: 1 μg to 3 μg.

[0024] Another object of the present invention is to provide an application of PEI40000 in enhancing the protection rate of fish hemorrhagic disease virus DNA vaccine; comprising the following steps:

[0025] 1) Prepare PEI40000 stock solution

[0026] Dissolve PEI40000 in ultrapure water at room temperature, adjust the pH of the obtained PEI40000 aqueous solution to 6.8 with sodium hydroxide solution, filter with a 0.1-0.45 μm syringe filter, and then adjust the volume to a PEI40000 mother solution with a PEI40000 concentration of 1 mg / mL, and store at 2-6°C after aliquoting;

[0027] 2) Preparation of PEI40000 reagent

[0028] Take 1-6 μL of the PEI40000 mother solution obtained in step 1 and dilute it to 50 μL with a PBS solution having a pH of 7.2-7.4 to obtain a PEI40000 reagent having a PEI40000 concentration of 0.006-0.042 μg / μL;

[0029] 3) Mixing of vaccines and reagents

[0030] The PEI40000 reagent obtained in step 2) is diluted with a PBS solution having a pH of 7.2-7.4 and mixed with a fish hemorrhagic disease virus DNA vaccine to obtain a mixed reagent; the ratio of the fish hemorrhagic disease virus DNA vaccine to the PEI40000 reagent is 2.1 μg:2 μg;

[0031] 4) Fish processing

[0032] The mixed reagent obtained in step 3) was injected into the fish body through the peritoneal cavity or muscle. One day after the injection, 10 μL containing 3*10 5 pfu of fish hemorrhagic disease virus, and then observe and count the mortality rate 24 hours after virus injection. The ratio of fish body to fish hemorrhagic disease virus DNA vaccine is 0.3g:0.2μg.

[0033] Preferably, the fish hemorrhagic disease virus DNA vaccine comprises a G protein DNA vaccine of SVCV.

[0034] Preferably, the pH of the PEI40000 aqueous solution is adjusted to 6.8 using a sodium hydroxide (0.5-2 mol / L) solution.

[0035] Preferably, the PEI40000 aqueous solution is filtered using a 0.1-0.45 μm syringe filter.

[0036] Preferably, the PEI40000 aqueous solution is stored at 2-6°C when the concentration is 0.5-1.2 mg / mL.

[0037] Compared with the prior art, the present invention has the following advantages and effects:

[0038] The raw material PEI40000 used in the present invention is cheap, easy to obtain, safe and non-toxic. When the cell density is 70%-80%, the transfection efficiency can reach more than 80%, which is suitable for transient transfection and stable transfection; it is widely applicable to a variety of cell lines, with low toxicity and high expression; and the PEI40000 transfected cells have good morphology, can express a large amount of target protein, and have low cytotoxicity. The reagent containing PEI40000 provided in the present application is easy to store and has stable properties; and the preparation operation is simple: the solution can be directly prepared with distilled water, and it can be directly added to the culture medium containing serum, which is simple to operate and cost-effective; the research process of the present application verifies that the PEI40000 reagent significantly promotes the expression of exogenous plasmids in fish; different doses of PEI40000 can significantly enhance the expression of pcDNA5-Flag plasmid in black carp, and its expression time effect has a high overexpression level within 1-10 days. It was confirmed that the PEI40000 reagent significantly enhanced the protective effect of the fish hemorrhagic disease virus DNA vaccine and significantly increased the survival rate of diseased fish. Its effect was more significant than the common adjuvants in the prior art. It may become an effective adjuvant for a variety of DNA vaccines and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 The mRNA expression levels of TBK1 in spleen, liver and kidney in the presence or absence of PEI40000 in Example 3. E is a primer for detecting exogenous expression vector, and D is a primer for detecting total TBK1.

[0040] Figure 2 The protein level expression of the exogenous TBK1 plasmid carrying the Flag tag in fish in Example 3. TBK1 was detected using the Flag antibody, and β-actin was used as the internal reference gene.

[0041] Figure 3 This is a spleen tissue section after GCRV-II infection after the exogenous gene shown in Example 4 was overexpressed in the fish body mediated by PEI40000.

[0042] Figure 4 The survival rate of black carp after GCRV-II infection after the exogenous gene mediated by PEI40000 in Example 4 was expressed in the fish body.

[0043] Figure 5 These are typical symptoms of zebrafish infected with SVCV in Example 5.

[0044] Figure 6 This is the survival rate of the PEI40000-mediated DNA vaccine after expression in fish in Example 5.

[0045] Figure 7The protection rate of PEI40000 and maleimide for DNA vaccine in Example 6 DETAILED DESCRIPTION

[0046] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with the embodiments of the specification.

[0047] In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention may also be implemented in other ways different from those described herein, and those skilled in the art may make similar generalizations without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0048] Secondly, the term "one embodiment" or "embodiment" as used herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The term "in one embodiment" that appears in different places in this specification does not necessarily refer to the same embodiment, nor does it refer to a separate or selective embodiment that is mutually exclusive with other embodiments.

[0049] The test detection method used in the embodiments of the present invention is as follows:

[0050] Recombinant plasmid construction:

[0051] Use a virus-specific RNA extraction kit (FOREGENE, China) to extract mRNA, and obtain a cDNA template after reverse transcription. Use this template to perform a PCR reaction, that is, first denature at high temperature: heat the reaction mixture to 93-98°C and maintain it for a certain period of time to dissociate the double-stranded DNA into a single strand so that it can bind to the primer. Then anneal at low temperature: the temperature drops to 50-65°C, and the primers are paired with the complementary sequence of the template DNA single strand. Finally, extend at medium temperature: at a suitable temperature (generally 72°C), DNA polymerase uses dNTP to synthesize a new DNA chain to form double-stranded DNA. This process is repeated multiple times: the above three steps are repeated, and the amount of the target fragment doubles each cycle. Usually 25-35 cycles are used to amplify the target fragment (the sequence of the G protein of the carp spring hemorrhagic virus). The vector was changed from circular to linear using enzyme cutting, and the linear vector was homologously recombined with the target gene with homology arms, that is, the target gene was connected to the expression vector FRT / TO-pcDNA5 vector, and the sequence expressing the Flag tag was inserted into the vector, thus completing the construction of the recombinant vector with the Flag tag (G-vector).

[0052] qPCR detection

[0053] Clean the mortar, tweezers, and scissors one day in advance, wrap them with tin foil, and sterilize them at 180℃ for 4h. Grind the tissue in a fume hood: add 1mL Trizol, tissue blocks, and liquid nitrogen to the mortar and grind until liquid, then put it into an EP tube. (Liquid nitrogen should always be sufficient) Add 200μL chloroform to the EP tube, shake for 30s, let it stand on ice for 10min, and separate them into layers. After separation, centrifuge at 12000g for 10min, separate into three layers (upper layer: water phase; middle layer: DNA; lower layer: protein), transfer the supernatant to a new EP tube (do not aspirate the middle layer), add an equal amount of isopropanol to the EP tube, invert and mix, let it stand on ice for 10min, and then centrifuge at 12000g for 10min. Discard the supernatant and keep the precipitate. (Use a pipette to aspirate the supernatant as much as possible). Add 1mL of 75% ethanol to the EP tube, centrifuge at 12000g for 5min, discard the supernatant, and aspirate it clean. Add 1 mL of 100% ethanol to the EP tube, centrifuge at 12000g for 5 minutes, discard the supernatant, and aspirate clean. Open the EP tube, wait for 3 minutes, wait for the ethanol to evaporate, and aspirate clean again. Add 25-50 μL of DEPC water to dissolve the RNA. After measuring the concentration with an enzyme marker (the Tip is RNAse free). Run nucleic acid electrophoresis to check for RNA degradation. (Two relatively large bands 28S and 18S will appear. When testing, you need to replace it with a new electrophoresis buffer, and the Tip head needs to be RNAse free). Store at -80°C after detection. Use the Tiangen reverse transcription kit to obtain the cDNA template. Perform qPCR detection according to the specific corresponding qPCR procedure in the embodiment.

[0054] Protein Extraction:

[0055] Take out the prepared RIPA lysis buffer (Shenggong, C500005-0100) from -20℃, place on ice to dissolve, mix, and centrifuge instantly; prepare RIPA lysis buffer containing protease inhibitors. Weigh the tissue, cut into small pieces and put into a tube. Rinse the tissue block with pre-cooled PBS 3 to 5 times to remove the blood on the surface. Add pre-cooled RIPA lysis buffer containing protease inhibitors, and add 1mL of RIPA lysis buffer containing protease inhibitors to 250mg of tissue block. Homogenize with a glass homogenizer, homogenize at a low speed for 30s each time, and ice bath for 1min between each homogenization until the tissue is completely lysed. Place on ice for 30min, shake once every 10min, and shake for 1min each time. After sufficient lysis, centrifuge at 4℃, 14000rpm for 15min, and immediately transfer the supernatant to a new centrifuge tube and store at -80℃.

[0056] Immunoblotting assay:

[0057] a. Sample preparation: After the extracted protein sample was cooled to room temperature on ice, 20 μL of 5X SDS protein loading buffer (Yazyme, LT101S) was added, heated in a 100°C metal bath for 15 min, allowed to stand, cooled to room temperature and centrifuged;

[0058] b. Electrophoresis: Place the 10% SDS-PAGE gel prepared in advance in the electrophoresis tank, add an appropriate amount of electrophoresis buffer, take 30 μL of sample and load it, start electrophoresis at a constant current of 20 mA per gel, until the protein markers are clearly separated and it is convenient for subsequent experiments, then stop electrophoresis;

[0059] c. Transfer: After the electrophoresis, take the gel out of the card slot, pry open the glass plate, and stick the gel and PVDF membrane together tightly. Then put it into the wet transfer instrument. Make sure the gel is on the negative side of the power supply and the PVDF membrane is on the positive side. After adding the transfer buffer, the transfer operation parameters are 280V, 90min, and an ice bath is used for cooling during the process.

[0060] d. Antibody incubation: After the transferred PVDF membrane was washed with TBS, it was blocked with a protein-free rapid blocking solution at room temperature for 15 minutes. The mouse anti-Flag-Tag monoclonal antibody was diluted with an antibody diluent at a ratio of 1:5000, and the PVDF membrane was incubated at room temperature for 1 hour, then washed with TBS, and then incubated with a goat anti-mouse secondary antibody diluted at 1:30000 at room temperature for 1 hour, and then washed three times with TBST buffer (50mM Tris-Cl, 150mM NaCl, 0.1% Tween-20, pH7.5), and washed once with TBS buffer (50mMTris-Cl, 150mM NaCl, pH7.5). Each wash was shaken on a decolorizing shaker for 15 minutes;

[0061] e. Color development: After diluting the BCIP / NBT color development kit (Solarbio, China, PR1100) according to the ratio, incubate with the PVDF membrane in the dark. When the target band is clearly visible on the PVDF membrane, terminate the color development reaction with clean water.

[0062] Tissue sectioning and staining:

[0063] The spleen was separated and fixed with 4% paraformaldehyde, then dehydrated with dehydrating agents such as ethanol of increasing concentrations, and then transparentized with transparent agents such as xylene. The transparentized tissue sample was placed in a paraffin-xylene solution for wax treatment, and then the waxed tissue sample was placed in a paper boat, and then the paper boat was placed on cold water to accelerate the cooling process, and cooled to 26°C to obtain a wax block for embedding the sample. The wax block was adhered to the slicer, and the slicer was adjusted to cut into continuous wax strips, and then the wax strips were divided to obtain wax slices. The wax slice was placed on 45°C warm water for spreading, and then the wax slice was picked up with a glass slide, and the position of the wax slice was adjusted to be located in the center of the glass slide, and dried naturally. The naturally dried wax slice was placed in a pure xylene solution to remove the paraffin, and then placed in ethanol solutions of different concentrations for alcoholization treatment. Finally, the alcoholized slices were stained with hematoxylin-eosin and observed and photographed under a microscope.

[0064] PBS solution (Gino Biotechnology, catalog number: GNM20012-5)

[0065] Example 1: Safe dosage of PEI40000 in fish

[0066] 1.1 Preparation method of PEI40000 stock solution

[0067] PEI40000 (Yeasen, 40815ES) was dissolved in ultrapure water at room temperature. The pH of the obtained PEI40000 aqueous solution was adjusted to 6.8 with sodium hydroxide (1 mol / L) solution, and the PEI40000 mother solution was diluted to 1 mg / mL after filtering with a 0.1 μm syringe filter.

[0068] 1.2 Storage method of PEI40000 stock solution

[0069] 1 mL of the above PEI40000 mother solution was taken and stored at 4°C, -20°C and -80°C, and the PEI40000 mother solution stored at the above three temperatures for one week was used to transfect EGFP-N1 plasmid in EPC cells and HEK-293T cells, respectively. After 48 hours of transfection, a fluorescence microscope was used to take pictures and quantify the fluorescence signal. The results are shown in Table 1. At the concentration, the ability of the PEI40000 mother solution to transfect exogenous plasmids into cells was weakened after freezing, and the optimal storage condition of the reagent was 4°C.

[0070] Table 1

[0071] cell 4℃ -20℃ -80℃ EPC 48.88％ 33.63％ 31.82％ HEK-293T 90.73％ 74.65％ 72.94％

[0072] Note: The values ​​in the figure are transfection efficiency.

[0073] 1.3 Analysis of toxicity of PEI40000 to living organisms

[0074] 7 groups of 1 mg / mL PEI40000 stock solutions of different volumes were diluted to 50 μL with PBS solution (Shenggong, E607008) with a pH of 7.2-7.4, so that the final dosage of PEI40000 in each stock solution was 0.3, 0.6, 0.9, 1.2, 1.5, 1.8 and 2.1 μg, respectively, and a blank control concentration group, 7 stock solution injection concentration groups and a mother solution injection concentration group were set, and the groups were named 1, 2-8, and 9, respectively. The specific settings are shown in Table 2.

[0075] Healthy black carp weighing 3g±0.2g were selected, 10 in each group, and the above dilution was injected intraperitoneally using a syringe, as shown in Table 2. Feeding began 12 hours after injection, and then fed once every 12 hours, with a feeding amount of 1% of the fish body weight. After each feeding, the residual bait was collected, weighed after drying, and the residual bait rate was calculated for seven consecutive days. The results showed that during the 7-day feeding, no death occurred in each group, the weight gain of each group was basically the same, and the average residual bait rate for seven days did not change significantly. Therefore, at this concentration, PEI40000 did not cause harm to black carp.

[0076] Table 2

[0077] Grouping Dosage (μg) Volume (μL) Total weight (g) Quantity (end) 1 0.0 50 30.23 10 2 0.3 50 30.12 10 3 0.6 50 30.05 10 4 0.9 50 30.25 10 5 1.2 50 29.98 10 6 1.5 50 30.14 10 7 1.8 50 30.20 10 8 2.1 50 30.02 10 9 50 50 30.16 10

[0078] Table 3

[0079]

[0080] Example 2: Efficiency of PEI40000 in promoting exogenous plasmid expression

[0081] In Example 1, it was clarified that intraperitoneal injection of 1-21 μg PEI40000 per gram of fish did not affect the health of the fish. However, within this range, it is not clear which concentration and ratio can maximize the expression of exogenous plasmids in fish, and it is also unclear how long the method described in the present invention can make the exogenous plasmids continue to express in fish at the optimal concentration and ratio. Therefore, this example uses PEI40000 stock solutions of different dilutions configured in the same manner as in Example 1, and conducts orthogonal experiments with exogenous plasmids pcDNA5-Flag of different masses.

[0082] Here’s how to do it:

[0083] In the process of verification, the present invention uses a PEI40000 stock solution with a large dilution span and an exogenous plasmid pcDNA5-Flag for orthogonal experiments. Four groups of 0, 0.3, 1.5, and 2.1 μg were selected and combined with 0.5, 1, 2, and 3 μg of exogenous plasmid pcDNA5-Flag (expression vector) respectively, and 3g±0.2g of black carp were injected intraperitoneally, with 12 fish in each group, and feeding began 12 hours after injection. Subsequently, three fish were taken from each group 1 day, 4 days, 7 days, and 10 days after injection, and the viscera mixture was used for RNA extraction, and after reverse transcription, it was used for qPCR to identify the expression of the exogenous plasmid. During qPCR detection, the primers are:

[0084] bcβ-actin-QF (SEQ ID NO.1): TGGGCACCGCTGCTTCCT

[0085] bcβ-actin-QR (SEQ ID NO.2): TGTCCGTCAGGCAGCTCAT

[0086] pcDNA5-QF(SEQ ID NO.3):GGTAGGCGTGTACGGTGG

[0087] pcDNA5-QR(SEQ ID NO.4):TAGAAGGCACAGTCGAGG

[0088] qPCR reaction system: upstream primer (bcβ-actin-QF / pcDNA5-QF) 2.0 μL (10 pmol / μL), downstream primer (bcβ-actin-QR / pcDNA5-QR) 2.0 μL (10 pmol / μL), sample DNA 5 μL, Taq DNA polymerase (5 U / μL) 0.6 μL, real-time fluorescence PCR buffer (2×) 12.5 μL (prepared with 10× buffer 2.5 μL purchased from Takara, 2 μL of 10 mM dNTP, 0.0025 μL of 10000× SYBR green I and 8 μL of DEPC water), and sterile water was added to 25 μL. The PCR reaction conditions are: first, anti-contamination at 37℃ for 5min; then pre-denaturation at 95℃ for 3min; and finally amplification at 95℃ for 10sec, 60℃ for 40sec, for a total of 40 cycles, with fluorescence signal detection at the end of each extension cycle. The CT value of pcDNA5 was adjusted by the CT value of β-actin.

[0089] The results showed (Table 4) that when PEI40000 was not added, the ΔCT value of overexpression in black carp was less than 1 by intraperitoneal injection, while the addition of different doses of PEI40000 could significantly enhance the expression of pcDNA5-Flag plasmid in black carp, and its expression time was high within 1-10 days. In black carp weighing about 3g, after intraperitoneal injection, when 2-3μg of plasmid pcDNA5-Flag and 1.5-2.1μg of PEI40000 were used in a volume of 50μL, the expression of exogenous plasmid pcDNA5-Flag promoted by PEI40000 was basically the same, and the best expression combination was 2μg plasmid + 2.1μg PEI40000, that is, the best ratio was live weight (g): plasmid mass (μg): PEI40000 mass (μg) = 3:2:2.1.

[0090] Table 4 Effect of overexpression in fish ΔCT values

[0091]

[0092] Note: The values ​​in the table are the ΔCT values ​​after pcDNA5-β-actin adjusted the CT values.

[0093] Example 3: PEI40000 promoted the expression of TBK1 (TANK binding kinase 1) in black carp.

[0094] In Example 2, the optimal usage ratio of PEI40000 was determined. The black carp TBK1 was connected to the FRT / TO-pcDNA5 vector and transformed into Escherichia coli. The correct FRT / TO-pcDNA5-TBK1 plasmid was obtained after colony PCR screening. The above ratio (2 μg plasmid + 2.1 μg PEI40000) was used to detect the ratio of intraperitoneal injection expression in black carp.

[0095] Healthy black carp weighing about 3 g were divided into two groups, with six fish in each group. Each group was injected with 50 μL of the following solution:

[0096] A: PEI40000(2.1μg)+TBK1(2μg)

[0097] B: TBK1 (2 μg)

[0098] The above reagents were diluted to 50 μL with PBS. Intraperitoneal injection was performed. The spleen, liver and kidney of three black carps were harvested 4 days after injection, and some were used for WB test to detect the protein expression level of exogenous plasmid; some were used for qPCR detection. In order to detect the overexpression efficiency of TBK1, we designed two pairs of TBK1 detection primers. The first pair was named endogenous D primer pair, which can detect the expression of exogenous overexpressed TBK1 and endogenous TBK1; the second pair of primers was named E exogenous primers, because its 5' end primer was designed on the exogenous vector, so it can only detect exogenously expressed TBK1. The detection primer information is as follows:

[0099] D Primer Pair:

[0100] bcTBK1-qF(SEQ ID NO.5):AAGTACAGCCACGCTACGAC

[0101] bcTBK1-qR (SEQ ID NO.6): TGAGATACGCCTGCGGTTTG

[0102] Primer pair E

[0103] pcDNA5-qF(SEQ ID NO.7):GGTAGGCGTGTACGGTGG

[0104] pcDNA5-TBK1-qR (SEQ ID NO.8):CGTCCAGCGGACGCAGGAAGCT

[0105] Internal reference primer pair

[0106] bcβ-actin-QF (SEQ ID NO.9): TGGGCACCGCTGCTTCCT

[0107] bcβ-actin-QR (SEQ ID NO.10): TGTCCGTCAGGCAGCTCAT

[0108] qPCR reaction system: upstream primer 2.0 μL (10 pmol / μL), downstream primer 2.0 μL (10 pmol / μL), sample DNA 5 μL, Taq DNA polymerase (5 U / μL) 0.6 μL, real-time fluorescence PCR buffer (2×) 12.5 μL (prepared with 10× buffer 2.5 μL purchased from Takara, 2 μL of 10 mM dNTP and 0.0025 μL of 10000× SYBR green I and 8 μL DEPC water), supplemented with sterile water to 25 μL. The results showed that, as Figure 1, PEI40000 group significantly enhanced the mRNA expression level of TBK1 in black carp, among which the highest mRNA level was detected in spleen, with relative expression multiples of 38.76 and 44.2 times detected by exogenous primers and endogenous primers, respectively. It was also well expressed in liver, with relative expression multiples of 29.3 and 33.3 times detected by exogenous primers and endogenous primers, respectively. The results showed that PEI40000 can significantly enhance the expression of exogenous plasmids in black carp.

[0109] The spleen and liver of black carp were extracted and ground, and then the protein was extracted using ripa lysis buffer. Protease inhibitors and phosphatase inhibitors were added during the extraction process. It was then used in WB experiments, and the expression of TBK1 was detected using anti-Flag monoclonal antibodies. The results showed that ( Figure 2 ), and the protein level of TBK1 was obviously overexpressed in group A.

[0110] Example 4: PEI40000 promotes overexpression of TBK1 (TANK binding kinase 1) and IRF5 (interferon regulatory factor 5) to promote the body's defense against grass carp reovirus (GCRV)

[0111] Healthy black carp weighing about 3g were divided into 5 groups, each with 13 fish. One group was not treated and was called MOCK group. The other four groups were injected intraperitoneally with 50μL of solution diluted with PBS containing the following ingredients and contents:

[0112] A: MOCK

[0113] B: pcDNA5(2μg)+PEI40000(2.1μg)

[0114] C: TBK1(1μg)+pcDNA5(1μg)+PEI40000(2.1μg)

[0115] D: IRF5(1μg)+pcDNA5(1μg)+PEI40000(2.1μg)

[0116] E: TBK1(1μg)+IRF5(1μg)+PEI40000(2.1μg)

[0117] One day after the plasmid was injected, the black carp was gavaged with GCRV-II (GD108, Guangdong). Example 3 verified that the injected TBK1 treated by this method was strongly expressed in the spleen and liver. Therefore, three black carps were taken from each group four days after gavage, and the tissue samples were fixed, sliced, stained, and obtained. Figure 3The results shown are described in the "Tissue Sectioning and Staining" section of the previous method. Overexpression of TBK1 and IRF5 led to increased intercellular spaces in the spleen after GCRV-II infection.

[0118] Subsequently, this example continued to observe and record the mortality of black carp after GCRV-II intragastric administration every 12 hours ( Figure 4 ). The results showed that the overexpression of TBK1 and IRF5 in black carp mediated by PEI40000 could maintain the survival rate of black carp at 44.4% when infected with GCRV-II, which indicated that the co-overexpression of TBK1 and IRF5 treated by this method could significantly inhibit the mortality of black carp infected with GCRV-II.

[0119] Example 5: PEI40000 promotes the protection rate of SVCV virus DNA vaccine.

[0120] The present invention takes the DNA vaccine constructed by the glycoprotein expression vector of SVCV virus as an example, and uses the model organism zebrafish as the implementation object to illustrate whether the present invention can enhance the protective efficacy and protection rate of the viral DNA vaccine.

[0121] The PEI40000 reagent used in this example is the same as that in Example 1; the G protein DNA vaccine used is a homemade recombinant vector in which the DNA sequence expressing the G protein is connected to the FRT / TO-pcDNA5 vector. The preparation method is shown in the recombinant plasmid construction section of the specific embodiment. The SVCV strain used is SVCV741, and the titer of the SVCV strain used this time is 3*10 8 pfu / mL, the method of use is intraperitoneal injection, the injection dose for each 0.3g zebrafish is 3*10 5 pfu, the total injection volume was 10 μL (diluted with PBS), and 2 days after injection, zebrafish showed obvious punctate bleeding and then died one after another. Figure 5 .

[0122] According to the ratio of Example 2, a zebrafish weighing 0.3 g was intraperitoneally injected with the following solution diluted to 10 uL with PBS solution:

[0123] A: PEI40000 (0.21 μg)

[0124] B: G-vector (0.2 μg)

[0125] C: G-vector(0.2μg)+PEI40000(0.21μg)

[0126] One day after injection, 10 μL containing 3*10 5pfu of SVCV, and then observed and counted the mortality rate 24h after virus injection. Figure 6 As shown, the G protein DNA vaccine treated with PEI40000 can make the survival rate of zebrafish reach 45.45% 132 hours after SVCV infection, while the survival rate of zebrafish in the group using only the G protein DNA vaccine was 11.15%, and the survival rate of the group injected with PEI40000 and the untreated group was 0. These significant SVCV G protein DNA vaccine (G-vector) has a certain protective efficiency in zebrafish, and PEI40000 can promote the protective efficiency of SVCV virus G protein DNA vaccine.

[0127] Example 6: PEI40000 is stronger than maleimide as an adjuvant for SVCV G protein DNA vaccine

[0128] Maleimide is a common DNA vaccine adjuvant. To clarify whether PEI40000 described in the present invention can be used as an efficient DNA vaccine adjuvant. In this example, maleimide and PEI40000 were used for comparison. According to the ratio of Example 2, zebrafish weighing 0.3g were intraperitoneally injected with the following solution diluted to 10uL with PBS solution:

[0129] A: PBS

[0130] B: G-vector(0.2μg)+PEI40000(0.21μg)

[0131] C: G-vector (0.2 μg) + maleimide (0.21 μg)

[0132] One day after injection, 10 μL containing 3*10 5 pfu of SVCV, and then observe and count the number of deaths 24 hours after virus injection, and calculate the vaccine protection rate, which is (the incidence rate of the control group - the incidence rate of the vaccination group) / the incidence rate of the control group * 100%, where the control group is the above-mentioned group A. Figure 7 As shown, the protection rate of the G protein DNA vaccine treated with PEI40000 was 54.21%, while the protection rate of the G protein DNA vaccine treated with maleimide was 33.03%. Therefore, the effect of PEI40000 as an adjuvant for the G protein DNA vaccine of SVCV is significantly stronger than that of maleimide. The present invention uses PEI40000 to promote the expression of exogenous plasmids in fish, which is expected to assist in the study of antiviral mechanisms. Furthermore, PEI40000 can promote the protection efficiency of the G protein DNA vaccine of SVCV, and is expected to promote the research and development of the DNA vaccine of SVCV. In summary, the present invention provides a new use of PEI40000 to promote the expression of exogenous DNA in living fish.

[0133] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention can be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the present invention.

Claims

1. A method for promoting transient overexpression of exogenous genes in fish based on PEI40000, characterized in that: The steps include: 1) Prepare PEI40000 stock solution Dissolve PEI40000 in ultrapure water, adjust the pH to 6.5-7.0, filter and dilute to a PEI40000 mother solution with a concentration of 0.5-1.2 mg / mL, and store at 2-6°C after aliquoting; 2) Preparation of PEI40000 reagent The PEI40000 mother solution obtained in step 1) is diluted with a PBS solution to obtain a PEI40000 reagent having a PEI40000 concentration of 0.006 to 0.042 μg / μL; 3) Preparation of exogenous plasmid Mixing one or more exogenous target gene mixtures with a PBS solution to obtain an exogenous plasmid reagent; 4) Promote expression The PEI40000 reagent prepared in step 2) is mixed with the exogenous plasmid reagent prepared in step 3), and injected into the fish body through the abdominal cavity or muscle, and feeding is started 12 hours after injection, and the effect of promoting the overexpression of the exogenous gene in the fish body is produced within 10 days after injection; The pH of the PBS solution is 7.2-7.

4.

2. The method according to claim 1, characterized in that When the fish is injected intraperitoneally or intramuscularly in step 4), the ratio of the fish to the exogenous plasmid reagent is 1 g: 0.5 μg to 1 μg; the ratio of the exogenous plasmid reagent to the PEI40000 reagent is 1 μg: 1 μg to 3 μg.

3. The method according to claim 1, characterized in that The exogenous target gene is TBK1 and / or IRF5.

4. Application of PEI40000 in the preparation of adjuvants to enhance the protection rate of fish hemorrhagic disease virus DNA vaccine.

5. An adjuvant for enhancing the protection rate of fish hemorrhagic disease virus DNA vaccine, characterized in that: Including PEI40000.

6. Application of PEI40000 in enhancing the protection rate of fish hemorrhagic disease virus DNA vaccine, characterized in that: The steps include: 1) Prepare PEI40000 stock solution Dissolve PEI40000 in ultrapure water at room temperature, adjust the pH of the obtained PEI40000 aqueous solution to 6.8 with sodium hydroxide solution, filter with a 0.1-0.45 μm filter, and then adjust the volume to a PEI40000 mother solution with a PEI40000 concentration of 1 mg / mL, and store at 2-6°C after aliquoting; 2) Preparation of PEI40000 reagent The PEI40000 mother solution obtained in step 1) is diluted with a PBS solution to obtain a PEI40000 reagent having a PEI40000 concentration of 0.006 to 0.042 μg / μL; 3) Mixing of vaccines and reagents The PEI40000 reagent obtained in step 2) is diluted with a PBS solution and mixed with the fish hemorrhagic disease virus DNA vaccine to obtain a mixed reagent; 4) Fish processing The mixed reagent obtained in step 3) is injected into the fish body through the abdominal cavity or muscle, and the fish hemorrhagic disease virus is injected after 1 day, and the vaccine protection rate is detected after 24 hours; The ratio of the fish hemorrhagic disease virus DNA vaccine to the PEI40000 reagent is 2.1 μg:2 μg; The ratio of the fish body to the fish hemorrhagic disease virus DNA vaccine is 0.3 g:2.1 μg.

7. The use of PEI40000 in enhancing the protection rate of fish hemorrhagic disease virus DNA vaccine according to claim 6, characterized in that: The fish hemorrhagic disease virus is carp spring viremia virus SVCV or grass carp reovirus GCRV.

Images